Cell and molecular 285 exam 3
What is the role of telomerase RNA in telomere replenishing?
Acts as a template
Meselson and Stahl
Added an isotope of Nitrogen (N15) to make one strand more dense Switch to N14 media after one two or three generations ran on cesium chloride gradient (separated by density) what should we see? Semiconservative ▪ should get light/heavy (after 1 round) ▪ get light/heavy and light/light after multiple rounds Conservative ▪ get the original heavy/heavy DNA ▪ get 3 new light light strands Dispersive ▪ get DNA that is a mix of heavy and light in all strands along different areas They found a mix of heavy and light *Can't tell between semi conservative or conservative *Go another round of replication: *Semiconservatively Get light/heavy and light/light after multiple rounds get two distinct bands *Dispersive Get a mix of light/heavy in all (not by strand either) should be less dense than before, but still in the middle get one band
The following statement sounds patently false. "The different cells in your body rarely have genomes with the identical nucleotide sequence." Provide an argument for why it might be true.
Each time the genome is copies in preparation for cell division, there is a chance that mistakes (mutations) will be introduced. The rate of mutation for humans is estimated to be 1 nucleotide change per 1010 nucleotides each time the DNA is replicated. Since there are 6.4 x 1010 nucleotides in each diploid cell, an average of 6.4 random mutations will be introduced into the genome each time it is copied. Thus, the two daughter cells from a cell division will often differ from one another and from the parent cell that gave rise to them. Even genomes that are copied perfectly, giving rise to identical daughter cells, will often be altered in subsequent replication cycles. The proportion of identical cells depends on the exact mutation rate.
Double strand DNA break causes
ionizing radiation uv exposure blockage in DNA replication causes by lesions in the DNA like (thymine/pyrimidine dimers)
is the deletion of some nucleotides in NHEJ problematic?
it may be fine, the lost material may not be in a gene and if the lost material was in a gene, then there will be problems but this is better than no fix at all.
The lagging strands form
joining okazaki fragments
The "end replication problem" is an issue for which strand during DNA replication?
lagging
If the above newly replicated strand of DNA is in the process of being synthesized and is the leading strand, was the large complex of replication machinery at this replication fork moving to the left or to the right (as the DNA is written on this piece of paper)? A = to the left; B = to the right
to the left
T/F The error rate of DNA replication is reduced both by proofreading by DNA polymerase and by DNA mismatch repair
true
T/F The process of RNAi with microRNAs requires that the microRNA is at least partially complementary to an mRNA in the cell
true
which enzyme acts in the first step in the repair of cytosine deaminations?
uracil glycosylase
which of the proteins are necessary to carry out DNA mismatch repair
dna polymerase helicase DNA ligase exonuclease NO PRIMASE
What proteins are involved in nucleotide excision repair?
endonuclease helicase dna polymerase dna ligase
Nuclease
enzymes that degrade nucleic acids by breaking the phosphodiester bond that holds nucleotides together (bond between phosphate group and the sugar in a polynucleotide molecule) -DNA backbone is composed of alternating sugar and phosphate groups
True/False. DNA repair mechanisms all depend on the existence of two copies of the genetic information, one in each of the two homologous chromosomes.
f
DNA repair mechanisms all depend on the existence of two copies of the genetic information, one in each of the two homologous chromosomes.
false
T/F Drosha is an enzyme that cleaves microRNA in the cytoplasm
false
T/F RNA interference (RNAi) is an example of post-translational control of gene expression
false
t/f telomeres contain protein coding genes
false
Which enzyme is required for the repair of both cytosine deaminations as well as depurinations?
-AP endonuclease -DNA ligase
DNA vs RNA
-OH on the 2' carbon for RNA Really important implications to the difference between DNA and RNA -Is part of the reason that DNA and RNA have different functionality and properties Oxygen is larger than the hydrogen atom on the 2' carbon takes up more room and does not favor some organization schemes -Both can base pair -Transient base pairing between DNA and RNA can happen. -RNA carries a uracil instead of thymine -structure between Uracil and thymine is very similar -RNA is much more transient than double stranded DNA (dsDNA) the OH group on the 2' Carbon of RNA is responsible for keeping the RNA mostly single stranded.
Proofreading
-Performed by DNA polymerase called polymerase I after copying each base -use 3->5 exonuclease activity -DNA polymerase asks itself "did I mess up?" if yes, fixes it and if no, moves on
tRNA
-brings amino acids to the ribosome -specifically is determined by base pairing
Nucleotide Excision Repair
-bulky lesions such as thymine thymine dimers -distort DNA dramaticcally -xeroderma pigmentosum=LOF in NER
If double strands are not repaired correctly you get....
-chromosomal rearrangements -apoptosis -premature aging -cancer
DNA polymerase-what does it do
-creates DNA molecule by assembling nucleotides (reads in 3-5 but always synthesizes 5-3) -highly conserved structure -C goes to G -A goes to T
What are some non bad ways you get double strand breaks?
-crossing over in meiosis -VDJ recombination during antibody generation
Mismatch repair
-fixes mistakes evaded by proofreading -needs to know which strand is newly synthesised Eukaryotic cells: new strand is nicked Prokaryotic cells: parent strand is methylated and new strand is not
The end replication problem
-issue with the lagging strand -part of the DNA at the end of a chromosome gets uncopied each round of replication (aka a short piece of DNA not covered by an Okazaki fragment (which is just a fragment of DNA) -after multiple cell cycles, chromosomes gradually become smaller
2 ways double stranded dna is fixed...
-non-homologous end joining -homologous recombination
rRNA
-part of the ribosome -catalyzes the formation of the peptide bonds that string amino acids together
Telomeres
-protect the ends of chromosomes -When chromosomes get too short, apoptosis will occur -end of replication problem is solved by the enzyme telomerase which keeps chromosomes long
MRNA
-synthesized by RNA polymerase during transcription and after it's processed, it exits the nucleus to be translated by a ribosome
non-coding RNAs important for the process of transcription and translation
-tRNA -rRNA -microRNA
Compare and contrast RNAi with siRNAs and with miRNAs.
1) siRNA generally comes from outside the cell, like from viruses or other parasites - or in the case of using siRNA in research, scientists buy the siRNA to silence a specific gene. miRNAs are generally encoded within the genomes of the cell that uses them. 2) They're generally about the same size once they're done being processed and they are both incorporated into RISC (RNA induced silencing complex). 3) In animal cells, siRNA is often an exact complementary match to its target RNA and leads to degradation of the RNA. miRNA is often an inexact match and leads to inhibition of translation and not directly to RNA degradation. However, in plant cells, miRNA is often an exact match and leads to RNA degradation. 4) miRNA is first processed in the nucleus by an enzyme called Drosha and then exported to the cytoplasm where it encounters more processing by Dicer whereas siRNA comes from the outside of the cell into the cytoplasm and so is only processed by Dicer.
Homologous recombination
1. DBS occurs 2. a nuclease chews back on the 5' ends of a broken strand 3. Strand invasion occurs (the 3' ends find their complimentary strands and base pair with it 4. Replication occurs filling in the gap that was broken 5. When DNA comes back together it has been synthesized up until the end of the digested strand (the 5' ends) 6. DNA ligase seals the nicks that are left 7. Result is perfectly repaired DNA
Non homologous end joining steps
1. cell recognizes a double stranded break 2. extending ends are chewed up by nucleases that make blunt ends (thus the ends of the DNA double helix will show the same length 3. blunt ends are ligated back together by DNA ligase 4. DBS is fixed, but some nucleotides are deleted
Steps for DNA replication sequence
1. initiator proteins 2. DNA helicase 3. Primase 4. Replicative DNA polymerase 5. RNA ribonuclease (enzyme that rips the primer off) 6. DNA ligase
3 Types of RNA required for transcription and translation
1. mRNA 2. rRNA 3. tRNA
3 major types of NON-CODING RNA that regulate gene expression
1. siRNA (small interfering RNAs) 2. miRNA (microRNA) 3. Long Noncoding RNAs
Adenine-Thymine pairs are stabilized by...
2 H bonds
If a segment of DNA contains 28 percent T nucleotides, then the percentage of A nucleotides in that segment will be _____.
28%
Cystine-Guanine pairs are stabilized by.....
3 H bonds
Telomerase adds new bases to the _____________ of a DNA strand...
3 prime end
How does DNA replicate itself?
3 theoretical models for replication Semiconservative First replication cycle: sees split of parental DNA into two different strands Conservative parental conserved and replicated in its whole. Parental strands remain together Dispersive DNA is chopped and replicated Portions of the daughter DNA is parental and some portions are new
You examine DNA replication in an E. coli mutant, which has a partially defective 5'3' polymerase 3'5' exonuclease the normal polymerase? Circle all that apply. DNA polymerase. In vitro experiments using the mutated DNA polymerase gives an error rate of 10-3, as compared to the expected error rate of 10-6. Which of the 5'3' exonuclease 3'5' polymerase following activities is the mutant polymerase likely to be missing, as compared to 5'3' recombinase 3'5' recombinase the normal polymerase?
3' -> 5' exonuclease
In which direction does the "proofreading" exonuclease go?
3-5
The following is a single strand of newly replicated DNA: 3'- CTGATCGAGGGTCTAATCCTAGCTAGATC - 5' Which of the following must be the template strand?
5' - GACTAGCTCCCAGATTAGGATCGATCTAG - 3'
Primer
A primer is a short strand of RNA or DNA (generally about 18-22 bases) that serves as a starting point for DNA synthesis. It is required for DNA replication because the enzymes that catalyze this process, DNA polymerases, can only add new nucleotides to an existing strand of DNA
RNA structure
Back bone is also composed of ribose sugar and negatively charged phosphate RNA has an OH on the 2' carbon Can base pair like DNA Adenine - Uracile has 2 h-bonds Guanine - Cystine has 3 h-bonds RNA can base pair with itself, making a loop structure
Which of the following repair pathways typically repairs depurated nucleotides?
Base excision repair
DNA Replication
Bi-directionally at the origin of replication replication machinery is loaded at all of the blue circles in the image at the right each side is called the replication fork DNA is replicated in both directions Not all origins "fire" at the same time some start before other origins note that replicating DNA fuse when they reach one another, eventually making a set of fully replicated DNA (for linear chromosomes). There can be regions tightly wrapped around proteins heterochromatin- wrapped tightly, hinders gene expression euchromatin- more loosely dispersed around organizing proteins Heterochromatin origins tend to begin replication later ▪ this is a correlation though Requires a template to copy from Requires a strand from which to work off of. Both RNA and DNA-polymers are only synthesized in one direction. (5'-3') To provide the energy the beta and gamma phosphate (arrow) are broken off providing energy for the addition reaction A bond is formed between the 3' OH and the 5' phosphate
Cancer cells and Telomerase
Cancer cells overexposes telemorase OR have issues with program cell death pathway so they don't initiate apoptosis
DNA structure
Composed of a sugar phosphate backbone and nucleotides Phosphate The entire backbone is charged (-) and polar due to the phosphate
...and these bases are made of _______________
DNA
A biochemist isolated and purified molecules needed for DNA replication. When some DNA was added, replication occurred, but the DNA molecules formed were defective. Each consisted of a normal DNA strand paired with segments of DNA a few hundred nucleotides long. Which of the following had been left out of the mixture?
DNA ligase
Enzyme that joins two adjacent DNA strands together
DNA ligase
Collective term for the enzymatic processes that corrects deleterious changes affecting the continuity or sequence of a DNA molecule.
DNA repair
DNA strands run......
DNA strands run Anti-parallel (they are lined up in opposite directions) Each nucleotide is attached to the next nucleotide with the alpha phosphate (on the 5' carbon) being bound to the 3' OH in the neighboring nucleotide
Yeast strain "DSBR1" is haploid and you observe that they die if they get a double strand break in their DNA.
For the most part, haploid yeast only have NHEJ available as a repair mechanism (except for the short period of time after S-phase but before cytokinesis - see question 10) because they lack a second copy of their chromosomes. So if they are dying, that implies that their NHEJ isn't working.
Bases are....
Guanine, Cystine, Adenine, and Thymine -planar -Pyrimidine are 1 ring -Purine are 2 rings -Bases stack on top of one another to add to the stability of the helix
Haploid yeast cells that preferentially repair double-strand breaks by homologous recombination are especially sensitive to agents that cause double-strand breaks in DNA. If the breaks occur in the G1 phase of the cell cycle, most yeast cells die; however, if the breaks occur in the G2 phase, a much higher fraction of cells survive. Explain these results.
Haploid yeast cells contain only one of each chromosome so if they undergo a double strand break before the cells have duplicated their DNA in S phase, then they won't have another chromosome to work off of for homologous recombination. But in G2, they will because they will have replicated their DNA.
Put the following steps of DNA replication in chronological order.
Hydrogen bonds between base pairs of antiparallel strands are broken. Single-stranded binding proteins attach to DNA strands. Primase binds to the site of origin. An RNA primer is created. DNA polymerase binds to the template strand.
How does telomerase solve the end-replication problem of eukaryotes?
It uses an intrinsic RNA template to build DNA
What causes xeroderma pigmentosum?
LOF in nucleotide excision repair
nucleotide excision repair MUTATED DNA LIGASE results
MUTATION results in a damaged nucleotides have been repaired but theres an unusual number of nicks in the DNA
nucleotide excision repair MUTATED DNA POLYMERASE results
MUTATION you observe a higher than usual incidence of single-stranded DNA
nucleotide excision repair MUTATED ENDONUCLEASE results
MUTATION you observe the DNA is intact but there is a lot of damaged nucleotides not repaired
nucleotide excision repair MUTATED EXONUCLEASE RESULT
MUTATION you observe the damaged bases are not repaired and you observe a higher than usual number of nicks in the DNA
Nucleic acids have a definite polarity, or directionality. Stated another way, one end of the molecule is different from the other end. How are these ends described?
One end has an unlinked 3 carbon; the other end has an unlinked 5 carbon.
The following statement sounds patently false. "No two cells in your body have the identical nucleotide sequence." Knowing what you know now about DNA replication, damage and repair, provide an argument for why it might be true.
Our cells are accruing an average of 6 mutations every time they divide and they are also experiencing DNA damage that might not be correctly repaired 100% of the time. This could lead to slight differences in nucleotide sequence in each of our cells.
DNA Helices....
Prefers to exist as a double helix highly energetically favorable any molecule that is going to try and separate the DNA will have to use energy DNA and RNA can form a double helix, but it is very weak and does not last very long RNA alone may exist double stranded or single stranded RNA is very unstable
DNA remember!!!!!! binding, storage,
REMEMBER! DNA is the information storage method in the cell. The cell goes to great lengths to protect the DNA bases (which actually code for the genes). When a sequence specific protein binds to DNA, it binds to the major groove because it is much easier to make contact with the bases in the major groove contacts do happen in the minor groove, usually non sequence specific DNA is a right handed helix B form helical structure
What kind of enzyme is the telomerase protein?
RNA template-directed DNA polymerase
Leading and Lagging
Replication machinery is loaded on the DNA ends of the fork and move together in the same direction If replication must go in the 5'- 3' direction and the machinery at each fork must move in the same direction, there is a problem with the directionality of the strand that is running in the 3'-5' direction in order to synthesize in the 5'-3' direction, the replication machinery synthesizes backwards in small chunks The 3'-5' direction strand (in reference to direction of motion at the fork) is known as the lagging strand A lagging strand requires a slight delay before undergoing replication, and it must undergo replication discontinuously in small fragments.
In Excision repair, DNA polymerase can make DNA without the need for primase. How?
The 3`OH is provided by existing DNA adjacent to the DNA that was removed
DNA polymerization
The DNA Polymerase reads in opposite directions. BUT, when you polymerize, you ALWAYS, ALWAYS polymerize 5' → 3' How to do this??? Label all of your ends draw a line down the middle of both strands Your new strands should always be going in the 5'→ 3' direction Let us use the top strand as an example: since the 5' to 3' is going from left to right, the leading should be on the right and the lagging strand should be on the left of the midline.
The epsilon (ε) subunit of DNA polymerase III of E. coli has exonuclease activity. How does it function in the proofreading process?
The epsilon subunit can remove a mismatched nucleotide.
Replicative cell senescence (a term for dividing cells that cannot divide any longer) occurs at a characteristic number of population doublings, typically about 40 for cells taken from normal human tissue. This observation suggests that in some way individual cells can "count" the number of times they have divided. How does the structure of telomeres figure into a cell's calculations?
The gene for telomerase is turned off early in development and remains off in most cells in humans. Thereafter, each time a cell replicates its chromosomes, it fails to copy a short segment of the telomeric DNA at the very end of the chromosome. As a result, the telomere becomes progressively shorter with each cell division; thus, the length of the telomere is a rough gage of the number of times a cell has divided. When the telomere gets too short to function properly, it triggers p53 dependent cell cycle arrest.
What is the difference between the leading strand and the lagging strand in bacterial DNA replication?
The leading strand is synthesized continuously in the 5`->3` direction, while the lagging strand is synthesized discontinuously in the 5`->3` direction.
Researchers found E. coli that had mutation rates 100 times higher than normal. What is a possible explanation for these results?
The proofreading mechanism of DNA polymerase was not working properly.
Describe the events that occur during mismatch repair in the order that they occur. Make sure to include the protein and/or enzymatic activity required for each step. Feel free to number each step or event as it will make your explanation easier to read.
There are proteins that identify the mismatch and identify which strand is the newly synthesized strand. 2. Place a nick in the newly synthesize strand (if needed - if in euks, this nick might already exist as this is the mechanism used to identify the newly synthesized strand. In proks, the DNA won't be nicked yet so it will need to be by an endonuclease). 3. Chew back the DNA around the mismatch (including the mismatched nucleotide) using an exonuclease. Helicase will be required for this step to peel apart the two strands so that the exonuclease can chew back on the newly synthesized strand. 4. Single-stranded DNA-binding protein will need to bind the single-stranded DNA left behind by the exonuclease. 5. Fill in the area of single-stranded DNA with a DNA polymerase and a clamp. 6. Fill in the final nick left by the DNA polymerase using DNA ligase.
Recent studies have shown that xeroderma pigmentosum (an error in the nucleotide excision repair process) can result from mutations in one of seven genes. What can you infer from this finding?
There are several enzymes involved in the nucleotide excision repair process
Yeast strain "DSBR2" is diploid and you observe that they have several places in the genome in which small sections have been deleted.
This data suggests that NHEJ is the only repair pathway working, which means they must not have HR available as a repair pathway.
The Meselson-Stahl experiment was designed to answer which question?
What part of newly replicated DNA comes from the parental molecule and what part is newly synthesized?
Xist
X chromosome inactivation -Xist is a long non-coding RNA expressed in cells with at least 2 X chromosomes -one of the chromosomes expresses it which leads to transcriptional silencing of that chromosome *****IT IS BOTH NECESSARY AND SUFFICIENT FOR X INACTIVATION
When nucleotides polymerize to form a nucleic acid polymer _____.
a covalent bond forms between the sugar of one nucleotide and the phosphate of a second
What is the role of the DNA strand in telomere replenishing?
acts as a primer
which enzyme works in the first step of repairing deprivations?
ap endonuclease
The catalytic component of RISC is called
argonaut
Where along the parent DNA strand does synthesis of the new DNA strand take place?
at the fork of replication
Double strand breaks in DNA occur where?
both strands have a break in the sugar phosphate backbone (and the breaks DO NOT have to be directly across from each other
Base excision repair
handles deprurinations (spontaneous removal of guanine) and deaminations (hydrolysis of cytosine to uracil)
Enzyme that opens the DNA helix by separating the single strands
helicase
enetic exchange between a pair of identical, or nearly identical, DNA sequences, typically those located on two copies of the same chromosome: either sister chromatics or homologs.
homologous recombination
What is the preferred dsDNA damage control method?
homologous recombination because there is no loss of nucleotides (all the info is preserved) -During S phase of the cell cycle, the homologous recombination method is used to repair DSBs.
What is the difference between NHEJ and homologous recombination in reference to DNA
homologous recombination needs a copy of the dna while non-homologous end joining does not need a copy
Deaminations
hydrolysis of cytosine to uracil
The condensation reaction that forms nucleic acid polymers occurs between a _____ group on one nucleotide and a _____ group on the incoming nucleotide.
hydroxyl, phosphate
MECHANISM OF GENE SILENCING by microRNAs
miRNA is the first type of RNAi that we study (the other is siRNA). miRNA is coded for in the DNA in the nucleus. Still in the nucleus, it is processed by Drosha, which cleaves it in areas. -It is then exported from the nucleus, where it is cleaved again by Dicers. -It then binds to an Argonaut and forms the RISC complex, where it is unwound. -The complex chooses one strand to act as the template, and it binds either perfectly or imperfectly to the mRNAs. -If it binds perfectly, the mRNA is cleaved and degraded. -If it binds imperfectly, it can also bind to other mRNAs and cleave them or store them in P-bodies. This way, miRNAs contribute to repression of translation → less protein is formed.
MiRNAs
micro RNAs non-coding RNA involved in gene expression -encoded for within the genome (endogenous source) -small RNAs that control mRNA stability -used by RNA interference (RNAi) machinery
Mismatch repair EUKARYOTES how do you tell the strands apart?
new strand is nicked
In a nucleic acid polymer, the hydrogen bonds that help to hold regions of double-strandedness together occur between what parts of the nucleotide monomers?
nitrogenous bases
SiRNA
non-coding RNA involved in gene expression small interfering RNAs -typically from exogenous source (outside the cell) -protects organism from foreign invaders that contain or produce double stranded RNAs (dsRNA) -used by RNA interference (RNAi) machinery
Long noncoding RNAs
non-coding and controls gene expression -least well understood -ex=Xist which is involved in X chromosome inactivation
What is a means for repairing double-strand DNA breaks that links two ends with little regard for sequence homology?
non-homologous end joining
Which of the following would be used to repair DNA double strand breaks in human cells NOT DIVIDING!?
non-homologous end joining
Exonuclease
nuclease that cuts phosphodiester bonds from ends of DNA (cuts a bond between phosphate group and the sugar
Endonuclease
nuclease that cuts within the DNA backbone
Xeroderma Pigmentosum is generally caused by loss of function mutations in the genes in which repair pathway?
nucleotide excision repair
DNA replication is highly accurate. It results in about one mistake per billion nucleotides replicated. For the human genome (contains about 3 billion base pairs), how often would errors occur?
on average, 6 times each time the entire genome of a cell is replicated
Mismatch repair PROKARYOTES how do you tell the strands apart?
parent strand is methylated and new strand is not
The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ______ bonds.
phosphodiester
RNA interference
process of RNA inhibiting translation by targeting mRNA
Nucleotide excision repair _____.
recognizes and repairs thymine dimers in the DNA
DNA is synthesized through a process known as _____.
semiconservative replication
The primers used for DNA synthesis are _____.
short RNA sequences
Telomeres
shorten with each round of DNA replication in most somatic cells
SiRNA silencing mechanism
siRNAs: The other RNAi (interfering RNA). -This one is produced exogenously (not coded for in the DNA). -First, the acquired dsRNA is processed in the cytoplasm (Drosha not involved) to form shRNA, which has a hairpin formation. -The shRNA is then cleaved by Dicers to form the siRNA duplex, which binds to Argonaut to form the RISC complex. -A template strand is selected which always binds PERFECTLY to the mRNA (so it can only bind to one mRNA). -The mRNA is then cleaved and digested with the help of endonucleases.
DNA isolated from the bacterial virus "M13" contains 25% Adenines, 33% Thymines, 22% Cytosines, and 20% Guanines. made of:
single stranded DNA
A protein complex that encircles the DNA double helix and binds to DNA
sliding clamp
This is the only protein in the group that is not an enzyme
sliding clamp
Depurinations
spontaneous removal of guanine
Pentosesugar
sugar's carbons are labeled 1'-5' the 3' carbon is attached to the OH group the 5' carbon is attached to the phosphate and is not actually in the ring of the sugar
If the activity of DNA ligase was removed from replication, this would have a greater affect on...
synthesis on the lagging strand versus the leading strand
What provides the energy for the polymerization reactions in DNA synthesis?
the deoxyribonucleotide triphosphate substrates
Consider the following statement: Primase is a DNA template-directed RNA polymerase. Do you agree with this statement? A = Yes, B = No
yes
There are miRNAs encoded within the human genome
yes
