chapter 12

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

Comparison of whole genome sequences shows that we share _____ of our genome sequence with our closest relative.

96%

Which of the following restriction enzymes cuts the following DNA? Assume that ^ determines the cut site. GCATTACGGGATCCACCCGTT

BamHI (G^GATCC)

If a biochemist were searching for the nucleic acid sequence CTAGTTATG, what sequence would the biochemist use to make a nucleic acid probe?

GATCAATAC

What is gene cloning?

Gene cloning occurs when a bacterium carrying a recombinant plasmid reproduces, thus allowing for the production of multiple copies of the recombinant plasmid.

A new treatment for cystic fibrosis (CF) is currently being tested. The treatment is sprayed into the noses of patients with CF. The spray contains a genetically engineered adenovirus that carries a (CFTR) gene, which codes for a normal protein involved in the function of chlorine channels. Cells that harbor the adenovirus express the gene, and patients experience relief from the debilitating respiratory symptoms of CF. What is the significant drawback of this treatment?

The treatment only lasts until the epithelial cells lining the nasal cavity are shed.

Which of the following would be considered a transgenic organism? -a rat with rabbit hemoglobin genes -a human given a corrected human blood-clotting gene -a bacterium that has received genes via conjugation -a fern grown in cell culture from a single fern root cell Submit

a rat with rabbit hemoglobin genes

When is PCR particularly applicable?

When there are small quantities of DNA to analyze

Which of the following is an example of a transgenic organism? -Dolly, the cloned sheep -a bacterium found with a plasmid that provides protection against an antibiotic -a bacterium with human gene for producing insulin -a "test-tube" baby produced via in vitro fertilization

a bacterium with human gene for producing insulin

Insulin used for the treatment of diabetes in humans is now obtained from _____.

bacteria

Golden rice has been genetically engineered. Golden rice differs from other rice varieties because it contains genes that will produce _____.

beta-carotene

Restriction enzymes __________________________. -cut DNA at specific nucleotide sequences -restrict access to the DNA of a cell -copy DNA -bind DNA together at specific nucleotide sequences

cut DNA at specific nucleotide sequences

In a PCR reaction, the strands of DNA are first separated by ___.

heating

A single nucleotide polymorphism (SNP) is detected in an inheritable disorder that deletes the restriction site for HindIII. When the DNA from two individuals (one with and one without this disorder) is cut with this enzyme and then analyzed by gel electrophoresis, the resulting samples will be __________.

of different sizes. The individual with the disease will have fewer fragments than an individual without this disorder

A supplemental appendix is to a book as a ____________ is to a bacterial chromosome. -plasmid -bacterium -restriction enzyme -genetically modified organism

plasmid

"Sticky ends" are very useful in genetic engineering because they _____. -prevent the enzymatic degradation of engineered DNA -allow scientists to use the edited form of mRNA for genetic engineering -allow scientists to label genes in a living cell -provide a site for complementary base pairing so that pieces of DNA can be linked together

provide a site for complementary base pairing so that pieces of DNA can be linked together

What is the correct sequence of events that occur in a PCR reaction?

separation of DNA strands; addition of primers; use of DNA polymerase to produce second strand of DNA

Gel electrophoresis separates pieces of DNA based on _________. -size -sequence -quantity -charge

size

The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.

sticky ends

DNA polymerase is a heat-sensitive enzyme. What is one thing that would need to be considered concerning the activity of this enzyme in PCR when the temperature is heated during each cycle to separate the DNA strands?

that the DNA polymerase could be denatured

The process of accurately amplifying a sample of DNA is called __________________________. -short tandem repeats -recombinant DNA -the polymerase chain reaction -gel electrophoresis

the polymerase chain reaction

Concerns have been raised as to the safety of genetically modified organisms (GMOs). Which of the following would be a concern when modifying a plant to be resistant to a broad-spectrum herbicide? -a decrease in the use of herbicides -an increased shelf life of the fruit from the plants -the production of herbicide-resistant weeds -a decrease in food production

the production of herbicide-resistant weeds


Set pelajaran terkait

Thermodynamics Final Exam Review

View Set

Biology - Evolution: Early Earth Practice Questions

View Set

The Process of Occupational Therapy NBCOT

View Set

Ch.19 Industrial Revolution and Unification Test

View Set

Autonomic Nervous System chap 15

View Set

Intro to Climate Studies 2021-2022 (ENSC 220) Investigation 1B

View Set

1 KINEMATICS AND DYNAMICS-KHAN ACADEMY

View Set

US History Since 1877: Chapter 15

View Set