Biology Exam 4
Which of the following statements about transcription in bacteria and eukaryotes is true?
Bacteria and eukaryotes rely on proteins that recognize specific DNA sequences in the promoter to initiate transcription
Which of the following statements about transcription in bacteria and eukaryotes is true?
Bacteria and eukaryotes rely on proteins that recognize specific DNA sequences in the promoter to initiate transcription.
Which of the following statements about translational initiation in bacteria is true?
Bacteria use only one RNA polymerase to transcribe RNA whereas eukaryotes use three.
Which of the following statements is true?
Bacterial and archaeal genomes are compact.
Which of the following statements is incorrect?
Bacterial genomes are full of interrupted coding sequences
Which of the following statements is incorrect?
Bacterial genomes have no apparent relationship between their genome size and gene number
Which of the following is a similarity between receptor tyrosine kinases and G protein- coupled receptors?
Both are plasma membrane receptors
In what sense are studies by 19th-century naturalists and those by early 21st-century genomic biologists similar?
Both focused on observing and describing what exists in their realms of investigation.
Signal receptors for lipid-soluble and hydrophilic (Lipid soluble) hormones are similar in which of the following ways?
Both receptors types change shape upon hormone binding
In sequencing a genome of 2 million base pairs, which of the following steps would occur first?
Break the DNA into smaller fragments (~160 kb).
Which option lists the steps of transcription initiation in the proper order?
Chromatin remodeling, exposure of promoter and regulatory sequences, assembly of proteins, proteins contact core promoter
In the diagram of the extracellular matrix of an animal cell which term is best represented by the letter A?
Collagen
Which of the following proteins is most abundant in the extracellular matrix?
Collagen
Which of the following considerations is important when attempting to amplify a gene by PCR?
Finding primers that are complementary to both sides of the gene of interest
What is gene annotation in bioinformatics?
Finding transcriptional start and stop sites, RNA splice sites, and ESTs in DNA sequences
Which of the following addresses questions about what genes actually do?
Functional genomics
Which of the following is an example of signal deactivation?
GTP bound to Ras becomes hydrolyzed to GDP
Which of the following is an example of deactivation?
GTP to Ras becomes hydrolyzed to GDP
Which of the following connections between cells resembles channels?
Gap junction
Which of the following structures allows ions to pass between cells to coordinate cardiac muscle contractions?
Gap junctions
Which of the following describes gene families?
Gene families are closely related genes that derived by gene duplication and divergence.
Which of the following is not true of cDNA produced using mRNAs from human brain tissue as the starting material?
It could be used to create a complete genomic library.
Plasmodesmata is a structure in which all of the following types of cell?
Plant cell
Which of the following would not be true of cDNA produced using mRNAs from human brain tissue as the starting material?
It could be used to create a complete genomic library.
What happens when an open reading frame (ORF) is identified in a new whole-genome sequencing project?
It is compared to other known genes and identified as a likely gene if there is a lot of similarity to known genes.
Which of the following statements best describes a eukaryotic promoter?
It is found upstream of the gene and contains the TATA box.
Which of the following best describes the significance of the TATA box in eukaryotic promoters?
It is the binding site for a transcription factor.
If a bacterium were to develop resistance to an antibiotic, which of the following methods would most likely result in the development of antibiotic resistance in other species of bacteria that are located in close proximity to the resistant bacteria?
Lateral gene transfer
Which of the following statements concerning lateral gene transfer is true?
Lateral gene transfer can occur between unrelated species of bacteria.
Second messengers are important for which of the following signals?
Lipid-insoluble hormones
Which of the following must occur for shotgun sequencing to work effectively?
Many copies of each genome are cut into 1 kb fragments that are sequenced, and overlapping sections are aligned to create a draft of the genome sequence.
In a eukaryotic cell , which of the following statements about post-translation modification of proteins is true?
Many proteins are modified chemically after they are synthesized
In a eukaryotic cell, which of the following statements about post-translational modification of proteins is true?
Many proteins are modified chemically after they are synthesized.
What is the difference between a linkage map and a physical map?
Markers are spaced by recombination frequency on a linkage map and by number of base pairs on a physical map.
Which of the following fields attempts to catalog all of the genes present in a microbe community?
Metagenomics
Which of the following enzymes initiate a phosphorylation cascade?
Mitogen- Activated protein kinases
Which of the following is in the phosphorylation cascade?
Mitogen-acticated protein kindases (MAPK)
According to the wobble hypothesis___.
More than one codon codes for an amino acid, and codons for the same nucleotides in the first two positions.
Which of the following is the function of nucleosomes?
Nucleosomes are important in the organization and the compaction of DNA
A long stretch of codons that lacks a stop codon is termed which of the following? (Hint: it's a good indication of protein-coding sequences.)
Open reading frame
What causes turgor pressure in plant cells?
Osmosis of water into the plant cell as a result of solutes inside the cell.
What is a primary difference between polymerase chain reaction (PCR) and traditional cloning procedures such as those that use plasmids?
PCR eliminates the need for restriction enzymes, vectors, and cells
Pax-6 is a gene that is involved in eye formation in many vertebrates, such as Drosophila. Pax-6 is also found in vertebrates. A Pax-6 gene from a mouse can be expressed in a fly and the protein (Pax-6) leads to a compound fly eye. This information suggests which of the following?
Pax-6 is highly conserved and shows shared evolutionary ancestry.
Which of the following is a function of a pheromone?
Pheromones are used by yeast cells to recognize mates
What is the correct order for the following structures in plants, if the first one listed is in contact with the cytoplasm?
Plasma membrane, secondary cell wall, and primary cell wall.
How can genes move so readily between different species of bacteria?
Plasmids may move genes between different organisms, and bacteria scavenge DNA from their environment.
Predict which type of receptor would contain a DNA-bbinding domain, allowing it to bind and direct changes to gene expression when activated.
Steroid hormone receptor.
Which of the following is focused on the emergent properties that result from interactions between individual parts of a system?
Systems biology
The ____________ of the eukaryotic promoter is analogous to the __________ of the bacterial promoter.
TATA box; -10 box
Which of the following is involved in the first step of initiating transcription?
TATA-binding protein (TBP)
Once a core promoter that contains a TATA box has been exposed by chromatin remodeling, the first step in initiating transcription is binding of ________.
TATA-binding proteins
What information is critical to the success of the polymerase chain reaction (PCR) itself?
The DNA sequence of the ends of the DNA to be amplified must be known.
What would happen if there were a mutation in reverse transcriptase that prevented it from binding to a LINE mRNA?
The new LINE copy would not be inserted into the genome.
Regulatory transcription factors such as enhancers are binding sites for _______ that regulate transcription, whereas silencers are binding sites for _____________ that regulate transcription.
activators; repressors
Ribosomes translate mRNAs into proteins with the help of ____________.
adaptor molecules called tRNAs
For disorders like Huntington's disease, sickle-cell anemia, and cystic fibrosis, which are caused by mutations in a single gene, ____________ is a possible approach to treatment that involves replacing or augmenting defective copies of the gene with normal alleles.
gene therapy
Bacterial enzymes that cut DNA molecules at specific base sequences (recognition sites) are __________.
restriction endonuclease
The enzyme __________ catalyzes the synthesis of DNA from an RNA template. DNA that is produced from RNA is called __________.
reverse transcriptase; complementary DNA
Which of the following cell types are likely to contain tight junction?
Cells lining the stomach.
Which of the following is the tightly coiled DNA-protein complex?
Chromatin
Which of the following mechanisms utilizes histone acetyltransferases?
Chromatin remodeling
Which of the following statements correctly describes the difference between a genome sequence and a gene clone?
A genome sequence contains many different DNA sequences; a gene clone contains one type of DNA sequence.
Across a wide range of species, a function cannot yet be assigned to __________ percent of genes.
15 to 30
How many DNA molecules would there be after four rounds of PCR if the initial reaction mixture contained two molecules?
32
In what direction is RNA synthesized during transcription?
5' to 3'
Taking into account the wobble hypothesis, which if the following mRNA sequences could be bound to the tRNA anticodon for 3'GGC5'?
5'CCA3'
Which of the following best describes the spliceosome?
A complex molecular machine that splices introns out of pre-mRNA
An unknown cell is investigated and determined to be eukaryotic. Which of the following results would support the conclusion that the cell type is eukaryotic?
A large number of proteins regulating transcription are present, and there are no operons.
If there were a mutation in a ribosome that prevented tRNA molecules from moving to the E site, how many amino acids can be found in the resulting peptide chain?
A maximum of two
What is the symplast?
A portion of the plasma membrane in which the cytoplasms of different cells are connected by plasmodesmata
In the diagram of the extracellular matrix of an animal cell which term is best represented by the letter D?
Actin
Which of the following are responsible for recruiting chromatin-remodeling proteins?
Activators
Which of the following will speed up the rate of transcription?
Activators
In general, protein kinases act to____.
Add phosphate groups to proteins
The control of gene expression in bacteria and eukaryotes is broadly similar, but not identical. Which of the following is/are fundamentally different in bacteria and eukaryotic gene expression?
All of these are fundamental differences in the control of gene expression between bacteria and eukaryotes.
Which of the following is a role played by "activated" p53?
All of these are roles played by activated p53 Promotes transcription of genes for cell cycle arrest Promotes transcription of genes for DNA repair Promotes transcription of genes for apoptosis
Which of the following is/are post-transcriptional controls?
All of these mechanisms are post-transcriptional controls
During Transcription, which of the following describes the role(s) of a mediator? (think transcription)
All statements describe the role of a mediator
What does it mean when a gene for a given phenotype is closely linked to a gene that may cause a disease?
Almost all the individuals who inherit the gene for the given phenotype also inherit the disease.
Which of the following processes explains why one DNA sequence can express different protein products?
Alternative RNA splicing
Researchers report that a protein is encoded by a gene with four promoters that give rise to at least eight different mRNAs. What mechanism could account for the production of these different mRNAs from the same gene?
Alternative splicing
Which of the following aspects of transcription initiation in eukaryotes involves spliceosomes?
Alternative splicing of mRNAs
What is/are the main advantages of 2nd messengers?
Amplification and speed
What is/are the main advantages of second messengers?
Amplification and speed
Which of the following would most likely be considered an open reading frame (ORF)?
An ATG codon followed by 3n in-frame nucleotides and a TGA codon
Which of the following types of information is provided by a cDNA microarray experiment?
An overview of the difference in mRNA expression profiles between two different cell types
Desmosomes are associated with which of the following?
Anchoring junctions
Which of the following statements of cadherins is true?
Cadherins mediate binding interactions between cells.
Which of the following second messengers bind to calmodulin?
Calcium ions (Ca2+)
Which of the following occurs during signal reception?
Conformational change of the receptor
Which of the following terms is defined as a regulatory sequence in eukaryotes that is a specific sequence for RNA polymerase to bind to?
Core promoter
Several different intracellular pathways interact and result in the modification of a cellular response that would be different if these pathways did not interact. Which best describes this interaction of intracellular pathways?
Crosstalk
Which of the following is an example of an intracellular receptor?
Cytosolic receptor proteins
Which of the following is a technique for identifying individuals based on the unique features of their genomes?
DNA fingerprinting
How can the 2 meters of DNA found in a typical human cell be packed into a nucleus that is only a few micrometers in diameter?
DNA is associated tightly with histone proteins in nucleosomes, which pack the DNA compactly.
Why is there an association between DNA and histones?
DNA is negatively charged, and histones are positively charged.
Which of the following tools of recombinant DNA technology is incorrectly paired with its function?
DNA ligase; cutting DNA to create ʺsticky endsʺ of restriction fragments
What would happen to DNA wrapped in histones in the event of transcription?
DNA wrapped around histones is not transcribed and is protected from degradation by nucleases.
J. Craig Venter and his team used the following approach to study microbial species in the Sargasso Sea: Collect random samples of microbes from a particular environment. Extract DNA. Fragment and clone the DNA in preparation for sequencing. Sequence millions of randomly selected clones. Store this information on a computer and apply algorithms to assemble overlapping sequences from single species. Analyze such features as the total number of genes and the number and identity of newly discovered genes. Estimate the total number of microbial species. The authors reported the identification of 1,800 microbial species in their samples, including 148 unknown species. Additionally, 1.2 million formerly unknown genes were discovered. The team had to identify which of the millions of randomly generated sequences came from the same organism. The first step of this procedure involved searching for sequence overlaps from different clones. The algorithms typically used for sequence assembly ignore repeated sequences. However, this team had to modify the algorithms in order to accurately analyze DNAs from so many pooled species. Why was this necessary?
DNAs from abundant organisms would occur frequently in the sample, making them look like repetitive DNAs
An estimated 25 to 30% of all human cancers are linked to...
Defective Ras.
Which of the following connections between cells resemble rivets?
Demosomes
Which of the following is the correct order for one cycle of polymerase chain reaction (PCR)?
Denature DNA, anneal primers, extend primers
If two cells are connected by the cytoskeleton, which of the following structures would the cell have?
Desmosomes
Which of the following statements about cell-attachment is true?
Desmosomes link the cytoskeletons of adjacent cells.
Forming specialized cell types and arranging them into tissues best describes which of the following processes?
Differential gene expression
Dihysterone is a lipid-based molecule that is important in the development of secondary sex characteristics. Which of the following scenarios best describes how dihydrotestosterone could act as a chemical signal?
Dihydrotestotestorne binds to the receptor, located in the cytosol, and the receptor goes through a conformational change.
Plant cells that do not produce lignin_______.
Do not produce wood
Which of the following is not a possible result of transposable elements moving about a genome?
Enhancing the activity of a gene by landing in the middle of the open reading frame
Which of the following binds to receptors inside the cells?
Estrogen
Why are mRNA sequences generally used in the study of genome sequences in eukaryotes?
Eukaryotes have a number of introns in their genes, so it is difficult to determine the coding regions when viewing the DNA sequences
What are two mechanisms used for turning genes off in eukaryotic cells?
Genes are turned off when chromatin remains condensed or when a regulatory protein binds to a silencer.
What is a gene family?
Genes within a species that are similar to each other in structure and probable function, but may have some nonfunctional members
____________ is the effort to sequence, interpret, and compare whole genomes, while ____________ is the is the large-scale study of all the proteins in a cell or organism.
Genomics; proteomics
A similarity between plant and animal cells is that both
Have a ground substance composed primarily of gel-forming polysaccharides
Which of the following act(s) to physically block the promoter and the proteins required to initiate transcription?
Histones
Which of the following consists of DNA complexed with histones and other proteins?
Histones
What are histones?
Histones are proteins associated with DNA to form chromatin
In bacteria, sigma binds to the polymerase before transcription begins. Bacterial RNA polymerase and sigma form which of the following?
Holeoenzyme
What factors are not significant when deciding which organisms should have their genomes sequenced?
How much the project will likely cost (based on the size of the genome)
Which of the following is the most likely explanation for why humans have so many fewer genes than was predicted prior to the sequencing of the human genome?
Human genes are very often alternatively spliced, leading to the potential of many proteins being produced from a single gene.
Which of the following is the correct sequence of events in cloning a gene into a plasmid?
Identify a restriction site for use in cloning, attach the restriction site to the DNA ends, add restriction endonuclease to the plasmid and DNA, and use ligase to seal the inserted gene into the plasmid.
In comparison to bacterial transcription, eukaryotic transcription is more complex. Which of the following statements best describes why eukaryotic transcription is more complex?
In eukaryotic transcription, the promoters are more diverse, and the primary RNA transcript must be extensively processed.
In bacteria, larger genomes typically mean a wider array of metabolic capabilities. Given that parasitic bacteria make use of much of the host's biochemical machinery, what can be inferred about the general size of parasite genomes?
In general, parasitic bacteria have genomes that are smaller in size compared to nonparasitic bacteria.
The process of translation, whether in bacteria or eukaryotes, requires tRNAs, amino acids, ribosomal subunits, and __________.
Initiatoin and elongation factors, plus GTP
Once a researcher has created a cDNA library of mRNA produced by a given cell type, what would be the next step in producing large numbers of cDNA molecules of a specific mRNA?
Insert the cDNA of a given gene into a bacterial plasmid.
In the diagram of the extracellular matrix of an animal cell which term is best represented by the letter C?
Integrin
Which of the following are most easily shared by adjacent plant and animal cells?
Ions
Sickle-cell disease is a recessive genetic disorder in which hemoglobin is improperly folded, leading to the breakdown of red blood cells. Which would be the first step in finding the gene involved in this disorder?
Isolate mrRNA from bone marrow and spleen cells, where red blood cells are synthesized, from an individual with sickle-cell disease
If a cDNA library in E. coli is screened for a growth hormone gene, what would be the best next step after identifying potential colonies with the gene?
Isolate proteins from the colonies to determine whether they are synthesizing functional growth hormone.
Which of the following statements about the p53 protein (a tumor suppressor) is true?
It activates genes that induce apoptosis in cells with extensively damaged DNA
A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). To compare a specific region of the DNA from the sample with DNA from living birds, which of the following would be most useful for increasing the amount of dodo DNA available for testing?
Polymerase chain reaction (PCR)
What is the term for a complex of mRNA bound with multiple ribosomes, each synthesizing its own polypeptide strand?
Polyribosome
Microfibils and pectins are associated with which of the following?
Primary cell wall
In a single polymerase chain reaction (PCR) cycle consisting of 15 seconds at 94°C, 30 seconds at 50°C, and 1 minute at 72°C, what is happening in the step run at 50°C?
Primers are annealing to DNA to be amplified.
Which of the following is a location where RNA polymerase binds?
Promoter
Which of the following recognize ubiquitin?
Proteasomes
To label amino acids within cells, researchers "pulsed" E. coli with radioctive sulfate. They observed that radioactivity was first associated with ribosomes and then later with completed proteins. The biologists concluded that____.
Protein synthesis by ribosomes and are subsequently released
In the diagram of the extracellular matrix of an animal cell which term is best represented by the letter B?
Proteoglycan
Which of the following involves the analysis of all of the proteins being expressed in a cell or organism's system at one time?
Proteomics
Which of the following is an example of post-translational control?
Protoeasome recognizes ubiquitin on a protein
The bacteria Pseudomonas derginosa form a biofilm only when they reach a certain density. Below this density a biofilm will not form. Which of the following processes allow these bacteria to detect density?
Quorum sensing
What prevents the DNA coding strand and RNA from matching exactly in base sequence?
RNA has the base uracil (U) rather than the thymine (T) found in the coding strand. Adenine (A) in the DNA template strand specifies a U in the complementary RNA strand.
During the process of RNA interference, double-stranded miRNA precursor is separated by which of the following?
RNA helicase
Which of the following transcribes protein-coding genes in eukaryotes?
RNA polymerase II
In eukaryotes, transcription normally stops when___.
RNA polymerase reaches a termination signal on the DNA that leads to the formation of a hairpin loop in the mRNA.
Which of the following statements best describe the termination in bacteria?
RNA polymerase transcribes a terminator sequence, causing the polymerase to separate from the DNA and release the transcript.
Which of the following statements best describes the termination of transcription in bacteria?
RNA polymerase transcribes a terminator sequence, causing the polymerase to separate from the DNA and release the transcript.
In transcription, ___________ produces an RNA molecule with a base sequence complementary to the base sequence of the _____________.
RNA polymerase; DNA template strand
Modifications needed for converting a primary transcript into a mature RNA are called
RNA processing
Modifications needed for converting a primary transcript into a mature RNA are called ________.
RNA processing
Which of the following statements is true about protein production in eukaryotes?
Splicing patterns in mRNA are critical to protein formation
How are Ras proteins activated
Ras proteins are activated when Ras is bound to guanosinetriposphate (GTP)
Which of the following might be an open reading frame? Why? This figure illustrates an open reading frame.
Reading frame 3
Which of the following signal receptors is true?
Receprtors change conformation upon signal binding.
What is the correct order for the 3 steps in signal transduction?
Reception, Transduction, response
Which of the following best describes an enhancer?
Region of DNA that may be located more than 100,000 base pairs away
Which of the following steps for terminating translation are correct and in the right order?
Release factor binds to stop codon; polypeptide and uncharged tRNAs are released; ribosome subunits separate
Which of the following will decrease the rate of transcription?
Repressors
If mRNAs could be ligated and replicated within plasmids, what enzyme commonly used in recombinant DNA technology would no longer be needed?
Reverse transcriptase
Which of the following is required to make complementary DNA (cDNA) from RNA?
Reverse transcriptase
During elongation, what substrates are used for the polymerization reaction catalyzed by RNA polymerase?
Ribonucleoside triphosphates
To locate and isolate genes associated with a particular disorder in humans, researchers look for __________.
SNPs, where one allele is found more often in persons with a particular disorder than in healthy controls
What are transposable elements?
Segments of DNA that insert themselves into new locations within a genome
What is the function of the plasma membrane?
Separates the cell's content from the environment.
In addition to RNA polymerase, transcription in eukaryotes requires which of the following?
Several transcription factors
Which of the following are proteins that associate with promoters in bacteria during transcription?
Sigma
Which of the following statements about cell signaling is true?
Signal pathways that involve plasma membrane receptors often reproduce signal amplification.
Beta-blockers affect which step of signal transduction?
Signal reception
The drug taxmen binds to estrogen receptors in cancer cells but does not activate the receptor. This prevents estrogen from binding to the estrogen receptor. Which part of the signal transduction pathway is altered when a patient takes tamoxifen?
Signal reception
What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?
Six
Which of the following statements best describes bacterial genomes?
Some bacteria contain genes that appear to have originated from other bacterial species.
Which is the correct description of transformation in bacteria?
The assimilation of external DNA into a cell
Which of the following defines a genome?
The complete set of an organism's genes and other DNA sequences
Which of the following resulted from determining the sequence of the Huntington's gene?
The creation of animal model of Huntington's disease
Which of the following best describes the difference between bacteria and eukaryotic DNA packaging?
The default transcription state in eukaryotes is "off," whereas the default state in bacteria is "on."
How can gene expression change in an individual cell in a multicellular eukaryotic organism?
The expression of specific genes is turned on or off by signal pathways activated by molecules secreted by nearby or distant cells.
Which of the following statements about the extracellular matrix in organisms is true?
The extracellular matrix is a fiber opposite that provides strength
How might researchers investigate similarities between a newly sequenced mammalian genome and others that were previously sequenced?
The genomic sequences for both organisms would be compared using computers and sophisticated algorithms.
What would be the most likely result of forgetting to treat filters with a chemical to make the DNA single-stranded while probing a cDNA library?
The labeled probe would not bind to the double-stranded DNA.
During crossing over in meiosis I, repeats misalign, resulting in products that have a different number of repeats. In a comparison of the pattern of repeat sequences in dizygotic (nonidentical or fraternal) twin brothers, what is the most likely finding?
The number of repeats would be different between the two brothers.
In smooth and striated muscle cells, the DNA for tropomyosin is the same, yet the mRNAs produced are different. Which statement explains this phenomenon?
The production of proteins that influence the splicing patterns of the mRNA are different.
Predict what would happen if a mutant Ras protein was unable to exchange GDP for GTP
The proteins downstream from Ras would not become phosphorylated.
Which of the following statements best describes the ribosome binding site?
The ribosome binding site is where the small ribosome subunit binds; it is located upstream of the start codon.
Which of the following is true of the sequence called the TATA box?
The sequence is located 30 base pairs upstream of the transcription site and is important for recognition by RNA polymerase.
Vibrio cholera is the species of bacterium that causes cholera, an acute diarrheal disease of humans and other animals worldwide. Which of the following would be the most likely reason for sequencing the genome of this bacterium?
The study of its genome may help in the development of novel treatments (e.g., new antibiotics) that are effective against this organism.
When evaluating bacterial and archaeal genomes for genes, why must researchers evaluate six open reading frames?
There are three possible reading frames for each DNA strand, so researchers must evaluate six open reading frames.
How do histone deacetylases impact chromatin structure?
They deacetylate histones, making them more positively charged, which causes the chromatin to condense.
When a restriction enzyme is introduced to the plasmid, it makes staggered cuts. Why is this important?
This creates "sticky ends," which are capable of hydrogen-bonding with a complementary sequence.
Which of the following factors are associated with transcription in eukaryotes?
Three polymerases, basal transcription factors, 5' cap, and 3' poly A tail
Which of the following connections between cells resemble quilting?
Tight junctions
Which of the following structures seals cells together?
Tight junctions
The lack of membrane-bound organelles in bacteria impacts transcription and translation in which way?
Transcription and translation occur simultaneously
In bacteria, transcription ends at a distinct site in each gene. Which of the following best describes transcription in eukaryotes?
Transcription ends at variable distances from the Poly(A) signal.
If a mutation rendered the sigma protein nonfunctional, which of the following would result?
Transcription of bacterial genes would be reduced or eliminated.
Which eukaryotic protein binds to the promoter-proximal region of only some genes?
Transcriptional activators binding to enhancers
If less than 2 percent of the human genome is composed of protein-coding exons, what constitutes almost half of the genome?
Transposable elements
Which of the following genes are important in the inhibition of cell division?
Tumor suppressor genes
What is a common way that genes are duplicated?
Unequal crossing over
The globin gene family, which contains several pseudogenes, is thought to have arisen from which of the following processes?
Unequal crossover during meiosis
If a child has cystic fibrosis, a recessive genetic disorder that primarily affects the lungs, which of the following treatments would be the best gene therapy for the child?
Use a retrovirus to deliver genetic material into cells and help incorporate a functional gene into the child's DNA.
How are genes cut out for insertion into cloning vectors?
Using restriction endonucleases
In bacteria, when does transcription end?
When a stem-look structure forms in the transcribed RNA
Which of the following of G proteins is true?
When activated, G proteins activate enzymes that catalyze the production of second messengers
Which of the following statements best describes proto-oncogenes?
When mutated, they become oncogenes, driving the cell cycle forward and promoting cancer.
How do miRNAs interfere with translation?
When there is a perfect match between a miRNA and an mRNA, the mRNA is destroyed.
Which of the following lists the genes present in an organism?
While genome sequencing
Cells from different tissues (A and B) in an animal are isolated, and antibodies are raised against membrane proteins from each cell type. Cells from tissue B are isolated and dissociated, then traded with the antibodies raised against cell type A membrane proteins. Will cells from tissue B reaggregate?
Yes, they will reaggregate
In recombinant DNA methods, the term vector can refer to __________.
a plasmid used to transfer DNA into a living cell
Sequencing an entire genome, such as that of C. elegans, a nematode, is most important because __________.
a sequence that is found to have a particular function in the nematode is likely to have a closely related function in vertebrates
An advantage of introns is that they __________.
allow expression of different exon combinations from one gene
Paul Zamecnik and his colleagues tracked the fate of radioactive leucine molecules attached to tRNAs. In their experiment, they found that ________.
amino acids are transferred rom tRNAs to proteins
Where does an amino acid attach to a tRNA?
at the 3' end
In __________, there is a strong correlation between the size of the genome and the metabolic capabilities of the organism.
bacteria
Fragments of DNA from extinct wooly mammoths have been extracted, amplified, and sequenced. These can now be used to __________.
better understand the evolutionary relationships among members of related taxa
The release factor (RF) __________.
binds to the stop codon in the A site in place of a tRNA
How does RNA polymerase begin transcription in eukaryotes?
by binding to promoters sequence is DNA
Which of the following is an example of a second messenger
cGMP
When a plasmid is used to make copies of a foreign DNA sequence, it is referred to as a ____________.
cloning vector
A gene is a __________.
coding and regulatory sequence that directs the production of one or more related polypeptides or RNAs
The RNA hairpin structure finishes being processed into the final, single-stranded miRNA in the __________.
cytoplasm
In an approach called ________________, the relative amounts of each cDNA—and therefore the corresponding mRNA—are determined by extensively sequencing a population of cDNAs prepared from a particular cell type or tissue.
deep sequencing
Regulatory sequences that are found thousands of base pairs downstream from the promoter and activate transcription are termed ________.
enhancers
Transcriptional activators bind to __________ to __________ transcription.
enhancers; begin
Integrins are transmembrane proteins that connect the______ outside the animal cell to the _______ inside the animal cell.
extracellular membrane; actin cytoskeleton
The effort to sequence, interpret, and compare whole genomes is __________.
genomics
Transposable elements __________.
have the ability to replicate themselves and to move from one location to another in a genome
The poly(A) tail at the end of eukaryotic mRNA __________.
helps protect the mRNA from degradation by enzymes in the cytoplasm.
Genes that are similar to each other because they are in organisms that share a common ancestor are __________.
homologous genes
Genes that are similar to each other because they are in organisms who share a common ancestor are __________.
homologous genes
Chemical messengers secreted from cells in a multicellular organism that travel throughout the body and get on distant cells are called
hormones
What molecule carries a genetic message from DNA to the proteins-synthesizing components of the cell?
mRNA
A primary transcript in the nucleus of a eukaryotic cell is __________ the functional mRNA, whereas a primary transcript in a bacterial cell is __________ the functional mRNA.`
larger than; the same size as
The movement of DNA from one species to another is __________.
lateral gene transfer
The movement of DNA from one species to another is called __________.
lateral gene transfer
What molecule carries a genetic message from DNA to the protein-synthesizing components of the cell?
mRNA
Which of the following processes occur in the cytoplasm?
miRNA binding to a complementary mRNA sequence
Systems biology is an attempt to __________.
model the dynamic behavior of whole biological systems
Studies of bacteria have shown that __________.
most bacterial genes are not shared with many different organisms
Studies of prokaryotes have shown that __________.
most bacterial genes are not shared with many different organisms
The RNA polymerase will bind to the __________ of an operon.
promoter
Studies of prokaryotes have shown that __________.
parasitic microbes have smaller genomes than free-living microbes
Many identical copies of genes cloned in bacteria are produced as a result of __________.
plasmid and bacterial cell replication
During RNA interference, the mRNA strand is __________.
produced but will not be translated into a protein
Studies of bacteria have shown that __________.
prokaryotic genomes are frequently rearranged during evolution
A laboratory might use dideoxy sequencing to __________.
sequence particularly long pieces of DNA that need to be read with great accuracy
GATA (a repeat of the bases G,A,T, and A many times) is an example of a __________, which is useful in DNA fingerprinting.
short tandem repeat (STR)
During RNA splicing, which molecular component of the spliceosome catalyzes the excision reaction?
snRNA
What happens to introns in eukaryotic mRNA?
snRNPs bind to the primary transcript and form the spliceosome, which removes introns.
The life span of an mRNA molecule can be controlled by the activities of __________.
the RISC protein complex
Which of the following best describes the processing of eukaryotic pre-mRNAs in the proper order?
the addition of a 5'cap; removal of introns; poly (A) tail
RNA polymerase reads the template strand. The non-template strand is ________.
the coding strand- its sequence matches the sequence of the RNA that is transcribed from the template strand
Studies of prokaryotes have shown that __________.
the content of genomes varies widely, even within species
If a scientist needs to put new DNA into a bacterium, she must __________ the bacterium.
transform
Proteins that stop or slow the cell cycle when conditions are unfavorable for cell division are called ________.
tumor suppressors
