FINAL EXAM
What type of cells is a hypertonic solution good for?
A hypertonic solution is healthy for neither animal nor plant cells.
What type of cells is a hypotonic solution good for?
A hypotonic is not healthy for animal cells, but is healthy for plant cells.
An animal cell placed in a hypotonic solution is likely to: A. Enlarge and possibly lyse B. Plasmolyze C. Shrink in size D. Be unaffected E. Collapse causing a blank hole
A. Enlarge and possibly lyse.
You briefly expose bacteria undergoing DNA replication to radioactively labeled nucleotides. When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). These two classes of DNA probably represent: A. Leading strands and Okazaki fragments B. Lagging strands and Okazaki fragments C. Okazaki fragments and RNA primers D. Leading strands and RNA primers E. RNA primers and mitochondrial DNA
A. Leading strands and Okazaki fragments.
When a virus infects a cell and makes new virus particles killing the host cell, that virus is undergoing _________ growth. A. Lytic B. Lysogenic C. Litigious
A. Lytic.
The scientific method usually begins with _____? A. Making observations. B. Formulating a testable hypothesis. C. Formulating a theory. D. Searching for relevant materials in the library. E. Conducting a controlled experiment.
A. Making observations.
A protein known as a phospholipase removes fatty acids from phospholipids. What cellular structure would be most affected by this enzyme? A. The cell membranes B. Cellulose in the cell wall C. The chromosomes D. The soluble cell proteins E. The glucose in the cell
A. The cell membranes.
What does cellular respiration produce?
ATP, NADH, CO2, and H2O.
DNA Polymerase III
Adds most of the new DNA.
Cytoplasm
Aqueous interior of the cell.
Monosaccharide formula
(CH2O)n
If the codon consisted of three nucleotides, what would be the maximum amount of amino acids that proteins could contain?
64 amino acids.
When you sequence the DNA of someone with a rare genetic disease you find that the base "A" is found in a position where normally there is a "G". What type of mutation is it?
A point mutation.
A human cell containing 22 autosomes and a Y chromosome is A. A sperm B. An egg C. A zygote D. A somatic cell of a male
A. A sperm.
Chemiosmosis drives _____ and occurs in ______. A. ATP formation; the mitochondrion and the chloroplast. B. ATP formation; the mitochondrion. C. ATP formation; the chloroplast. D. NADPH formation; the chloroplast. E. NADH formation; the mitochondrion.
A. ATP formation; the mitochondrion and the chloroplast.
Alternative forms of genes are referred to as A. Alleles B. Chromatids C. Kinetochores D. Sister chromatids E. Homologous pairs
A. Alleles.
Which component is not directly involved in translation? A. GTP B. DNA C. tRNA D. Ribosomes
A. GTP.
The pH of ocean water is about 8. What is the H+ concentration of the ocean? A. 1* 10^8 M B. 1* 10^-8 M C. -1*10^8 M D. -1*10^-8 M
B. 1* 10^-8 M.
This process occurs in muscles undergoing O2 deprivation: A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Pyruvate oxidation
B. Lactic acid fermentation.
Tay-Sachs Disease
Breakdown of brain lipids.
Catabolism
Breakdown.
Which of the following contains codons? A. rRNA B. tRNA C. mRNA D. All proteins E. Ribosomes
C. mRNA.
Human Sex-Linked (X) Disorders
Color blindness, duchene muscular dystrophy, and hemophilia.
Which molecule contributes the oxygen atoms in the O2 produced by photosynthesis? A. Sucrose B. Glucose (C6H12O6) C. CO2 D. H2O E. Ethanol (C2H6O)
D. H2O.
What does the nucleus store?
DNA (genetic material).
Sulfur and nitrogen atoms _____? A. Have different numbers of protons. B. Have different numbers of valence electrons. C. Form different numbers of chemical bonds. D. Statements A and B are correct. E. Statements A, B, and C are correct.
E. Statements A, B, and C are correct.
Ligase
Links the Okazaki fragments.
Allosteric regulation
Regulator molecule binds away from the active site.
Plasma membrane
The bilayer that separates the outside from the cytoplasm.
Solute
The substance that is dissolved.
What is membrane potential maintained at?
-70 mV.
What is the charge of the inside of a cell due to the sodium-potassium pump?
-70 mV.
Your gametes (egg cells or sperm cells) are: A. Haploid B. Diploid C. Tertraploid
A. Haploid.
Primase
Adds RNA to start the new strand.
How many CO2 molecules are released by a single acetyl-CoA molecule during aerobic respiration? A. 1 B. 2 C. 3 D. 6 E. 12
B. 2.
What type of cell division is occurring when a bacterium divides?
Binary fission.
The H+ concentration in a person's stomach might be as low as 1*10^-2 M after eating a five Hongo Burrito at the Sanitary Burrito Factory. What is the pH of that person's stomach? A. 20 B. -20 C. 2 D. -2 E. 2^-10
C. 2.
Sulfur has 6 electrons in its outer shell. It combines covalently with hydrogen to form a stable (and smelly) compound. What is the structure of this compound? A. HS B. HS2 C. H2S D. H3S2 E. H4S
C. H2S.
How many carbons are in a glucose molecule? A. 1 B. 2 C. 3 D. 6 E. 12
D. 6.
DNA Structure
Deoxyribose sugar, phosphate group, and nitrogenous base.
Which of the following isotopes is/are found in nature or naturally occurring? A. 12C B. 13C C. 14C D. 12C and 13C E. All of the isotopes are found in nature
E. All of the isotopes are found in nature.
How many haploid cells does meiosis produce?
Four.
Who proved DNA is the genetic material?
Hershey and Chase.
Endocytosis
Import of molecules into vesicles (animal cells).
Viruses
Obligate intracellular parasites.
What does the transcript undergo in eukaryotic cells before translation?
RNA processing.
Parathyroid hormone (PTH)
Raises blood calcium.
At which wavelengths is the growth of bacteria the greatest?
Red and blue.
At which wavelengths is the photosynthesis rate the greatest?
Red and blue.
What light waves does chlorophyll absorb?
Red and blue.
During what period are neurons resistant to depolarization?
Refractory period.
What does a plasma membrane do?
Regulates movement of materials in and out of the cell.
Operator
Repressor binding site.
What protein perceives the light?
Rhodopsin.
Sugar of RNA
Ribose.
What is rRNA?
Ribosomal RNA and is a part of the ribosome.
Initiation
Ribosome binds to mRNA, processes 5' to 3'.
Two parts of the endoplasmic reticulum
Rough ER and smooth ER.
Features of mRNA codons?
Specific, redundant, and virtually universal.
Energy storage polysaccharides for plants
Starch.
How does the G-protein return to inactive form?
The G protein cleaves the GTP to GDP and inactivates itself.
Metabolism
The reactions that occur in cells.
Biology
The scientific study of life.
DNA from _____________ cells can transform normal cultured cells.
Tumor.
How many divisions occur in meiosis?
Two divisions, meiosis I and meiosis II.
Disaccharides
Two monosaccharides joined by a glycosidic bond (formed by dehydration).
Linked Genes
Two or more genes located on the same chromosome. Do not assort independently.
Carbonyl
Two types: aldehydes and ketones; non-polar molecules.
How many cell divisions occur in meiosis?
Two.
How many diploid cells does mitosis produce?
Two.
How many electrons can the first valence shell fit?
Two.
How many potassium ions does the sodium-potassium pump let into the cell?
Two.
How many sex chromosomes do humans possess?
Two.
How many subunits are ribosomes composed of?
Two.
How many membranes does the mitochondrion contain?
Two; an inner and outer membrane.
What are the three stop codons?
UAA, UGA, and UAG.
Amylose
Unbranched starch.
Lactose
a disaccharide composed of glucose and galactose. Found in milk sugar.
What are proteins made up of?
carbon, hydrogen, oxygen, nitrogen, and sulfur.
Is a codon a part of mRNA or tRNA?
mRNA.
What percentage of genes in a cell are expressed at one time?
3-5%.
Titan is the biggest protein with 10,000 amino acids. How many nucleotides would you need to code for those 10,000 amino acids
30,000 nucleotides.
Which direction does RNA polymerase read DNA?
5' to 3' direction.
Consider the DNA sequence 5'-ATGCGGCATTAA-3'. What mRNA would be produced from this sequence?
5'-UUAAUGCCGCAU-3'
The stage of the cell cycle that occurs immediately after DNA synthesis is _____. A. G1 phase B. G2 phase C. Meiosis D. S phase E. Mitosis
B. G2 phase.
Which hormone raises blood glucose levels? A. Insulin B. Glucagon C. Calcitonin D. Parathyroid hormone
B. Glucagon.
Multiple Alleles
A condition in which more than two alleles for a gene are possible.
What causes the amplification of signal transduction?
A second messenger.
What are metabolic pathways?
A series of enzymatic steps.
Hydrophobic
A substance that does not have an affinity for water.
An aqueous solution has a H+ of 1* 10-9 M. What is the pH of this solution? A. 9 B. -9 C. 5 D. -5 E. 7
A. 9.
What does epinephrine bind to on the cell surface? A. A G-protein coupled receptor on the plasma membrane B. A G-protein on the inside of the cell C. Adenylyl cyclase D. A transcription factor in the nucleus E. Protein kinase C F. All of the above
A. A G-protein coupled receptor on the plasma membrane.
What type of linkage connects the monosaccharides in cellulose? A. Beta-glycosidic linkages B. Peptide bonds C. 3'-5' phosphodiester linkages D. Disulfide bonds E. Ester bonds
A. Beta-glycosidic bonds.
A compound contains hydroxyl groups as its predominant functional group. Which of the following statements is true concerning this compound? A. It should dissolve in water. B. It is probably a lipid. C. It should dissolve in oil. D. It won't form hydrogen bonds with water. E. All of the above.
A. It should dissolve in water.
You have a friend that recently lost fifteen pounds. Where did the fat go? A. It was released as CO2 and H2O. B. Chemical energy was converted to heat and then released. C. It was converted to ATP which ways less than fat. D. It was broken down to amino acids and eliminated from the body. E. It was converted to urine and eliminated from the body.
A. It was released as CO2 and H2O.
Pairing of homologous chromosomes occurs in _________________? A. Meiosis B. Mitosis C. Prokaryotic fission D. Meiosis and mitosis E. Meiosis, mitosis, and prokaryotic fission.
A. Meiosis.
This process consumes O2, converting it to H2O: A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Pyruvate oxidation
A. Mitochondrial electron transport.
This process takes place entirely on the inner membrane of the mitochondria: A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Glycolysis
A. Mitochondrial electron transport.
In facilitated diffusion ________. A. Molecules only move from high concentration to low concentration. B. Molecules only move from low concentration to high concentration. C. Molecules can move in both directions across the membrane.
A. Molecules only move from high concentration to low concentration.
A nucleic acid was isolated from a new plague-causing virus. Analysis of this nucleic acid indicated the following base composition: 20% Adenine, 30% uracil, 10% guanosine, and 40% cytosine. From this information which of the statements are true? A. The virus contains RNA. B. The virus contains DNA. C. The virus has a double stranded nucleic acid. D. Statements A and C are true. E. Statements B and C are true.
A. The virus contains RNA.
Bacillus anthracis cells were treated with lysozyme which destroys the cell wall. These treated cells are then placed in pure water. What would you expect to happen to these cells? A. They would swell and then burst. B. They would shrink. C. They would swell but not burst due to their cell wall. D. They would neither swell nor shrink.
A. They would swell and then burst.
A piece of DNA that can copy itself and insert itself into a new place on the host genome is called a ________. A. Transposon B. Retrotransposon C. A poser D. An opponent
A. Transposon.
When carbon and hydrogen form a single bond, how many electrons in total are being shared? A. Two B. One C. Three D. Five E. Four
A. Two.
Which eukaryotes contain a cell wall?
All eukaryotes except animals.
Which eukaryotes contain a nucleus?
All eukaryotes.
Which eukaryotes contain a plasma membrane?
All eukaryotes.
Which eukaryotes contain mitochondria?
All eukaryotes.
Which eukaryotes contain peroxisomes?
All eukaryotes.
Which eukaryotes contain ribosomes?
All eukaryotes.
What happens during RNA processing?
An addition of 5' cap and a poly(A) tail.
What attached the poly(A) tail?
An enzyme.
Which eukaryotes contain lysosomes?
Animals, fungi, and some protists.
Covalent bonds
Atoms share electrons equally.
Polar covalent bonds
Atoms share electrons unequally.
18O and 16O are different isotopes of oxygen. What makes them different? A. 18O has two more protons than 16O. B. 18O has two more neutrons than 16O. C. 18O has two more electrons than 16O. D. 18O has one more proton than 16O. E. 18O has one more proton and one more neutron than 16O.
B. 18O has two more neutrons than 16O.
How many ATPs are made when one glucose molecule is utilized using lactic acid fermentation? A. 0 B. 2 C. 6 D. 10 E. 36
B. 2.
How many CO2 are produced when one acetyl-CoA molecule goes through the Krebs Cycle? A. 1 B. 2 C. 3 D. 6 E. 12
B. 2.
How many NADH are produced when one glucose molecule goes through the glycolysis? A. 1 B. 2 C. 3 D. 6 E. 12
B. 2.
How many carbons does acetyl-CoA have? A. 1 B. 2 C. 3 D. 6 E. 0
B. 2.
How many lactic acids are made from one glucose during lactic acid fermentation? A. 1 B. 2 C. 3 D. 6 E. 0
B. 2.
What is an oncogene? A. A gene that is involved with triggering diabetes. B. A gene that is involved with triggering cancer. C. A gene that is involved with triggering Alzheimer's. D. All of the above answers are correct.
B. A gene that is involved with triggering cancer.
You are looking at a cell under a microscope. It has a nucleus, a large vacuole, and many chloroplasts. What type of cell is it? A. A photosynthetic bacteria B. A plant cell C. A fungal cell D. Answers A and B could be correct E. Answers A, B, and C could be correct
B. A plant cell.
Carbon atoms tend to form _____ bonds? A. Ionic B. Covalent C. Hydrogen D. Extracellular E. Emotional
B. Covalent.
Which of the following terms belongs with the words synapsis, tetrads and chiasmata? A. Haploid B. Crossing over C. Autosome D. Prophase ll E. Fertilization
B. Crossing over.
Which of the following terms belongs with the words synapsis, tetrads, and chiasmata? A. Haploid B. Crossing over C. Autosomes D. Prophase II E. Fertilization
B. Crossing over.
How many neutrons does 14C have? The Atomic number of Carbon is 6. A. Five B. Eight C. Ten D. Six E. Two
B. Eight.
Which of the following statements regarding enzymes is true? A. Enzymes decrease the free energy change of a reaction. B. Enzymes increase the rate of a reaction. C. Enzymes change the direction of chemical reactions. D. Enzymes are permanently altered by the reactions they catalyze. E. Enzymes prevent changes in substrate concentrations.
B. Enzymes increase the rate of a reaction.
If a person has two identical alleles, he/she is _____ for that gene. A. Zygotic B. Homozygous C. Heterozygous D. Homomorphic E. Tetraploid
B. Homozygous.
Which of the following cells are haploid? A. Human bone marrow cells B. Human sperm cells C. Human liver cells D. All of the above E. None of the above
B. Human sperm cells.
The bonds that are broken when water vaporizes are: A. Ionic bonds between different water molecules. B. Hydrogen bonds between the atoms of single water molecules. C. Polar covalent bonds between the atoms of single water molecules. D. Non-polar covalent bonds between the atoms of a single water molecule. E. Polar covalent bonds between different water molecules.
B. Hydrogen bonds between the atoms of single water molecules.
The reaction used to split a polymer back into its original subunits is called _____? A. Hydrogenation B. Hydrolysis C. Hydroxylation D. Redox reaction E. Dehydration
B. Hydrolysis.
A molecule that has all non-polar covalent bonds would be_____? A. Hydrophilic B. Hydrophobic C. Acidic D. Basic E. Ionic
B. Hydrophobic.
Which of the following is a good description of the O-H bond in water? A. It is ionic B. It is polar covalent C. It is non-polar covalent D. It is as strong as duct tape!
B. It is polar covalent.
This process occurs in our muscles during exercise. A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Glycolysis
B. Lactic acid fermentation.
What organism produces O2? A. All living things produce O2. B. Only photosynthetic organisms produce O2. C. Only organisms that undergo alcoholic fermentation produce O2. D. Living things do not make O2. E. Only prokaryotes produce O2.
B. Only photosynthetic organisms produce O2.
Which of the following does not occur during mitosis. A. Condensation of chromosomes B. Replication of DNA C. Separation of sister chromatids D. Spindle formation
B. Replication of DNA.
Cystic Fibrosis
Cl- channels.
Plantae
Consists of multicellular eukaryotes that carry out photosynthesis, the conversion of light energy to food.
Which organelle contains membranes? A. Mitochondria B. Lysosome C. Golgi apparatus D. All of the above E. None of the above
D. All of the above.
2N =
Diploid, two of each chromosome.
A karyotype reveals two X chromosomes, 3 chromosome #21 and two of each of the other human chromosomes. The phenotype of this individual is: A. A normal female B. A normal male C. A sterile female D. A sterile male E. A female with Down's Syndrome
E. A female with Down's Syndrome.
The processes of active transport and the movement of motor proteins involved in cell motility both require: A. NAD+ B. NADH C. Phospholipids D. Passive diffusion E. ATP
E. ATP.
Which of the following is found in plant cells? A. Nucleus B. Vacuole C. Mitochondria D. Cytoskeleton E. All of the above
E. All of the above.
Which one of the following functional groups is important in protein folding? A. R-NH2 B. R-OH C. R-SH D. R-COOH E. All of these functional groups are important.
E. All of these functional groups are important.
Which of the following types of transport requires a protein? A. Simple diffusion B. Osmosis C. Facilitated diffusion D. Active transport E. Answers C and D are correct F. Answers A and D are correct
E. Answers C and D are correct.
Sedoheptulose is a seven carbon sugar. What is its molecular formula? A. C6-H12-N6 B. C6-H12-O6 C. C7-H12-O6 D. C7-H14-H-6 E. C7-H14-O7
E. C7-H14-O7.
Which term most precisely describes the cellular process of breaking down large molecules into smaller ones? A. Catalysis B. Metabolism C. Anabolism D. Dehydration E. Catabolism
E. Catabolism.
After a "flesh wound" some of the skin fibroblast cells begin to move into the wound area. Which sub-cellular structure listed below is directly involved in this process of cell movement? A. Mitochondria B. Endoplasmic reticulum C. Golgi apparatus D. Lysosomes E. Cytoskeleton
E. Cytoskeleton.
How many electrons can the second valence shell fit?
Eight.
Valence electrons
Electrons in outer shell.
Functions of carbohydrates
Energy storage, mobile energy molecules, and structural functions.
Functions of lipids
Energy storage.
What can trigger gene expression?
Environmental and chemical cues.
How big is the average human chromosome? A. 1,000 base pairs B. 10,000 base pairs C. 100,000 base pairs D. 1 million base pairs E. 10 million base pairs F. 100 million base pairs G. One billion (spoken like Dr. Evil) base pairs
F. 100 million base pairs.
True or False: DNA is converted into RNA.
False; DNA is not converted into RNA, RNA is made using DNA as a guide.
True or False: H+ and OH- are not very reactive and thus relatively unimportant to biologically systems.
False; H+ and OH- are very reactive and thus important to biological systems.
Building blocks of lipids
Fatty acids and glycerol.
Oncogene
Genes that may lead to cancer.
Structure of viruses
Genome (RNA or DNA), capsid protein cell, envelope (membrane), and envelope with glycoprotein.
What light waves are reflected/transmitted by leaves?
Green.
What does electron transport produce across the thylakoid membrane?
H+ gradient.
Hypertonic
Higher solute concentration, low water content.
Anaphase I
Homologous chromosomes separate.
Where are ribosomes assembled?
In the nucleolus (nucleus).
Where is the defect in a mutation?
In the protein.
Where is most of the carbon stored?
In the soil.
Pinocytosis
Ingestion of extracellular fluid.
Hypopolarization
Inside the cell becomes more positive (Na+ in)
What important hormones does the pancreas produce?
Insulin and glucagon.
During what stage are chromosomes duplicated?
Interphase.
What is the inhibitor synapse controlled by?
K+.
What is pyruvate converted to in fermentation?
Lactic acid.
Cytosol
Portion of the cell enclosed by the plasma membrane but not part of any organelle.
Promoter
RNA polymerase binding site.
Labeled phage DNA with 32 P
Radioactivity is inside the bacteria.
Labeled phage coat (protein) with 35 S
Radioactivity is not inside the bacteria.
DNA Polymerase I
Replaces the RNA with DNA and corrects errors.
Three functions of cell division?
Reproduction, growth and development, and repair.
What is the molecule that actually interacts with light?
Retinal.
Three things nerve cells do
Sensory perception, integration, and motor output.
Neuron classes
Sensory, interneurons, and motor.
What does RNA polymerase catalyze?
Separation of DNA strands.
Tertiary protein structure
Shape produced by bonds between side chains.
Genome of parvovirus
Single-stranded DNA.
Genome of flavivirus
Single-stranded RNA; serves as mRNA.
Genome of picornavirus
Single-stranded RNA; serves as mRNA.
Second messenger
Small molecules inside the cell (cAMP, Ca++, and IP3).
Function of gogli apparatus
Stacks possess "shipping" and "receiving" sides.
What does accumulation of triose phosphate in the chloroplast lead to?
Starch synthesis.
Termination
Stop codon reached, polypeptide is released from the tRNA, ribosome releases mRNA.
Function of vacuoles
Storage of energy and waste molecules and maintains water balance.
Function of nucleic acids
Store and "transmit" genetic information.
Point mutation
Substitution of base or bases.
What binds to the enzyme?
Substrate.
Examples of C4 plants
Sugarcane, crabgrass, and corn.
What is one of the longest human genes known?
The DMD gene, which encodes for dystrophin.
Nonsense mutation
The DNA change leads to a stop codon or a premature termination.
What do terminator nucleotides signal?
The end of transcription.
Developmental patterns are produced by _____.
The expression of different genes.
Epistatic gene
The expression of one gene alters the affect of another gene.
Homeostasis
The steady-state physiological condition of the body.
Myosin
Thick filament; motor protein that binds to actin and stretches actin.
Actin
Thin microfilaments.
How many bases are needed to code for an amino acid?
Three.
How many bases is a codon?
Three.
How many sodium ions does the sodium-potassium pump move out of the cell?
Three.
A codon consists of _____ bases and specifies which _____ will be inserted into the polypeptide chain.
Three; amino acid.
Where does an anticodon bind?
To the codon.
Pyrimidine + Pyrimidine
Too narrow.
The process by which an mRNA sequence is interpreted and used to direct the synthesis of a protein is called?
Translation.
The synthesis of protein using mRNA as a guide is called?
Translation.
Three features of channel proteins
Transport is passive, specific (only certain molecules can pass through), and gated (exist in open or closed positions).
Two types of mobile DNA
Transposons and retrotransposons.
True or False: A carbon atom can form a single or double bond with another atom.
True.
True or False: A parent's alleles segregate during gamete production.
True.
True or False: ATPases may change the charge balance across the membrane.
True.
True or False: Cells require a constant input of energy for reactions.
True.
True or False: Chloroplasts possess DNA.
True.
True or False: H2O is a solvent for biological reactions.
True.
True or False: rRNA is a piece of the protein.
True.
Protist
Unicelluar, sometimes multicellular or colonial, eukaryotes.
Helicase
Unwinds the DNA strand.
What was Thalidomide used for?
Used as a sedative for pregnant mothers (prevented nausea), 1958 - late 1960s.
Enantiomer isomers
Variation in spatial arrangement around an asymmetric.
Structural isomers
Variations in covalent partners.
Examples of type of cancer treatment drug that prevents microtubules from elongating (polymerizing)?
Vicristine, vinblastine, and taxol.
Conclusions of Thomas Hunt Morgan's fruit flies?
White-eyed mutant allele must be located on the x chromosome and the findings supported the chromosome theory of inheritance.
Purine + Pyrimidine
Width consistent with X-ray data.
Does the sodium potassium pump require energy?
Yes, ATP is required.
When you sequence the the same piece of DNA from a third person with the same rare genetic disease you find that one nucleotide has been inserted into the gene. Would you begin to suspect that mutations in the gene are causing the disease?
Yes, because all three people have mutations in the same gene.
Is an anticodon a part of mRNA or tRNA?
tRNA.
Concentration of carbon in the atmosphere?
0.04%.
How large is a prokaryotic cell?
1-10um.
Starch linkage
1-4 linkage of alpha glucose.
Cellulose linkage
1-4 linkage of beta glucose, generally unbranched.
If the codon consisted of only two nucleotides, what would be the maximum amount of amino acids that proteins could contain?
16 amino acids.
How much ATP does cellular respiration produce from ADP and phosphate?
36 ATP.
If a codon consisted of only one nucleotide, what would be the maximum amount of amino acids that proteins could contain?
4 amino acids.
How many chromosomes are in a human liver cell?
46 chromosomes.
What is the genetic material in HIV? A. Reverse transcriptase B. DNA C. RNA D. Viral coat proteins E. Human phospholipids
C. RNA.
Metaphase
Chromosomes align on the metaphase plate (equator) or the middle of the cell.
How many bonds does sulfur normally form in biological molecules? A. Three B. Five C. One D. Two E. Four
D. Two.
Reduction
Electrons gained.
True or False: Leader and trailer sequences are also translated into the cytoplasm.
False; leader and trailer sequences are not translated into the cytoplasm.
True or False: Neurons are not electrically active.
False; neurons are electrically active.
Where do homologous chromosomes pair?
Metaphase plate.
Valence shell
Outermost shell containing electrons.
Which eukaryotes contain chloroplasts?
Plants and some protists.
Glucagon
Raises blood glucose.
True or False: Offspring inherit one allele from each parent.
True.
Concentration of O2 in the atmosphere?
22%.
What is GTP similar to?
ATP.
During which stage of cell division do chromatids separate at the centromere?
Anaphase.
How many amino acids would be encoded by the open reading frame in the following sequence: CGCAGCAUGGGCCCGUAUUGACCGGGA A. 3 B. 4 C. 5 D. 7 E. 9
B. 4.
Gorilla skin cells have 48 chromosomes. How many chromosomes do gorilla egg cells have? A. 6 B. 12 C. 24 D. 96
C. 24.
How many CO2 molecules are produced when one pyruvate molecule goes through aerobic respiration? A. 1 B. 2 C. 3 D. 6 E. 12
C. 3.
Bonds between which two groups form polypeptides?
Carboxyl and amino groups.
Dominantly Inherited Disorders
Disease produced by a dominant allele (no carriers, always expressed).
Purine
Double ring structure; adenine and guanine.
Purine + Purine
Too wide.
If two genes are genetically "linked" they are A. Physically close together on the same chromosome B. On the same chromosome but at opposite ends C. On different chromosomes D. On the X or Y chromosomes E. Attached during chromosomal aberations
A. Physically close together on the same chromosome.
What does the G-protein do once activated?
Activates Adenylyl cyclase which converts ATP to cAMP.
Where does the substrate bind on the enzyme?
Active site.
Function of mitochondria
Aerobic respiration and ATP production.
Which source of energy is most directly responsible for ATP synthesis in the chloroplast? A. NADH oxidation on the thylakoid membrane. B. NADPH oxidation on the thylakoid membrane. C. A pH gradient across the thylakoid membrane. D. CO2 by the Calvin cycle. E. Light converting ADP + phosphate to ATP.
C. A pH gradient across the thylakoid membrane.
In what fashion is hemophilia inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
C. X-Linked.
CAM Plants
C4 acid produced at night; stomates closed during the day.
Oxidation
Electrons lost.
How large is a eukaryotic cell?
10-100um.
What is P53?
A checkpoint protein that is a tumor suppressor.
On what are duplicated chromosomes organized on?
A network of microtubules.
_____ are components of phospholipids. A. Fatty acids B. Citric and maleic acids C. Amino acids D. Nucleic acids E. Acid rocks
A. Fatty acids.
Allele
Alternative form of a gene.
How many carbons are in a pyruvate? A. 1 B. 2 C. 3 D. 6 E. 12
C. 3.
Which of the following represents a polar covalent bond(s)? A. H-H B. C-C C. H-O D. C-H E. O--O
C. H-O.
Which gas was much less abundant in Earth's early atmosphere than it is now? A. N2 B. CO2 C. H2O D. O2 E. H2
D. O2.
What does the rate of diffusion depend on?
Difference in concentration.
How many electrons can the third valence shell fit?
Eight.
Reproductive cells
Human reproductive cells have 23 chromosomes and are haploid cells (n).
What type of bonds are important in protein folding?
Hydrogen bonds.
What is translation?
Protein synthesis.
Is RNA a long-lived molecule or a short-lived molecule?
Short-lived molecule.
Where is ATP synthase embedded in plants?
Thylakoid membrane.
Which end of the RNA does the RNA cap bind to?
5' end.
What type of biological molecule is/are inserted into bacteria by bacteriophages to start a viral infection? A. Nucleic acids only B. Protein only C. Carbohydrate only D. Nucleic acids and protein E. The entire virus enters the bacteria
A. Nucleic acids only
Which of the following contains the vast majority of the cell's DNA? A. Nucleus B. Vacuole C. Mitochondria D. Cytoskeleton E. All of the above
A. Nucleus
Meiosis II is similar to mitosis in that A. Sister chromatids separate during anaphase B. DNA replicates before division C. Daughter cells are diploid D. Homologous cells synapse
A. Sister chromatids separate during anaphase.
Which of the following is a reasonable explanation for why unsaturated fatty acids help keep any membrane more fluid at lower temperatures? A. The double bonds form a kink in the fatty acid tail, forcing adjacent lipids to be further apart. B. Unsaturated fatty acids have a higher cholesterol content. C. Unsaturated fatty acids make membranes leaky enabling the organism to better control their temperature. D. The double bonds block interaction among the hydrophilic head groups of the lipids. E. The double bonds result in a shorter fatty acid tail.
A. The double bonds form a kink in the fatty acid tail, forcing adjacent lipids to be further apart.
Coupled transport
Active transport is coupled with facilitated diffusion.
How can the balance of H+ and OH- in H2O be upset?
Addition of acids (increase H+) or bases (increase OH-).
Bases of DNA
Adenine, guanine, cytosine, and thymine.
What type of cells is an isotonic solution good for?
An isotonic solution is healthy for both animal and plant cells.
What stage do homologous chromosomes separate?
Anaphase I.
Enzymes
Are biological catalysts, are proteins, and depend on their shape for activity.
Results of the Beadle and Tatum study?
Arginine is a necessary protein for growth in bread mold mutants. Phenotype was changed because one enzyme was changed, confirming the one gene-one enzyme hypothesis.
An aqueous solution has pH of 4. What is the H+ concentration? A. 1*10^4 M B. 1*10^-4 M C. -1*10^4 M D. -1*10^-4 M
B. 1*10^-4 M.
What functional group is -N-H2? A. Hydroxyl group B. Amino group C. Sulfhydryl group D. Carboxylic group E. Carbonyl group
B. Amino group.
In what fashion is sickle cell anemia inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
B. Autosomal recessive.
You have a yeast strain that has a defect in cytochrome oxidase. Under what conditions, if any, could that cell grow? A. It can grow by aerobic respiration. B. It can grow by alcohol fermentation. C. It can grow by photosynthesis. D. B and C are correct. E. It will not be able to grow under any circumstances.
B. It can grow by alcohol fermentation.
What is the effect of a nonsense mutation in a gene? A. It alters the reading frame of the mRNA. B. It introduces a premature stop codon into the mRNA. C. It has no effect on the amino acid sequence of the encoded protein. D. It prevents introns from being excised. E. It changes an amino acid in the encoded protein.
B. It introduces a premature stop codon into the mRNA.
Carbon dioxide (CO2) is released during which of the following stages of cellular respiration? A. Glycolysis and the oxidation of pyruvate to acetyl CoA. B. Oxidation of pyruvate to acetyl CoA and the citric acid cycle. C. The citric acid cycle and oxidative phosphorylation. D. Oxidative phosphorylation and fermentation. E. Fermentation and glycolysis.
B. Oxidation of pyruvate to acetyl CoA and the citric acid cycle.
Which of the following is a difference between RNA and DNA? A. RNA uses sulfur, while DNA uses phosphorous. B. RNA uses the sugar ribose, while DNA uses the sugar deoxyribose. C. RNA uses the base thymine, while DNA uses the base uracil. D. RNA is found only is prokaryotes. E. DNA is found only in Martian organisms.
B. RNA uses the sugar ribose, while DNA uses the sugar deoxyribose.
Which of the following is an example of a hydrogen bond? A. The bond of C and H in methane (CH4). B. The bond between H of water and O of another molecule. C. The bond between Na and Cl in salt (NaCl). D. The bond between two hydrogen atoms (H2). E. The bonds between S and H in Sulfhydryl.
B. The bond between H of water and O of another molecule.
What is transcription? A. The making of a new strand of DNA using the old strand as a guide. B. The making of RNA using DNA as the guide. C. The making of protein using mRNA as the guide. D. The changing of DNA into RNA. E. The conversion of amino acids into codons.
B. The making of RNA using DNA as the guide.
When DNA from dead Streptococcus pneumoniae "S" is added to living "R" cells and this mixture injected into mice. What happens? A. The mouse lives B. The mouse dies
B. The mouse dies.
Which is an example of a lipid? A. Insulin B. Triglyceride C. Chitin D. ATP E. Maltose
B. Triglyceride.
Which RNA or RNAs has an amino acid covalently linked to it at some point while making new proteins? A. mRNA B. tRNA C. rRNA D. Both mRNA and tRNA E. mRNA, tRNA, and rRNA
B. tRNA.
What are the three domains?
Bacteria, archaea, eukarya.
3 (P-5C-P) + 3O2 to 3(3C-P) + 2(2C-P), good reaction or bad?
Bad reaction.
Why are oil molecules hydrophobic?
Because they have relatively non-polar bonds.
Metabolic pathway
Begins with a specific molecule and ends with a product. Each step is catalyzed by a specific enzyme.
How does HIV infection occur?
Bodily fluid transfer.
Amylopectin
Branched polymer.
Maltose is a disaccharide consisting of two glucose sugars linked together. What is its formula? A. C6-H12-O6X2 B. C12-H20-O10 C. C12-H22-O11 D. C12-H24-O12 E. C11-H22-O11
C. C12-H22-O11.
A five carbon sugar has which of the following chemical formulas: A. C5-H5 B. C5-H12-O6 C. C5-H10-O5 D. C5-H6-O12 E. C5-H5-O5
C. C5-H10-O5.
During cell division, _______ attach to the ______ of the chromosome. A. Ribosomes, metaphase B. Ribosome, telomere C. Microtubules, kinetochore D. Microfilaments, telomere E. Endoplasmic reticulum, centrosome
C. Microtubules, kinetochore.
In which of the following would you find starch? A. Liver cells B. Muscle cells C. Potato tuber D. Brain tumor E. A piece of paper
C. Potato tuber.
What functional group is -S-H? A. Hydroxyl group B. Amino group C. Sulfhydryl group D. Carboxylic acid E. Carbonyl group
C. Sulfhydryl group.
Anaerobic
Cells break down compounds and produce energy in the absence of oxygen.
Acid rain sometimes has a pH of 5. What is the H+ concentration? A. 1*10^5 M B. 5*10^-1 M C. 5*10^-5 M D. 1*10^-5 M E. 1*5^10 M
D. 1*10^-5 M.
How many CO2 molecules are produced when one maltose molecule is completely converted to CO2 and H2O by aerobic respiration? A. 3 B. 6 C. 10 D. 12 E. 18
D. 12.
Which of the following trait or disease is inherited in an autosomal dominant fashion? A. Sickle cell B. Tay Sachs C. Hemophilia D. Polydactyly E. Ebola
D. Polydactyly.
What does the mitochondria possess?
DNA and ribosomes.
What is the pH solution with [H+] = 10^-4 M? A. 40,000,000 B. 40,000 C. 400 D. 40 E. 4
E. 4.
Heterozygous
Genotype consists of two different alleles (Pp).
N =
Haploid, one of every chromosome.
What does H2O to NADP+ create?
NADPH.
Heterotrophic
Organisms produce energy from autotrophic organisms.
Where is the electron transport membrane embedded in plant cells?
Thylakoid membrane.
What does adenine bond with?
Thymine (purine to pyrimidine).
Sex-Linkage on X-Chromosome
Trait is on the X chromosome. Heterozygous female is a "carrier."
True or False: Homologous chromosomes are physically similar.
True.
Phagocytosis
Uptake of very large particles (vacuole and lysosome).
How does an enzyme catalyze a reaction? A. By lowering the activation energy of a reaction. B. By supplying the energy to speed up a reaction. C. By changing the equilibrium of a spontaneous reaction. D. By increasing the amount of free energy of a reaction. E. All of the above.
A. By lowering the activation energy of a reaction.
The stage of the cell that occurs immediately after cytokinesis is: A. G1 Phase B. G2 Phase C. Meiosis D. S Phase E. Mitosis
A. G1 Phase.
Anabolism
Building up.
What type of signaling is long-distance? A. Paracrine signaling B. Synaptic signaling C. Endocrine signaling D. Both A and B E. Answer choices A, B, and C are all correct
C. Endocrine signalling.
Which of the following types of molecules are the major structural components of the cell membrane? A. Phospholipids and cellulose B. Nucleic acids and proteins C. Phospholipids and proteins D. Proteins and cellulose E. Saran wrap and duct tape
C. Phospholipids and proteins.
Which of the following types of transport requires energy? A. Simple diffusion B. Osmosis C. Facilitated diffusion D. Active transport
D. Active transport.
Which of the following is part of RNA editing? A. Adding the 5' cap to the message B. Adding a 3' poly A tail to the message C. Removing introns from the message D. All of the above answers are correct
D. All of the above answers are correct.
What type of signaling is short-distance? A. Paracrine signaling B. Synaptic signaling C. Endocrine signaling D. Both A and B E. Answer choices A, B, and C are all correct
D. Both A and B.
What is the direct source of energy that drives ATP synthesis by the mitochondrial ATP synthase? A. Oxidation reduction reactions B. O2 reduction C. The Krebs cycle D. H+ gradient across the inner membrane E. Pyruvate
D. H+ gradient across the inner membrane.
You and a nosey friend notice a couple sitting near you in the student union talking to one another. You speculate that they may be brother and sister. In relation to the scientific method of inquiry, your speculation is comparable to the _____ step? A. Observation B. Conclusion C. Test or gather information D. Hypothesis E. Enact a law
D. Hypothesis.
Nature of neural signals
Electrical potential across the plasma membrane.
Meiosis I
Homologous chromosomes pair, crossover occurs, the chromosomes separate, and the cell divides.
What does mRNA tell the cell to make?
Protein.
Ribosomes structure
Proteins and RNA (ribosomal RNA or rRNA).
Where does mRNA editing occur?
The nucleus.
Cl- is an example of a _____? A. Amphipathic molecule B. Cation C. Anion D. Zwitterion E. Iconoclast
C. Anion.
Axon
Connection.
What do stomach cells do in response to epinephrine?
Constrict.
What does Adenylyl cyclase do?
Converts ATP to cAMP.
Hydrogen bonds between water molecules influences A. An insect's ability to walk on water. B. The ability of a tree to transfer water from the roots to the leaves. C. The ability of water to store large quantities of heat. D. All of the above answers is correct. E. None of the above answers is correct.
D. All of the above answers is correct.
What is the genetic material of the coronavirus responsible for the current pandemic? A. Double strand DNA B. Single strand DNA C. Double strand RNA D. Single strand RNA E. The spike protein
D. Single strand RNA.
Which of the following is an example of a lipid? A. Insulin B. Sucrose C. Cellulose D. Triglyceride E. ATP
D. Triglyceride.
Two major types of nucleic acids
DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
R cells + Dead S cells
Dead.
Thalidomide (C13H10N2O4)
Drug, mixture of enantiomers.
A tissue weighs 100 micrograms. What is that weight in grams? A. 1 g B. 0.1 g C. 0.01 g D. 0.001 g E. 0.0001 g
E. 0.0001 g.
What do genes code for?
Enzymes.
E site of ribosome
Exit site.
Exocytosis
Export of macromolecules by secretion (animal and plant cells).
What do C4 and Cam plants require more of?
Extra ATP (NADPH).
True or False: All cells respond to epinephrine exactly the same way.
False; Not all cells respond to epinephrine the same way, some cells do not respond to epinephrine at all.
True or False: The promoter and operator regions are not pieces of DNA.
False; The promoter and operator regions are both DNA.
Three phases of fixing CO2 into sugars
Fixation, reduction, and regeneration.
Hydroxyl
Form alcohols and produce polar molecules.
Amino group
Form amines, normally act as bases. Functional group for amino acids.
Thomas Hunt Morgan
Hypothesized that genetic information was carried by chromosomes.
What is the function of RNA polymerase?
It unwinds the double helix and adds nucleotides to a growing strand of RNA.
Two ways to lower blood calcium
Kidneys uptake more calcium and urinate it out and bones deposit calcium.
Glycogen
Like amylopectin but more highly branched.
Does a eukaryotic cell have circular or linear DNA?
Linear DNA.
Calcitonin
Lowers blood calcium.
Insulin
Lowers blood glucose.
Side effects of Thalidomide
Major birth defects.
Co-Dominant
More than one type of allele can be dominant (and expressed).
Polyploidy
More than two sets of chromosomes (extremely rare in animals but relatively common in plants).
What two high energy molecules fix CO2 into sugars?
NADPH and ATP.
What is the "fire" synapse controlled by?
Na+.
Science
Natural explanations for observable events developed by use of the scientific method.
Does the sodium-potassium pump cause the inside of the cell to be more positive or negative?
Negative.
What does NADH donate electrons to?
O2, forming H2O.
Steps of the scientific method
Observation, hypothesis, experiment, and conclusion.
How many errors are there in DNA replication?
One error in one billion base pairs.
In pure water, how often does dissociation occur?
One in every 554 million H2O molecules.
How large is a prokaryotic cell compared to a eukaryotic cell?
One-tenth the size.
How many cell divisions occur in mitosis?
One.
Autotrophic
Organisms produce energy from chemical energy source, primarily by photosynthesis.
Function of peroxisomes
Oxidation of various molecules, produces hydrogen peroxide (H2-O2).
Metaphase I
Paired chromosomes align on the metaphase plate.
Nervous systems
Parallel regulation of physiology and behavior.
P site of ribosome
Peptidyl-tRNA binding site.
What is amino acid is UUU?
Phenylalanine.
Membrane structure
Phospholipid bilayer, integral proteins, and peripheral proteins.
Major components of the plasma membrane
Phospholipids and proteins.
Function of chloroplast
Photosynthesis.
What are the three kingdoms of multicellular organisms (eukarya)? What kingdom also falls under this group?
Plantae, fungae, animalia, and protists.
Which eukaryotes contain a central vacuole?
Plants, fungi, and protists.
Function of the cell wall
Protects the cell from lysis and controls cell shape.
Ribosomes
Protein RNA structures that make proteins.
What are ribosomes made of?
Protein and RNA.
Protein phosphatase
Remove the phosphates from proteins, process known as protein phosphorylation.
Simple diffusion
Requires no energy and no protein.
What enzyme catalyzes carbon fixation?
Rubisco.
Motor output
Signal from the CNS carried via PNS to effector cells.
Pyrimidine
Single ring structure; cytosine, thymine, and uracil.
Genome of rhabdovirus
Single-stranded RNA; template for mRNA synthesis.
Pumps (ATPases)
Solutes move by active transport. Energy from ATP hydrolysis moves ions against a concentration gradient.
Vaccines
Stimulate natural immuno-defense system before infection.
True or False: C4 and CAM plants improve photosynthesis because CO2 is increased at Rubisco.
True.
True or False: Hormones often result in changes in transcription.
True.
True or False: Light energy drives electron transport from H2O to NADP+.
True.
True or False: Oil is hydrophobic.
True.
True or False: Prokaryotic cells lack a nucleus.
True.
True or False: Proteins account for more than 50% of the dry mass of most cells.
True.
True or False: RNA sequence grows from 5' to 3' by addition of nucleotides.
True.
True or False: tRNA has a unique anticodon for each codon and amino acid.
True.
How many amino acids are in natural proteins?
Twenty.
Solution
A liquid that is a homogeneous mixture of substances.
What is rhodopsin?
A receptor protein.
A mature mRNA sequence that is 600 nucleotides from the start of the AUG to the beginning of the stop codon. How many amino acids will be in the final protein this mRNA codes for? A. 200 B. 300 C. 600 D. 1200 E. 1800
A. 200.
Which molecule will yield the most energy in aerobic respiration? A. Glucose B. Pyruvate C. ATP D. NADH E. H2O
A. Glucose.
R cells + S cell protein
Alive.
Coupled reaction
An unfavorable reaction (endergonic) is linked to a favorable reaction (exergonic) such as ATP cleavage.
You have two copies of chromosome ten, one from your mother and one from your father. These chromosomes are ____. A. Heterologous chromosomes B. Homologous chromosomes C. Homozygous chromosomes D. Gametes E. Sex chromosomes
B. Homologous chromosomes.
Purpose of cellular respiration
Breakdown glucose to make ATP.
How many NADH are produced when one acetyl-CoA molecule goes through the Krebs Cycle? A. 1 B. 2 C. 3 D. 6 E. 12
C. 3.
Which source of energy is most directly responsible for ATP synthesis in the chloroplast? A. NADH oxidation on the thylakoid membrane B. Glucose breakdown C. A pH gradient across the thylakoid membrane D. CO2 fixation in the stroma E. Light converting ADP+ phosphate to ATP
C. A pH gradient across the thylakoid membrane.
Three membrane proteins that play an integral role in transport
Carriers, channels, and electrogenic pumps (ATPases).
Different intracellular proteins
Different cell responses.
Osmosis
Diffusion of water through a selectively permeable membrane.
What kind of bond is found between paired bases on the two strands of the DNA double helix? A. Phosphate B. Ionic C. Covalent D. Sulfhydryl E. Hydrogen
E. Hydrogen.
What stages does meiosis I consist of?
Prophase I, metaphase I, anaphase I, and telophase I.
During what stage of cell division does crossing over of DNA occur?
Prophase I.
Protein Kinase
Transfer phosphate from ATP to protein.
During which stage of cell division do microtubules form?
Prophase.
Which of the following processes occurs when homologous chromosomes cross over in meiosis I? A. Two sister chromatids get tangled, resulting in one re-sequencing its DNA. B. Two sister chromatids exchange identical pieces of DNA. C. Corresponding segments of non-sister chromatids are exchanged. D. Maternal alleles are "corrected" to be like paternal alleles and vice versa. E. During crossover the sister chromatids are pulled to the spindle poles.
C. Corresponding segments of non-sister chromatids are exchanged.
The making of an exact copy of DNA is called _____. A. DNA excitation B. DNA transcription C. DNA replication D. DNA crossover E. DNA transformation
C. DNA replication.
Which one of these steps releases the most CO2? A. Glycolysis B. Oxidation of pyruvate to acetyl CoA C. Krebs cycle D. Electron transport E. Chemismotic ATP synthesis
C. Krebs cycle.
In the scientific method, which is the next step after making a hypothesis? A. Making a conclusion. B. Proving the hypothesis is incorrect. C. Test the hypothesis. D. Argue with other scientists. E. Prove the hypothesis is correct.
C. Test the hypothesis.
In what fashion is Duchenne muscular dystrophy inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
C. X-linked.
In what fashion is color blindness inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
C. X-linked.
Mobile elements of DNA
Can move and copy themselves.
Four types of macromolecules
Carbohydrates, lipids, proteins, and nucleic acids.
Mutation
Changes in DNA base sequence.
What do hydrogen bonds between water molecules produce?
Cohesion.
Chromosome
Composed of a long DNA molecule, and proteins in eukaryotic cells.
An unequal sharing of electrons between atoms results in ___. A. A nonpolar covalent bond B. An ionic bond C. A disulfide bond D. A polar covalent bond E. A hydrophobic interaction
D. A polar covalent bond.
K+ is transported into cells by a protein that cleaves ATP. The concentration of K+ inside the cell is greater than the K+ outside the cell. What type of transport is occurring? A. Exocytosis B. Endocytosis C. Phagocytosis D. Active transport E. Simple diffusion
D. Active transport.
Which of the following is an example of secondary protein structure? A. When the subunits of hemoglobin come together to form the whole protein. B. When a protein folds up into its final form. C. The protein sequence is leucine-valine-glycine. D. Beta-Sheet. E. All of the above.
D. Beta-sheet.
Chlorophyll molecules mostly absorb the _____ wavelengths of visible light. A. Green B. Blue C. Red D. Both C and B E. It absorbs in red, green, and blue wavelengths
D. Both C and B.
What type of photosynthesis is done by sugar cane? A. Lactic acid fermentation B. Molasses shunt-type carbon fixation C. C3-type photosynthesis D. C4-type photosynthesis E. CAM type photosynthesis
D. C4-type photosynthesis.
Which one of these steps oxidizes NADH? A. Glycolysis B. Oxidation of pyruvate to acetyl CoA C. Krebs cycle D. Electron transport E. Chemismotic ATP synthesis
D. Electron transport.
A chemical reaction that requires energy to take place is called: A. Pyrotechnic reaction B. Adiabatic reaction C. Exergonic reaction D. Endergonic reaction E. Allergic reaction
D. Endergonic reaction.
Which is the correct location of the Krebs cycle? A. Mitochondrial inner membrane B. Mitochondrial outer membrane C. Between the inner and outer membrane of the mitochondria D. In the mitochondrial matrix E. In the cytoplasm
D. In the mitochondrial matrix.
This process produces CO2 and uses acetyl CoA: A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Pyruvate oxidation
D. Krebs cycle.
A lion pride is chasing zebras. The physiological conditions of these zebras are given below. Zebra A has depleted glucose levels and his muscles are well oxygenated. Zebra B has depleted glucose levels and his muscles are anaerobic. Zebra C has normal glucose levels and his muscles are well oxygenated. Zebra D has normal glucose levels and his muscles are anaerobic. Which zebra is using glucose at the fastest rate? A. Zebra A B. Zebra B C. Zebra C D. Zebra D
D. Zebra D.
The macromolecule that carries the blueprint needed for the ribosome to build a protein of the correct sequence is called _____. A. DNA polymerase B. An intron C. rRNA D. mRNA E. tRNA
D. mRNA.
The macromolecule that carries the blueprint needed for the ribosome to build a protein of the correct sequence is called ________. A. DNA polymerase B. An intron C. rRna D. mRNA E. tRNA
D. mRNA.
Conclusions to the Hershey and Chase experiment
DNA is entering the bacteria and changing the programming.
Fungi
Defined by the nutritional mode of its members, such as mushrooms, which absorb nutrients after decomposing organic material.
What do blood cells do in response to epinephrine?
Dilate.
Eukarya
Domain that describes eukaryotes; consists of the kingdoms plantae, fungae, and animalia, along with protists.
Hierarchical classification system
Domain, kingdom, phylum, class, order, family, genus, and species. (Dear King Philip Please Come Over For Good Spaghetti)
Genome of reovirus
Double-stranded RNA.
Is diffusion a net movement of molecules up or down a concentration gradient?
Down a concentration gradient.
Does RNA polymerase work "upstream" or "downstream?"
Downstream.
How many CO2 are made from one glucose during lactic acid fermentation? A. 1 B. 2 C. 3 D. 6 E. 0
E. 0.
This component is found in prokaryotic cells: A. Carbohydrate B. Lipid C. Protein D. Nucleic acid E. All of the above
E. All of the above.
Which organelle contains proteins? A. Mitochondria B. Nucleus C. Chloroplast D. Vacuole E. All of the above
E. All of the above.
In a human cell, what percentage of the genes are being actively transcribed? A. Over 90% B. Between 50% and 90% C. Between 25% and 50 % D. Between 10% and 25% E. Less than 10%
E. Less than 10%.
In pure water about how many of the water molecules are dissociated into H+ and OH-? A. No water molecules dissociate in pure water. B. About 1 in every 7 water molecules have dissociated. C. About 1 in every 700 water molecules has dissociated. D. About 1 in every 10,000 water molecules has dissociated. E. Less that 1 in 1 million water molecules has dissociated.
E. Less that 1 in 1 million water molecules has dissociated.
You have recently found out that your father is a carrier of the cystic fibrosis trait and your mother is homozygous normal. You do not have cystic fibrosis. Neither of your paternal grandparents have cystic fibrosis. Which grandparent is likely to be a carrier of the cystic fibrosis gene? A. Your paternal grandmother must be a carrier B. Your paternal grandfather must be a carrier C. Both grandparents have to be carriers D. Neither grandparent is a carrier E. One or both grandparent(s) must be a carrier but you don't know who
E. One or both grandparent(s) must be a carrier but you don't know who.
Which component is present in prokaryotic cells? A. Mitochondria B. Cytoskeleton C. Golgi apparatus D. Endoplasmic reticulum E. Ribosomes
E. Ribosomes.
How do the two members of a pair of homologous chromosomes differ from each other? A. Their lengths are different. B. The identity and positions of the genes present on each of the chromosomes are different. C. Their staining patterns in a karyotype are different. D. The positions of the centromere within each of the chromosomes are different. E. The sequences of the DNA of the chromosomes are different.
E. The sequences of the DNA of the chromosomes are different.
Three main parts of cellular respiration
Glycolysis, krebs cycle, and electron transport chain.
Sickle-Cell Anemia
Hemoglobin formation; heterozygous condition produces protection against malaria.
What is the result when a diploid cell undergoes mitosis? A. 2 diploid cells B. 2 haploid cells C. 4 diploid cells D. 4 haploid cells E. 2 diploid and 2 haploid cells
A. 2 diploid cells.
A strain of bacteria is found that is antibiotic resistant. After mixing a heat-killed, antibiotic-resistant strain of bacteria with a living antibiotic sensitive strain, you discover that some of the living cells are now antibiotic resistant. Since this antibiotic resistance is a heritable trait, what do you think happened? A. DNA passed from the heat-killed strain to the living strain. B. Protein passed from the heat-killed strain to the living strain. C. Lipid passed from the heat-killed strain to the living strain. D. Both DNA and protein passed from the heat-killed strain to the living strain. E. Zombie bacteria obtained the brains of the living bacteria.
A. DNA passed from the heat-killed strain to the living strain.
What is the codon that codes for Met and START?
AUG.
Competitive inhibition
Active site is blocked.
Which eukaryotes contain the endoplasmic reticulum?
All eukaryotes.
What does the receptor protein do?
Allows a G-protein to bind to it, activating it.
Primary protein structure
Amino acid sequence as determined by genetic code.
Polypeptide has _____ and _____ ends.
Amino; carboxyl.
A site of ribosome
Aminoacyl-tRNA binding site.
Which statement about sickle cell anemia is true? A. It is a contagious disease. B. A sickled red blood cell containing rods of hemoglobin S and cannot enter capillaries. C. The mRNA sequence for hemoglobin in a person with sickle cell anemia and a person that does not have the disease is identical. D. People with sickle cell anemia often begin to make normal hemoglobin after a few years of treatment. E. Sickle cell anemia is caused by a virus.
B. A sickled red blood cell containing rods of hemoglobin S and cannot enter capillaries.
What is a hypothesis? A. An unproven explanation that can be tested and is falsifiable. B. A tentative explanation that can be tested and is falsifiable. C. A verifiable observation sensed directly or indirectly with the aid of scientific instrumentation. D. A fact based on qualitative data that is testable. E. A fact based on quantitative data that is falsifiable.
B. A tentative explanation that can be tested and is falsifiable.
Reactants capable of interacting to form products in a chemical reaction must first overcome a thermodynamic barrier known as the reaction's _____? A. Entropy B. Activation energy C. Endothermic level D. Heat content E. Free-energy content
B. Activation energy.
The early atmosphere on Earth had almost no O2. What early evolutionary event correlates with the appearance of O2 in the atmosphere? A. Appearance of aerobic respiration. B. Appearance of photosystem II. C. Appearance of rubisco. D. Appearance of alcohol fermentation.
B. Appearance of photosystem II.
In what fashion is Tay-Sachs inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
B. Autosomal recessive.
Which end of the RNA does the Poly-A tail bind to?
3' end.
What percentage of living cells are H2O?
70 - 95%.
Na+ is an example of a(n) _____? A. Amphipathic molecule B. Cation C. Anion D. Zwitterion E. Iconoclast
B. Cation.
When you continue investigating this DNA change you find that the sequence change has occured in an exon. The change results in a change in the protein sequence also. What type of change has occured?
A missense mutation.
How many FADH2 are produced when one acetyl-CoA molecule goes through the Krebs Cycle? A. 1 B. 2 C. 3 D. 6 E. 12
A. 1.
Prophase I
Crossover of homologous chromosomes.
Which protein gives electrons to O2?
Cytochrome oxidase.
What is the process by which a cell actually divides?
Cytokinesis.
Where does transcription occur?
The nucleus.
True or False: The charge imbalance caused by ATPases can drive the transport of other molecules.
True.
Consequences of a frameshift mutation?
Usually every amino acid after the insertion or deletion will be different from the normal protein.
How does the HIV virus affect the immune system?
Virus infects cells with certain cell surface protein (immuno defense cells). Immuno defense fends off the virus, but eventually the cells are depleted.
How many chromosomes are in a human skin cell that is in the G1 portion of the cell cycle? A. 23 B. 39 C. 46 D. 69 E. 92
C. 46.
How many pairs of sister chromatids would you expect to see in a human skin cell that was exiting G2 of the cell cycle? A. 23 B. 39 C. 46 D. 69 E. 92
C. 46.
The atomic weight of water is 18. In 100 grams of water, there are about ___ of water. A. 55 molecules B. 5.5 molecules C. 5.5 moles D. 55 moles E. 18 moles
C. 5.5 moles.
How many pairs of autosomes do humans possess?
22 pairs.
There is a one base chain in a RNA sequence changing a codon from UCA (serine) to UAA (stop). What type of mutation is this?
A nonsense mutation.
What functional group is -O-H? A. Hydroxyl B. Methyl C. Amino D. Sulfhydryl E. Phosphate
A. Hydroxyl.
Control points of gene expression
Accessibility of DNA, initiation of transcription, RNA processing and transport, mRNA stability and degradation, initiation of translation, and processing and degradation of protein.
What is the hormone that causes the "flight or fight" response?
Adrenaline or epinephrine.
Quaternary protein structure
Aggregation of polypeptides.
R cells + S cell carbohydrates
Alive.
The mitotic spindle is composed of _____. A. Actin microfilaments B. Microtubules C. Carbohydrates D. Polysomes E. Sickle cell hemoglobin
B. Microtubules.
Three ways to raise blood calcium
Bones release calcium to the blood, kidneys uptake less calcium, and intestines uptake more calcium from diet.
What do liver cells do in response to epinephrine?
Break down glycogen to produce glucose.
A virus incorporates its DNA into the host DNA. It replicates along with the host DNA. What type of viral growth is this? A. Lambdic growth B. Lytic growth C. Lysogenic growth D. Listerine growth E. Labyrinth-type growth
C. Lysogenic growth.
Which part of the eukaryotic cell is made up of only one protein? A. The lysosome B. The cell wall C. The cytoskeleton D. The endoplasmic reticulum E. Answers B and C
C. The cytoskeleton.
The molecular formula for glucose is C6-H12-O6. What would be the molecular formula for a molecule made by linking three glucose molecules together by dehydration reactions?
C18-H32-O16.
C4 Plants
C4 acid produced in mesophyll cells, Calvin cycle in bundle sheath cells (vein).
What reduces the good and bad reaction problem?
C4 and CAM plants.
Cellular respiration formula
C6H12O2 + 6O2 ------> 6CO2 + 6H20 + Energy (ATP)
Are carbohydrates linear or ringed structures?
Carbohydrates are both linear and ringed structures.
What are carbohydrates made of?
Carbon, hydrogen, and oxygen.
What are lipids made of?
Carbon, hydrogen, and oxygen.
What are nerve impulses?
Changes in membrane potential.
Isomers
Common molecular formulae, different structures and properties.
What is the order of information flow during gene expression?
DNA to RNA to protein.
What is the molecule associated with inheritance?
DNA.
R cells + Alive S cells
Dead.
Acquired immunodeficiency syndrome (AIDS)
Death by opportunistic infection.
What does RNA processing protect mRNA from?
Degradation.
Why is Guanine and Cytosine stronger than Adenine and Thymine?
Guanine and Cytosine have three hydrogen bonds as opposed to Guanine and Cytosine only having two hydrogen bonds.
What does cohesion in water lead to?
High surface tension.
Telophase
Migrating chromatids arrive at poles, nuclear membranes form at each pole, and cytokinesis begins.
What happens to the mouse with heat-killed S cells mixed with living R cells?
Mouse dies.
Building blocks of nucleic acids
Nucleotides.
What is the "on-off" switch for a gene?
Operator.
Where does RNA polymerase bind on DNA?
Promoter region.
Elongation
Proper tRNA's align with codons on the mRNA, amino acids are added to the growing polypeptide by peptide bond.
Channel proteins
Solutes move through "pores".
What does RNA polymerase transcribe?
Terminator nucleotides.
What bond angles do carbon compounds form?
Tetrahedron.
Which organ cannot do fermentation?
The brain.
Symbiosis
Theory that different prokaryotic cells living together eventually became eukaryotic.
What is mRNA used for?
Transcription and RNA processing.
The synthesis of RNA using DNA as the guide is called?
Transcription.
An element has 8 protons, 9 neutrons, and 8 electrons. Its atomic number and atomic mass, respectively, are _____. A. 8 and 16 B. 8 and 17 C. 9 and 16 D. 9 and 17 E. 17 and 25
B. 8 and 17.
What structure attaches to the sister chromatids during mitosis? A. Microfilaments B. Microtubules C. Microchromosome attachers D. Nuclear lamins E. Hanging chads (note election reference)
B. Microtubules
Which of the following is not a carbohydrate function? A. Carbohydrates catalyze chemical reactions. B. Carbohydrates are mobile energy molecules. C. Carbohydrates can be structural molecules. D. Carbohydrates are energy storage molecules. E. All of these are functions of carbohydrates.
A. Carbohydrates catalyze chemical reactions.
Which of the following would not normally be found in a plasma membrane? A. Cellulose B. Transport proteins C. Phospholipids D. Cholesterol E. All of the above are normally found in a plasma membrane
A. Cellulose.
The process of endocytosis is: A. Movement of substances into the cell through membrane-bound vesicles. B. Movement of substances out of the cell through membrane-bound vesicles. C. The active transport of molecules into the cell through membrane transport proteins. D. The active transport of molecules out of the cell through membrane transport proteins. E. The passive diffusion of substances across the cell membrane.
A. Movement of substances into the cell through membrane-bound vesicles.
One of the principal functions a cell wall is to _____. A. Protect the cell from osmotic lysis. B. Serve as a barrier to solutes. C. Function in active transport. D. Statements A and B are true. E. Statements A, B, and C are all important functions of the cell wall.
A. Protect the cell from osmotic lysis.
O2 enters human muscle cells. No energy is needed for this process and no transport proteins are required. What membrane transport process is likely to be involved? A. Simple diffusion B. Facilitated diffusion C. Active transport D. Endocytosis E. Phagocytosis
A. Simple diffusion.
In an experiment, DNA extracted from the pathogenic S strain of Streptococcus pneumoniae is mixed with living cells of the non-pathogenic R strain and this mixture is injected into mice. What will happen? A. The mice will die and the bacteria taken from the dead mice will look like the S strain. B. The mice will die and the bacteria taken from the dead mice will look like the R strain. C. The mice will live, any surviving bacteria will look like the S strain. D. The mice will live, any surviving bacteria will look like the R strain.
A. The mice will die and the bacteria taken from the dead mice will look like the S strain.
When protein from dead Streptococcus pneumoniae "S" is added to living "R" cells and this mixture injected into mice. What happens? A. The mouse lives B. The mouse dies C. The mouse gives this restaurant a poor review on Yelp!
A. The mouse lives.
A mature mRNA sequence that is 6000 nucleotides from the start of the AUG to the beginning of the stop codon. You know the exact mRNA sequence. Can you predict the exact amino acid sequence of the protein the mRNA encodes A. Yes B. No C. It will depend on whether it is plant, animal or bacterial mRNA D. The protein sequence depends on the environmental conditions
A. Yes.
Which eukaryotes contain the cytosol?
All eukaryotes.
The portion of mitosis where the sister chromatids have separated and are starting to be pulled to opposite ends of the cell is called __________?
Anaphase.
Compared to 40K, the isotope 39K has A. Different atomic number B. One less neutron C. one less proton D. One less electron E. One less proton and one less electron
B. One less neutron.
Which type of linkage connects amino acids to make the primary sequence in proteins? A. Beta-glycosidic linkages B. Peptide bonds C. 3'-5' phosphodiester linkages D. Disulfide bonds E. Ester bonds
B. Peptide bonds.
Which of the following is true for all exergonic reactions? A. The products have more total energy than the reactants B. The reaction proceeds with a net release of free energy C. The reaction is irreversible D. A net input of energy from the surroundings is required for the reactions to proceed E. The reactions are nonspontaneous
B. The reaction proceeds with a net release of free energy.
One characteristic shared by sucrose, lactose, and maltose is ___? A. They are all polysaccharides B. They are all disaccharides C. They are all monosaccharides D. They all contain fructose E. They cannot be digested by humans
B. They are all disaccharides.
One characteristic shared by sucrose, lactose, and maltose is that __________. A. They are all polysaccharides. B. They are all disaccharides. C. They are all monosaccharides. D. They all contain fructose. E. They cannot be digested by humans.
B. They are all disaccharides.
In the Hershey-Chase experiment which part of the virus was inserted into the host cell to start a viral infection? A. Viral capsule B. Viral nucleic acids C. Viral lipids D. Viral protein E. Viral DNA and the associated proteins
B. Viral nucleic acids.
Meiosis
Division of a diploid cell to form four haploid cells - sexual reproduction.
Which enzyme is responsible for removing the RNA primer during DNA replication? A. DNA polymerase III B. DNA ligase C. Primase D. Helicase E. DNA polymerase I
E. DNA polymerase I.
Carboxyl (carboxylic acid)
Form carboxylic or organic acids. Normally loses proton, produce ionic form. Functional group on amino acids.
Noncompetitive inhibition
Inhibitor binds away from active site changing protein shape.
Genome of paramyxovirus
Single-stranded RNA; template for mRNA synthesis.
Carrier proteins
Solutes moved by changes in carrier protein conformation.
Genome of filovirus
Single-stranded RNA; template for mRNA synthesis.
Genome of orthomyxovirus
Single-stranded RNA; template for mRNA synthesis.
What are lipids classified as?
Triglycerides and diglycerides (phospholipids).
Endergonic reaction
A reaction that requires energy from the surroundings to occur.
Are ribosomes free or bound?
A ribosome can be free or bound.
Hydrophilic
A substance that has an affinity for water.
An unfavorable reaction that occurs along with the cleavage of ATP to ADP and phosphate is an example of: A. A coupled reaction B. An amphipathic reaction C. An endergonic reaction D. An exergonic reaction E. A redox reaction
A. A coupled reaction.
Which one of these steps directly requires O2? A. Glycolysis B. Oxidation of pyruvate to acetyl CoA C. Krebs cycle D. Electron transport E. Chemiosmotic ATP synthesis
D. Electron transport.
Sugar of DNA
Deoxyribose.
Which organism below is capable of aerobic respiration? A. Grass B. Yeast cells C. Oak trees D. Mice E. All of the organisms are capable of aerobic respiration
E. All of the organisms are capable of aerobic respiration.
This process converts glucose into two molecules of pyruvic acid and produces 2 ATP's. A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs cycle E. Glycolysis
E. Glycolysis.
How do you get new viruses?
Emerging diseases.
Characteristics of living things
Has cells, reproduces, grows and evolves, responds to the environment, possesses metabolism, contains genetic material, and performs homeostasis.
What does the noncoding DNA genome include?
Introns, regions between genes, and other repetitive DNA.
What happens to the mouse with living S cells?
Mouse dies.
What protein makes up RNA?
RNA polymerase.
Genome of coronavirus
Single-stranded RNA; serves as mRNA.
Genome of togavirus
Single-stranded RNA; serves as mRNA.
Genome of retrovirus
Single-stranded RNA; template for DNA synthesis.
What is the product from carbon fixation?
Triose phosphate.
True or False: The nucleus possesses chromosomes.
True.
True or False: The promoter and operator are pieces of the DNA sequence?
True.
True or False: The promoter and repressor can overlap.
True.
True or False: tRNA has amino acids at the ends.
True.
Exergonic reaction
A reaction that releases energy when it takes place.
The sequence of one strand of double-stranded DNA molecule is given below. What is the sequence of the other strand? The sequence is 5' C-G-T-A-C-A-A 3'. A. 5' T-T-G-T-A-C-G 3' B. 5' G-C-A-T-G-T-T 3' C. 5' A-A-C-A-T-G-C 3' D. 5' A-T-A-G-G-G-C 3' E. 5' G-C-A-U-G-U-U 3'
A. 5' T-T-G-T-A-C-G 3'.
When a virus infects a cell and its genome integrates with the host genome, that virus is undergoing _________ growth. A. Lytic B. Lysogenic C. Litigious
B. Lysogenic.
This process occurs when beer is brewed. A. Mitochondrial electron transport B. Lactic acid fermentation C. Alcoholic fermentation D. Krebs Cycle E.Glycolysis
C. Alcoholic fermentation.
While at the store you buy some celery. The cells in the celery are _____? A. Dead B. Dead but might come back to life if you planted or left it in a cabinet for a while C. Alive D. Alive but metabollically inactive E. Alive but in a coma
C. Alive.
All of the following are functions of the citric acid cycle except: A. Production of ATP B. Production of NADH C. Consumption of O2 D. Release of carbon dioxide E. All of these
C. Consumption of O2.
A glass of salt water is _____ relative to a glass of pure water. A. Isotonic B. Hypotonic C. Hypertonic D. Barimetric E. Exothermic
C. Hypertonic.
Which of these sequences below goes from the largest to the smallest? A. Liver cell, hemoglobin, carbon atom, cell nucleus, amino acid B. Liver cell, hemoglobin, amino acid, cell nucleus, carbon atom C. Liver cell, cell nucleus, hemoglobin, amino acid, carbon atom D. Liver cell, cell nucleus, amino acid, hemoglobin, carbon atom E. Cell nucleus, liver cell, hemoglobin, amino acid, carbon atom
C. Liver cell, cell nucleus, hemoglobin, amino acid, and carbon atom.
Which of the following structures is found in eukaryotic cells but not prokaryotic cells? A. Cytoplasm B. RNA C. Mitochondria D. Plasma membrane E. All of these structures are in both eukaryotic cells and prokaryotic cells
C. Mitochondria.
What type of bond joins two hydrogen atoms together? A. Hydrogen bond B. Ionic bond C. Non-polar, covalent bond D. Polar, covalent bond E. Crazy glue
C. Non-polar, covalent bond.
Which of the following can pass most easily through a lipid bilayer? A. DNA B. ATP C. O2 D. Catalase E. Na-
C. O2.
How many bonds does hydrogen normally form in biological molecules? A. Three B. Five C. One D. Two E. Four
C. One.
A covalent chemical bond is one in which _____. A. Electrons are removed from one atom and transferred to another atom so that the two atoms become oppositely charged. B. Protons and neutrons are shared by two atoms so as to satisfy the requirements of both atoms. C. Outer-shell electrons of two atoms are shared so as to satisfactorily fill the outer electron shells of both atoms. D. Outer-shell electrons of one atom are transferred to the inner shell of another atom. E. Inner-shell electrons of one atom are transferred to the outer shell of another atom.
C. Outer-shell electrons of two atoms are shared so as to satisfactorily fill the outer electron shells of both atoms.
This component functions as biological catalysts: A. Carbohydrate B. Lipid C. Protein D. Nucleic acid E. All of the above
C. Protein.
When Hershey and Chase labeled the phage with "S-sulfur", what cellular component were they specifically labeling? A. The phage was not included in this experiment, phages do not contain sulfur. B. Nucleic acids were specifically labeled. C. Proteins were specifically labeled. D. Nucleic acids and proteins were labeled. E. The cell capsule was specifically labeled.
C. Proteins were specifically labeled.
A marathon is being run and four runners are near the lead. Runner A has low glucose levels in his muscles but his muscles are well oxygenated. Runner B has low glucose levels in his muscles and his muscles are anaerobic. Runner C has normal blood glucose levels in his muscles and his muscles are well oxygenated. Runner D has normal blood glucose levels in his muscles and his muscles are anaerobic. Which runner would you say has the best chance of winning the race? A. Runner A B. Runner B C. Runner C D. Runner D
C. Runner C.
A certain type of muscular dystrophy is seen only in boys born to apparently normal parents. This disorder causes the boy to die before age ten. Girls never have the disorder. What answer would best describe the genetics of this trait? A. Autosomal recessive B. Autosomal dominant C. X-linked trait D. Y-linked trait E. Chromosomal aberration
C. X-linked trait.
Aerobic
Cells require oxygen to break down compounds and produce energy.
How is ATP formed in plants?
Chemiosmosis.
Structural molecule for fungal cell walls and insect and arachnid exoskeletons
Chitin.
Anaphase
Chromatids separate at centromeres and the separated chromatids migrate towards the opposite poles.
Prophase
Chromosomes condense, mitotic spindle (microtubules) form, and nucleoli disappear.
Secondary protein structure
Coils and folds of primary chain.
Membrane function
Control point for transport of water and solutes into and out of the cell.
A condensation reaction _____. A. Occurs by the removal of water. B. Involves the formation of new covalent bonds. C. Is involved in the synthesis of polysaccharides, proteins, and triaclyglycerols. D. Answers A, B, and C are all correct. E. None of the above answers are correct.
D. Answers A, B, and C are all correct.
Why is water cohesive? A. Water molecules are non-polar. B. One side of the molecule is slightly positive and the other side is slightly negative. C. Water molecules participate in hydrogen bonds. D. Answers B and C are correct. E. All of the above answers are correct.
D. Answers B and C are correct.
The stage of the cell cycle when DNA is replicated is: A. G1 Phase B. G2 Phase C. Meiosis D. S Phase E. Mitosis
D. S Phase.
What is the synthesis of macromolecules done by?
Dehydration (removing water).
What type of reaction forms polypeptides?
Dehydration reaction.
Genome of herpesvirus
Double-stranded DNA.
What does diffusion concentration go to?
Equilibrium.
What cells commonly perform anaerobic respiration?
Facultative and obligate cells.
Lytic Growth
Infection host cell synthesizes viral genome and protein, eventually host cell lyses causing the release of viral particles.
Where does electron transport chain occur?
Inner membrane of mitochondria.
Sensory perception
Input transferred via the peripheral nervous system (PNS).
Frameshift mutation
Insertion or deletion of bases.
Which region will be transcribed, but then spliced out of the mRNA?
Intron.
Differences between meiosis and mitosis?
Mitosis produces genetically identical cells and conserves the number of chromosome sets whereas meiosis produces cells that are genetically different from the parent cells and reduces the number of chromosomes sets from two (diploid) to one (haploid).
Most (not all) macromolecules are polymers made up of repeating units called _____?
Monomers.
Mobile energy molecules for plant mobile sugar
Sucrose.
Function of rough ER
Synthesis of secretory proteins and membrane production.
Function of endo-membrane system
Synthesis, packaging, and transport of many cell constituents.
Solvent
The dissolving agent of a solution.
In Facilitated diffusion ________. A. A protein is needed but no energy is required. B. A protein is needed and energy is required. C. No protein is needed but energy is required. D. No protein is needed and no energy is required.
A. A protein is needed but no energy is required.
Atoms that have a full outer electron shell tend to _____? A. Be stable and nonreactive. B. Be unstable and reactive. C. Form covalent bonds in aqueous solutions. D. Form ionic bonds in aqueous solutions. E. Be strong acids.
A. Be stable and nonreactive.
Erythrose, a 4-carbon sugar, has the following chemical formula _____. A. C4-H6-O3 B. C4-H8-O4 C. C4-H4-O4 D. C4-H12-O6 E. C6-H12-O6
B. C4-H8-O4.
What type of bond does potassium typically form in biology? A. Covalent bonds B. Ionic bonds C. Hydrogen bonds D. Emotional bonds
B. Ionic bonds.
Cells have a Na+ - K+ ATPase that pumps Na+ out of the cell against the concentration gradient and K+ into the cell, also against the concentration gradient. What type of transport is this? A. Simple diffusion B. Facilitated diffusion C. Active transport D. Exocytosis E. Receptor mediated endocytosis
C. Active transport.
Flask A contains no O2 and no glucose and is kept in the dark. Flask B contains no O2 and no glucose and is kept in the light. Flask C contains O2 but no glucose and is kept in the dark. Flask D contains no O2 but has glucose and is kept in the dark. Flask E contains O2 and has glucose and is kept in the dark. Which flask(s) is/are producing ethanol? A. Only A B. Only B C. Only D D. A and B E. A, B, and D
C. Only D.
The bases adenine and thymidine base pair in DNA double helixes. What type of bond and how many make up this interaction? A. Two covalent bonds B. Three covalent bonds C. Two hydrogen bonds D. Three hydrogen bonds E. Two ionic bonds
C. Two hydrogen bonds.
A lion pride is chasing zebras. The physiological conditions of these zebras are given below. Zebra A has depleted glucose levels and his muscles are well oxygenated. Zebra B has depleted glucose levels and his muscles are anaerobic. Zebra C has normal glucose levels and his muscles are well oxygenated. Zebra D has normal glucose levels and his muscles are anaerobic. Which zebra(s) will likely become a lion chew toy? A. Zebra A B. Zebra B C. Zebras A and B D. Zebras A and C E. Zebras B and D
C. Zebras A and B.
A skin cell in G1 has 25 pg of DNA. How much DNA would you expect to find when the cell was in G2 of the cell cycle? A. 12.5 pg of DNA B. 25 pg of DNA C. 37.5 pg of DNA D. 50 pg of DNA E. The amount of DNA will vary
D. 50 pg of DNA.
Insulin, a hormone, is made in pancreatic cells and exported from the cell in small vesicles. These vesicles fuse with the plasma membrane releasing the insulin from the cell. What process is occurring? A. Facilitated diffusion B. Active transport C. Endocytosis D. Exocytosis E. A redox reaction
D. Exocytosis.
The concentration of pyruvate outside of the mitochondrion is higher than the concentration inside. A specific transport protein is required for pyruvate to cross the membrane, but no ATP is required. This is an example of: A. Osmosis B. Co-transport C. Active transport D. Facilitated diffusion E. Simple diffusion
D. Facilitated diffusion.
How are the plasma membrane and a membrane of the golgi apparatus different? A. Only the plasma membrane would have phospholipids. B. Only the plasma membrane would have proteins. C. Only the golgi apparatus has proteins. D. The proteins in each membrane would be different. E. The cellulose content in the membranes is different.
D. The proteins in each membrane would be different.
Geometric isomers
Different arrangements about bond angles.
Function of lysosomes
Digest/recycling of cell components and phagocytosis.
Mitosis
Division of a diploid cell to form two diploid cells - asexual.
Bacteria
Domain describing the most diverse and widespread prokaryotes that are now divided across multiple kingdoms.
What is the nucleus surrounded by?
Double-membrane nuclear envelope.
Genome of papovavirus
Double-stranded DNA.
Cellulose is: A. A storage polysaccharide found in plants. B. A storage polysaccharide found in animals. C. A monosaccharide used for energy in all cells. D. A 5-carbon sugar which is a component of RNA. E. A structural polysaccharide found in the cell wall of plants.
E. A structural polysaccharide found in the cell wall of plants.
Why does your instructor argue that a carrot in the market is still alive? A. It is still capable of growth. B. It is still metabollically active. C. It is still capable of reproduction. D. It can still acquire nutrients from the environment. E. All of the above reasons are true.
E. All of the above reasons are true.
Which of the following contains proteins? A. Nucleus B. Vacuole C. Mitochondria D. Cytoskeleton E. All of the above
E. All of the above.
A child born with Down's Syndrome has ____. A. Two copies of an autosomal recessive gene B. One of more copies of an autosomal dominant gene C. Has a defect in a gene on the X chromosome D. Has an extra X chromosome E. Has an extra chromosome 21
E. Has an extra chromosome 21.
Integration
Interpretation and initiation of responses in the central nervous system (CNS).
You have a small carbohydrate that has four glucoses linked together. How many oxygen atoms will be in this molecule? A. 7 B. 14 C. 21 D. 28 E. 35
C. 21.
Which type of linkage connects nucleotide units in RNA? A. Beta-glycosidic linkages B. Peptide bonds C. 3'-5' phosphodiester linkages D. Disulfide bonds E. Ester bonds
C. 3'-5' phosphodiester linkages.
Which type of linkage connects nucleotides units in RNA? A. Beta-glycosidic linkages B. Peptide bonds C. 3'-5' phosphodiester linkages D. Disulfide bond E. Ester bonds
C. 3'-5' phosphodiester linkages.
A molecule that binds to the active site of an enzyme, inhibiting that enzyme is called _____? A. An endergonic reaction B. A lipase C. A competitive inhibitor D. A non-competitive inhibitor E. An allosteric activator
C. A competitive inhibitor.
In a beta sheet, a hydrogen atom participates in a covalent bond with a nitrogen atom of one amino acid and also weakly interacts with an oxygen atom of another amino acid. What is this second weaker interaction called? A. A secondary bond B. A tertiary bond C. A hydrogen bond D. A peptide bond E. An ionic bond
C. A hydrogen bond.
In an alpha helix, a hydrogen atom participates in a covalent bond with a nitrogen atom of one amino acid and also weakly interacts with an oxygen atom of a different amino acid. What is this second weaker interaction called? A. A secondary bond B. An ionic bond C. A hydrogen bond D. A peptide bond E. A high-yield corporate bond
C. A hydrogen bond.
In aerobic cellular respiration, oxygen is directly required in _____? A. Glycolysis. B. The Krebs cycle. C. Accepting electrons at the end of the electron transport chain. D. Oxidation of pyruvate to form acetyl CoA. E. Hemoglobin.
C. Accepting electrons at the end of the electron transport chain.
The concentration of NADH outside of the mitochondrion is lower than the concentration inside. A specific transport protein is required for the NADH to enter the mitochondria and ATP is required. This is an example of: A. Osmosis B. Co-Transport C. Active transport D. Facilitated diffusion E. Simple diffusion
C. Active transport.
Which of the following is a part of processing a newly made eukaryotic mRNA? A. Adding exons to the mRNA. B. Insertion of the stop codon. C. Adding a poly-aedenine tail. D. Attaching the appropriate amino acid. E. All of the above.
C. Adding a poly-aedenine tail.
Which statement(s) about ALL living things is/are true? A. All living things are capable of sight. B. All living things have a nervous system of some sort. C. All living things are capable of reproduction. D. All of the above statements are true. E. None of the above statements are true.
C. All living things are capable of reproduction.
Differences between DNA and RNA?
DNA has deoxyribose, a H sugar, and thymine as a nitrogenous base. RNA has ribose, a OH sugar, and uracil as a nitrogenous base.
Interphase I
DNA synthesized (duplicated).
R cells + S cell DNA
Dead.
What does a neural signal depend on?
Differences in ion concentration, diffusion, and active transport.
Archae
Domain describing prokaryotes that live in Earth's extreme environments such as salty lakes and boiling hot springs.
Variations in viral genome
Double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), double-stranded RNA (dsRNA), and single-stranded RNA (ssRNA).
Genome of adenovirus
Double-stranded DNA.
Genome of poxvirus
Double-stranded DNA.
Syndromes commonly associated with disjunction?
Downs Syndrome, Turner's Syndrome, and Klinefelter's Syndrome.
Mutations in __________ cause muscular dystrophy.
Dystrophin.
How many CO2 are produced when one glucose molecule goes through glycolysis? A. 1 B. 2 C. 3 D. 6 E. 0
E. 0.
In plants, how many CO2 molecules are needed to make one sucrose molecule? A. 3 B. 5 C. 6 D. 10 E. 12
E. 12.
How many ATPs are made when one glucose molecule is utilized using aerobic respiration? A. 0 B. 2 C. 6 D. 10 E. 36
E. 36.
How many CO2 molecules are produced when one glucose molecule is completely utilized in the process of aerobic respiration? A. 0 B. 1 C. 2 D. 4 E. 6
E. 6.
A chemical reaction that requires energy that occurs at the same time ATP is cleaved to ADP and Pi is called: A. A pyrotechnic reaction B. An adiabatic reaction C. An exergonic reaction D. An endergonic reaction E. A coupled reaction
E. A coupled reaction.
What type of nucleotide is the genetic material of viruses? A. Double strand DNA B. Single strand DNA C. Double strand RNA D. Single strand RNA E. All of the above answers are correct
E. All of the above answers are correct.
True or False: The majority of Earth's surface is covered by land.
False; the majority of Earth's surface is covered by H2O.
When does NAD+ gain electrons?
From glucose during glycolysis and the krebs cycle.
What two proteins can the G-protein receptor bind to?
GTP and GDP.
What causes changes in membrane potential?
Gated ion channels.
What can detect isotopes?
Geiger counters, scintillation counters, and x-ray film.
What does packing control?
Gene exposure.
Sex-Linkage on Human Y-Chromosome
Gene is on the Y chromosome, all females are normal, and all males have the trait. Y chromosome is small, room for few genes.
Genotype
Genetic makeup; what alleles an individual contains.
DNA
Genetic material.
HIV (human immunodeficiency virus)
Genome is ssRNA (with reverse transcriptase), capsid protein, and viral envelope with glycoprotein.
Homozygous
Genotype consists of duplicates of the dominant or recessive alleles (PP or pp).
How to identify an organism
Genus and species.
Mobile energy molecules for animal mobile sugar
Glucose.
Energy storage molecules for animals
Glycogen.
3 (P-5C-P) + 3CO2 to 6 (3C-P), good reaction or bad?
Good reaction.
Dissociation of water formula
H2O >>> H+ + OH-
Important properties of H2O
High specific heat, high heat of vaporization, maximum density of 4 degrees celsius, and cohesive.
Recessively Inherited Disorders
Homozygous recessive has disease, heterozygous individuals are "carriers." (Cystic fibrosis, Tay-Sachs disease, and sickle cell disease).
What is the breakdown of macromolecules done by?
Hydrolysis (addition of water).
Important exergonic reaction to remember
Hydrolysis of ATP to ADP and phosphate.
Three steps of translation
Initiation, elongation, and termination.
Hyperpolarization
Inside the cell becomes more negative (K+ out).
After an RNA molecule is transcribed from a eukaryotic gene, what are removed and what are spliced together to produce an mRNA molecule with a continuous coding sequence?
Introns; exons.
Receptor-mediated endocytosis
Involves membrane bound receptor molecules.
Synapse
Junction between neurons.
Cancer treatment strategy?
Kill cells that are rapidly dividing.
The structure that holds the sister chromatids to the spindle fiber is called ____________?
Kinetochore.
In what cells is glycogen abundant in?
Liver and muscle cells.
One way to raise blood glucose
Liver breaks down glycogen and release glucose into blood.
Two ways to lower blood glucose
Liver takes up glucose and stores it as glycogen and muscle cells take up glucose and store it as glycogen.
Hypotonic
Lower solute concentration, high water content.
Function of microfilaments
Maintain cell shape (tension bearing), change cell shape and movement, muscle contraction, and cytoplasmic streaming.
Function of microtubules
Maintenance of cell shape (girders) and cell motility (cilia and flagella).
______________ tumors generally invade surrounding tissue and spread throughout the body.
Malignant.
What is tRNA used for?
Matching a proper amino acid with a given codon.
What type of cell division is occurring when an egg cell is made?
Meiosis.
What is the development of genes produced by?
Metabolic pathways.
Importance of pH regulation
Metabolic reactions, molecular structure, and toxicity of molecules.
During which stage of cell division do the chromosomes align?
Metaphase.
Cytoskeletal structural elements
Microtubules, microfilaments, and intermediate filaments.
Where does the Krebs cycle occur?
Mitochondrial matrix.
What are carbohydrates classified as?
Monosaccharides, disaccharides, and polysaccharides.
What happens to the mouse with heat-killed S cells?
Mouse lives.
What happens to the mouse with living R cells?
Mouse lives.
What is homeostasis controlled by?
Negative feedback loops.
Genetic code must give a sequence of amino acids from a sequence of ___________ bases?
Nitrogenous.
Pro-metaphase
Nuclear membrane breaks down, chromosomes attach to microtubules of the spindle apparatus, and chromosomes begin to migrate.
What is rhodopsin composed of?
Opsin and retinal.
Phosphate
Organic phosphates, are negatively charged, and are important for energy storage molecules.
What is the energy source of all organisms?
Photosynthesis.
In which protein-pigment complexes is light energy absorbed?
Photosystems I and II.
Phenotype
Physical appearance.
What elements do all cells contain?
Plasma membrane, cytoplasm, ribosomes, and DNA.
Does the sodium-potassium pump cause the outside of the cell to be more positive or negative?
Positive.
What kind of energy does the H+ gradient have?
Potenital energy.
During which stage of cell division do chromosomes attach to microtubules?
Pro-Metaphase.
What does protein kinase A do in the liver?
Produces two enzymes, one breaks down glycogen and the other synthesizes glycogen.
What stage does synapsis occur?
Prophase I.
Five stages of cellular division?
Prophase, pro-metaphase, metaphase, anaphase, and telophase.
Functions of proteins
Proteins do everything.
What is the most common ion transported by ATPases?
Protons (H+).
In Mendel's peas, what was the dominant color. What was the recessive color.
Purple; white.
Transcription is the synthesis of what?
RNA and mRNA.
Semiconservative Replication
Replicated molecule of DNA containing one strand from the original template molecule and one newly synthesized strand.
What blocks transcription?
Repressors.
Active Transport
Requires energy and a transport protein.
Facilitated diffusion
Requires no energy but does require a transport protein.
What are the binding sites for mRNA and tRNA?
Ribosomes.
Isotopes
Same atomic number, different atomic weight, unstable isotopes lose energy - radioactive. Are important biological tools.
Isotonic
Same solute and water concentrations.
Ribosome
Site of protein synthesis and chains are polyribosomes.
Function of ribosomes
Site of translation (protein synthesis).
How long is the DNA molecule from one eukaryotic chromosome?
Six centimeters.
Do carriers have a slow or fast rate of transport?
Slow rate of transport.
Function of smooth ER
Synthesis of lipids (phospholipids and steriods).
Factors affecting enzyme activity
Temperature, pH, cofactors, and inhibitors.
What is the reason a defect is passed on?
The DNA.
Silent mutation
The change in DNA sequence does not cause a change in the amino acid sequence.
Missense mutation
The change in the DNA sequence also leads to a change in the amino acid sequence.
Where does translation occur?
The cytoplasm.
How are chromosomes pulled apart?
The mitotic spindle, which is made of tubulin, shortens at the end of the attached chromosome.
What does light cause cis to transfer to?
Trans.
True or False: A dominant allele is fully expressed, a recessive allele is not expressed.
True.
True or False: Morgan found that body color and wing shape were linked genes.
True.
True or False: Recombination frequency is proportional to the distance between the two genes.
True.
True or False: Water is a versatile solvent due to its polarity, which allows it to form hydrogen bonds easily.
True.
How many amino acids can be found in proteins?
Twenty.
For the last mutation (5 nucleotides are missing) would you expect the amino acid sequence to be affected after the deletion?
Yes, the sequence would be different after the mutation.
A codon is GCA. What is the sequence of the corresponding anticodon? A. TGC B. CGU C. CGT D. UGC E. GCA
D. UGC.
True or False: Sucrose is hydrophobic.
False; Sucrose is hydrophillic.
How many bonds does phosphorus normally form in biological molecules? A. Three B. Five C. One D. Two E. Four
B. Five.
How much carbohydrates do photosynthetic organisms produce?
160 billion metric tons.
How many chromosomes are in a human sperm cell?
23 chromosomes.
How many slots does a ribosome have for tRNA?
3 slots.
Photosynthesis equation
6CO2 + 12H2O + Light to C6H12O6 + 6O2 + 6H2O.
When you sequence the the same piece of DNA from someone with the same rare genetic disease you find that five nucleotides are missing from the gene. What type of mutation is it?
A deletion mutation.
Sucrose
A disaccharide composed of glucose and fructose. Found in table sugar, transported in plants.
Maltose
A disaccharide composed of two glucose units. Sometimes known as malt sugar.
There is an insert of two bases into the coding region of a gene. What type of mutation is this?
A frameshift mutation.
What does a signal molecule bind to?
A receptor protein.
Pleiotrophy
A single gene is responsible for multiple symptoms (cystic fibrosis or sickle cell anemia).
Aqueous solution
A solution in which water is the solvent.
What does one strand of DNA serve as for the RNA polymerase?
A template.
In plants, how many CO2 molecules are needed to make one triose molecule? A. 3 B. 5 C. 6 D. 10 E. 12
A. 3.
The [OH-] concentration of a solution is 10^-9 M. What is the pH? A. 5 B. 3 C. 4 D. 7 E. 14
A. 5.
In what fashion is Huntington's inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
A. Autosomal dominant.
In what fashion is dwarfism inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
A. Autosomal dominant.
Putting protein (such as egg) in ethanol will _____? A. Denature the protein. B. Break the peptide bond of the protein. C. Cause more dehydration reactions to occur. D. Cause hydrolysis of the protein.
A. Denature the protein.
Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the assembly of microtubules, its effectiveness must be related to A. Disruption of mitotic spindle formation B. Suppression of cyclin formation C. Myosin denaturation and inhibition of cleavage furrow formation D. Inhibition of DNA synthesis
A. Disruption of mitotic spindle formation.
Which of the following is not true of RNA processing? A. Exons are cut out before the mRNA leaves the nucleus. B. Nucleotides may be added at both ends of the RNA. C. Ribozymes may function in RNA splicing. D. RNA splicing can be catalyzed by spliceosomes.
A. Exons are cut out before the mRNA leaves the nucleus.
Which one of these steps breaks glucose down into two 3-carbon molecules? A. Glycolysis B. Oxidation of pyruvate to acetyl CoA C. Krebs cycle D. Electron transport E. Chemiosmotic ATP synthesis
A. Glycolysis.
Which of the following structures directs newly made proteins to their correct location in the cell? A. Golgi apparatus B. Lysosome C. Mitochondria D. Nucleus E. All of the above
A. Golgi apparatus.
Which of the following separates the DNA strands during replication? A. Helicase B. DNA polymerase II C. Ligase D. Single stranded binding proteins E. Primase
A. Helicase.
During vigorous exercise, anaerobic muscle cells produce _____ and gain _____? A. Lactate; ATP B. Alcohol; CO2 C. Alcohol; ATP D. Lactate; NADH E. Lactate; CO2
A. Lactate; ATP.
Which of the following molecules is a carbohydrate? Indicate all that are carbohydrates. A. Lactose B. Cellulose C. DNA D. Insulin E. Trigyceride F. Glucose
A. Lactose. B. Cellulose. F. Glucose.
What is the angle of the H-O-H bond in water? A. 45 Degrees B. 90 Degrees C. 109 Degrees D. 135 Degrees E. 180 Degrees
C. 109 Degrees.
If there are 12 chromosomes in an animal skin cell in G1 stage of the cell cycle, what is the diploid number of chromosomes for this organism? A. 3 B. 6 C. 12 D. 24 E. Too little information to tell
C. 12.
In humans, the _____ determines the sex of the offspring because _____. A. Male gamete; each male gamete can contribute either an X or a Y chromosome. B. Female gamete; only the female gamete provides cytoplasm to the zygote. C. Male gamete; the sperm can fertilize either a female egg or a male egg. D. Female gamete; only the female gamete can have one of two functional chromosomes. E. Chromosome contribution from both parents; the offspring uses all of the parents chromosomes.
A. Male gamete; each male gamete can contribute either an X or a Y chromosome.
DNA crossover occurs in A. Meiosis B. Mitosis C. Prokaryotic fission D. Meiosis and mitosis E. Meiosis, mitosis, and prokaryotic fission
A. Meiosis.
Which organelle contains DNA? A. Mitochondria B. Lysosome C. Golgi apparatus D. All of the above E. None of the above
A. Mitochondria.
Which organelle contains the enzymes for aerobic respiration? A. Mitochondria B. Lysosome C. Golgi apparatus D. All of the above E. None of the above
A. Mitochondria.
In the reaction, pyruvate + NAD+ >>> acetyl-CoA + CO2 + NADH + H+, which of the reactants has been oxidized? A. Pyruvate B. NAD+ C. Both pyruvate and NAD+ have been oxidized D. None of the reactants were oxidized; both pyruvate and NAD+ were reduced E. There is no oxygen, therefore no oxidation has occurred
A. Pyruvate.
When a protein is made up of more than one peptide chain, it is said to have a _____ structure. A. Quaternary B. Secondary C. Primary D. Tertiary
A. Quaternary.
Which of the following is a five carbon sugar? A. Ribose B. Glucose C. Fructose D. Galactose E. All of the above
A. Ribose.
Early experiments involving mating between red-eyed and white-eyed fruit flies revealed that a disproportionately large number of males in the F2 generation were white-eyed. Why? A. The gene for eye color is located on a sex chromosome. B. The metabolic pathway leading to the red pigment in the eyes of fruit flies is different in males and females. C. White-eyed females did not develop normally in the egg. D. All of the above answers are correct.
A. The gene for eye color is located on a sex chromosome.
When DNA from dead Streptococcus pneumoniae "R" cells is added to living "R" cells and this mixture injected into mice. What happens? A. The mouse lives B. The mouse dies
A. The mouse lives
Which of the following is true for endergonic reactions? A. The products have more free energy than the reactants. B. The products have less free energy than the reactants. C. Reactants will always be completely converted to products. D. A net output of energy is generated by the reactions. E. The reactions decrease the free energy in the products and increase the energy of the surrounding environment.
A. The products have more free energy than the reactants.
Where does transcription and translation take place in a eukaryotic cell? A. Transcription takes place in the nucleus while translation takes place in the cytoplasm. B. Transcription and translation both take place in the nucleus. C. Transcription and translation both take place in the cytoplasm. D. Transcription and translation both take place in the endoplasmic reticulum. E. Transcription takes place in the cytoplasm while translation takes place in the nucleus.
A. Transcription takes place in the nucleus while translation takes place in the cytoplasm.
Aneuploidy
Abnormal number of chromosomes.
Polygenic Inheritance
Additive effect of two or more genes on a single phenotypic character.
What are nitrogenous bases in DNA made of?
Adenine and Guanine (Purines) and Thymine and Cytosine (Pyrimidines).
Bases of RNA
Adenine, guanine, cytosine, and uracil.
R cells + S cell lipids
Alive.
Two rules of chemical reactions
All atoms must be accounted for and reactions go to completion or equilibrium.
Which eukaryotes contain the golgi complex?
All eukaryotes.
An atom having an atomic number of 10 and a mass of 22 would be expected to have _____ neutrons? A. 10 B. 12 C. 16 D. 22 E. 32
B. 12.
What is the net increase in the number of ATP when one glucose molecule goes through glycolysis? A. 1 B. 2 C. 3 D. 6 E. 0
B. 2.
DNA isolated from a bacterium is composed of 30% thymine. What percentage of the nucleotides are guanine? A. 10% B. 20% C. 30% D. 40% E. 50%
B. 20%.
A mole of water weighs 18 grams while a mole of sucrose weighs 342 grams. Which statement is true? A. A mole of sucrose has more molecules than as a mole of water. B. A mole of sucrose has the same number of molecules as a mole of water. C. A mole of sucrose has less molecules than a mole of water. D. Moles are known for their excellent vision.
B. A mole of sucrose has the same number of molecules as a mole of water.
What is an operator? A. A protein that regulates transcription. B. A piece of DNA that binds a repressor protein. C. Part of the ribosome. D. A special type of RNA found in operons. E. A protein that changes RNA into DNA.
B. A piece of DNA that binds a repressor protein.
On a eukaryotic mRNA, the start codon is ____. A. At the very 5 prime end of the message B. About 50-100 bases from the 5 prime end of the message C. Almost exactly in the middle of the mRNA D. About 50-100 bases from the 3 prime end of the message E. At the very 3 prime end of the message
B. About 50-100 bases from the 5 prime end of the message.
In what fashion is cystic fibrosis inherited? A. Autosomal dominant B. Autosomal recessive C. X-linked
B. Autosomal recessive.
Which of the following is an example of a carbohydrate? A. Insulin B. Chitin C. mRNA D. Triglyceride E. ATP
B. Chitin.
If glucose entering the cell from the blood goes through the GLUT2 carrier protein and goes from a high to low concentration, what type of transport is occurring? A. Simple diffusion B. Facilitated diffusion C. Active transport D. Endocytosis E. Phagocytosis
B. Facilitated diffusion.
There are four flasks of yeast: Each flask has all of the nutrients for growth except an energy source. Here is what is in each flask: Flask A has glucose but no O2 and is in the dark. Flask B has glucose and O2 and is in the dark. Flask C has no glucose and no O2 and is in the dark. Flask D has no glucose but has O2 and is in the dark. Flask E has no glucose but has CO2 and is in the light Which flask(s) will be able to grow? A. Only flask A B. Flasks A and B C. Flasks A, B and D D. Flasks A, B and E E. All of the flasks will be able to grow.
B. Flask A and B.
There are four flasks of yeast: Each flask has all of the nutrients for growth except an energy source. Here is what is in each flask: Flask A has glucose but no O2 and is in the dark. Flask B has glucose and O2 and is in the dark. Flask C has no glucose and no O2 and is in the dark. Flask D has no glucose but has O2 and is in the dark. Flask E has no glucose but has CO2 and is in the light Which flask(s) will be producing CO2? A. Only flask A B. Flasks A and B C. Flasks A, B and D D. Flasks A, B and E E. All of the flasks will produce CO2
B. Flasks A and B.
Which of the following is a true statement about gene expression? A. Cells always express all of their genes all the time. B. In most cells, only some genes are expressed at any one time. C. Most cells never express any genes. D. Genes can never be turned on or off. E. All genes are turned on when the cell divides and then they are all switched off.
B. In most cells, only some genes are expressed at any one time.
Where is Rubisco located in the chloroplast? A. In the envelope membranes B. In the chloroplast stroma C. In the thylakoid membranes D. Inside of the thylakoid E. Anywhere chlorophyll is located
B. In the chloroplast stroma.
You accidentally leave your favorite house/dorm plant in the dark over Thanksgiving vacation. To your surprise it is still alive when you return because _____. A. It still produced sugars to live on because the Calvin cycle does not require light. B. It obtained energy from stored sugar and starch molecules produced before your vacation. C. It used short wave energy (x-rays and gamma rays) to power photosynthesis. D. The light reactions were driven by the breakdown of organic molecules instead of light. E. Plants are not really living organisms.
B. It obtained energy from stored sugar and starch molecules produced before your vacation.
The R group or side chain of the amino acid Serine is -CH2-OH. The R group or side chain of the amino acid Leucine is -CH2-CH-(CH3)2. Where would you expect to find these amino acids in a globular protein in aqueous solution? A. Serine would be in the interior, and leucine would be on the exterior of the globular protein. B. Leucine would be in the interior, and serine would be on the exterior of the globular protein. C. Both serine and leucine would be in the interior of the globular protein. D. Both serine and leucine would be on the exterior of the globular protein. E. Both serine and leucine would be in the interior and on the exterior of the globular protein.
B. Leucine would be in the interior, and serine would be on the exterior of the globular protein.
In his transformation experiments, Griffith observed that: A. Mutant mice were resistant to bacterial infections. B. Mixing a heat-killed pathogenic strain of bacteria with a nonpathogenic strain can convert some of the living cells. C. Mixing a heat-killed nonpathogenic strain of bacteria with a living pathogenic strain makes the pathogenic strain nonpathogenic. D. Infecting mice with the nonpathogenic strain of bacteria makes them resistant to the pathogenic strain. E. Infecting mice with the pathogenic strain of bacteria makes them resistant to the pathogenic strain.
B. Mixing a heat-killed pathogenic strain of bacteria with a nonpathogenic strain can convert some of the living cells.
Which of the following types of transport specifically refers to the diffusion of water across the membrane? A. Simple diffusion B. Osmosis C. Facilitated diffusion D. Active transport
B. Osmosis
Which element is most likely to form polar covalent bonds in biological systems? A. Sodium B. Oxygen C. Hydrogen D. Carbon E. All of the above will form polar covalent bonds
B. Oxygen.
Recently some Kentucky students took some breath mints containing chlorophyll and decided to go to the beach and photosynthesize. This probably wont work because the proteins that bind chlorophyll are not present in humans, even students and coaches from the University of Kentucky. What proteins listed below bind chlorophyll? A. Rubisco B. Photosystem I and II C. Chloroplast ATP synthase D. A and B E. B and C
B. Photosystem I and II.
A piece of DNA is first transcribed and then copied. The copied DNA now inserts itself into a new place on the host genome. This is called a ________. A. Transposon B. Retrotransposon C. A poser D. An opponent
B. Retrotransposon.
A marathon is being run and four runners are near the lead. Runner A has low glucose levels in his muscles but his muscles are well oxygenated. Runner B has low glucose levels in his muscles and his muscles are anaerobic. Runner C has normal blood glucose levels in his muscles and his muscles are well oxygenated. Runner D has normal blood glucose levels in his muscles and his muscles are anaerobic. Assuming they are running at the same speed and have the same weight, is runner C or runner D using glucose at the fastest rate? A. Runner C is using glucose at the faster rate. B. Runner D is using glucose at the faster rate. C. Runners C and D are using glucose at the same rate. D. Neither runner is utilizing glucose.
B. Runner D is using glucose at the faster rate.
In eukaryotic cells, transcription cannot begin until? A. The two DNA strands have been completely separated and exposed to the promoter. B. Several transcription factors have bound to the promoter. C. The 5' caps are removed from the mRNA. D. The DNA introns are removed from the template.
B. Several transcription factors have bound to the promoter.
Which statement(s) about the X chromosome is/are true? A. The X chromosome only has genes related to the female phenotype. B. The X chromosome has more genes than the Y chromosome. C. The X chromosome is not found in males. D. The X chromosome is inactivated in males. E. This chromosome was recently discovered in the "X" Files.
B. The X chromosome has more genes than the Y chromosome.
What type of isomer best describes the two compounds -SH and -N-H2? A. They are structural isomers B. They are geometric isomers C. They are enantiomers. D. One is carbohydrate and the other is a nucleotide. E. One is a simple sugar sugar and the other is an amino acid.
B. They are geometric isomers.
The molecular formula of glucose is C6-H12-O6. What would be the molecular formula of a polymer made by linking ten glucose molecules together? A. C60-H120-O60 B. C60-H118-O59 C. C60-H102-O51 D. C60-H100-O50 E. C60-H111-O51
C. C60-H102-O51.
Amino acids are acids because they possess which functional group? A. Amino group B. Alcohol group C. Carboxyl group D. Phosphate group E. Sulfhydryl group
C. Carboxyl group.
Which of the following is a false statement with respect to cellulose. A. It is a polysaccharide made up of glucose monomers. B. It is a major constituent of the plant cell wall. C. Cellulose is a major good source for all animals because it is easily digested. D. The monomers in cellulose are the same as those in glycogen. E. The monomers in cellulose are the same as those in amylose (starch).
C. Cellulose is a major good source for all animals because it is easily digested.
One difference between cancer cells and normal cells is that cancer cells A. Are unable to synthesize DNA B. Are arrested at the S phase of the cell cycle C. Continue to divide even when they are tightly packed together D. Cannot function properly because they are affected by density-dependent inhibition
C. Continue to divide even when they are tightly packed together.
The sodium potassium pump is called an electrogenic pump because it ___. A. Is used to drive the transport of other molecules against a concentration gradient B. Pumps equal quantities of Na+ and K+ C. Contributes to the membrane potential D. Pumps hydrogen ions out of the cell E. Ionizes sodium and potassium atoms
C. Contributes to the membrane potential.
How do autotrophs acquire their energy. A. From eating animals. B. From symbiotic relationships with heterotrophs. C. From nutrients in the environment. D. From eating plants. E. By digesting bacteria.
C. From nutrients in the environment.
If a person has two different alleles, he/she is __________ for that gene. A. Zygotic B. Homozygous C. Heterozygous D. Homomorphic E. Tetraploid
C. Heterozygous.
Which functional group is present in CH3-CH2-O-H? A. Carboxyl group B. Sulfhydryl group C. Hydroxyl group D. Amino group E. Phosphate group
C. Hydroxyl group.
Which of the following is not true of a codon? A. It may code for the same amino acid as another codon. B. It never codes for more than one amino acid. C. It extends from one end of the tRNA molecule. D. It is the basic unit of genetic code.
C. It extends from one end of the tRNA molecule.
Which of the following statements is correct about diffusion? A. It is very rapid over long distances. B. It requires an expenditure of energy by the cell. C. It is a passive process in which molecules move from a region of higher concentration to a region of lower concentration. D. It is an active process in which molecules move from a region of lower concentration to one of higher concentration. E. It requires integral proteins in the cell membrane.
C. It is a passive process in which molecules move from a region of higher concentration to a region of lower concentration.
Which of the following is involved in energy generation? A. Nucleus B. Vacuole C. Mitochondria D. Cytoskeleton E. All of the above
C. Mitochondria.
Chitin is found in _____? A. Dogs B. Kites C. Mushrooms D. Potatoes E. Artichokes
C. Mushrooms.
Insulin, a protein secreted by some pancreas cells, is made on _____. A. On ribosomes bound to the nuclear envelope. B. On free cytoplasmic ribosomes in the cytoplasm. C. On the rough endoplasmic reticulum. D. In the mitochondria. E. On ribosomes bound to the plasma membrane.
C. On the rough endoplasmic reticulum.
N-acetylglucosamine transferase I is a protein found in the golgi apparatus. Where would you expect the protein is made? A. On ribosomes bound to the nuclear envelope. B. On free cytoplasmic ribosomes in the cytoplasm. C. On the rough endoplasmic reticulum. D. In the mitochondria. E. On ribosomes bound to the golgi apparatus.
C. On the rough endoplasmic reticulum.
Genes that make the onset of cancer more likely are often called _____. A. Mitotic spindles B. Kinetochores C. Oncogenes D. Tumor suppressors E. Motor proteins
C. Oncogenes.
During mitochondrial electron transport, H2O is formed. Where does the oxygen for the synthesis of the water directly come from? A. Carbon dioxide (CO2) B. Glucose (C6H12O6) C. Oxygen (O2) D. Pyruvate (C3H3O3-) E. Lactate (C3H5O3-)
C. Oxygen (O2).
The cytoskeleton is composed of _____. A. Carbohydrate B. Lipid C. Protein D. Nucleic acid E. All of the above
C. Protein.
Ribosomes are found with _____ where they are involved with _____. A. Lysosomes, protein breakdown B. Smooth ER, lipid biosynthesis C. Rough ER, protein biosynthesis D. Golgi apparatus, carbohydrate biosynthesis E. Golgi apparatus, carbohydrate breakdown
C. Rough ER, protein biosynthesis.
_____ is probably the most abundant enzyme on the planet. A. Hemoglobin B. Catalase C. Rubisco D. Cytochrome oxidase E. Photosystem II
C. Rubisco.
A bag with an unknown sucrose concentration made of an artificial membrane with pores large enough to let water pass but not sucrose was placed in a solution of a 0.5 M sucrose. After 20 minutes, the bag was removed and it had gotten bigger. Which statement below is probably true? A. The bag had greater than 0.5M sucrose initially and then the sucrose concentration inside the bag gradually increases. B. The bag had greater than 0.5M sucrose initially and then the sucrose concentration inside the bag gradually decreases. C. The bag had a concentration of 0.5M sucrose all of the time. D. The bag had less than 0.5M sucrose initially and then the sucrose concentration inside the bag gradually increases. E. The bag had less than 0.5M sucrose initially and then the sucrose concentration inside the bag gradually decreases.
C. The bag had a concentration of 0.5M sucrose all of the time.
Mendel utilized the ____ as the experimental organism to work out the laws of segregation and independent assortment. A. The fruit fly B. Neurospora C. The garden pea D. Bacteriophage lambda E. E coli
C. The garden pea.
Genes that function in cell cycle checkpoint are often called _____. A. Mitotic spindles B. Kinetochores C. Centromeres D. Tumor suppressors E. Motor proteins
D. Tumor suppressors.
What is translation? A. The making of a new strand of DNA using the old strand as a guide. B. The making of RNA using DNA as the guide. C. The making of protein using mRNA as the guide. D. The changing of DNA into RNA. E. The conversion of amino acids into codons.
C. The making of protein using mRNA as the guide.
The anticodon of a particular tRNA molecule is A. Complementary to the corresponding mRNA codon. B. Complementary to the corresponding triplet in rRNA. C. The part of tRNA that bonds to a specific amino acid. D. Catalytic, making the tRNA a ribosome.
C. The part of tRNA that bonds to a specific amino acid.
Large nucleic acids are synthesized from nucleotide monomers by which process? A. Connecting monosaccharides together. B. The addition of water to each monomer (hydrolysis). C. The removal of water (dehydration reactions). D. Ionic bonding of the monomers. E. The formation of hydrogen bonds between monomers.
C. The removal of water (dehydration reactions).
How do water molecules interact with large molecules like a protein? A. Water molecules form covalent bonds with the protein. B. Water molecules form ionic bonds with the protein. C. Water can form hydrogen bonds with the protein. D. Answers A and C are correct. E. Answers B and C are correct.
C. Water can form hydrogen bonds with the protein.
A lion pride is chasing zebras. The physiological conditions of these zebras are given below. Zebra A has depleted glucose levels and his muscles are well oxygenated. Zebra B has depleted glucose levels and his muscles are anaerobic. Zebra C has normal glucose levels and his muscles are well oxygenated. Zebra D has normal glucose levels and his muscles are anaerobic. Which zebra would you say has the best chance of escaping the lions? A. Zebra A B. Zebra B C. Zebra C D. Zebra D
C. Zebra C.
Examples of CAM plants
Cactus and pineapple.
What does aminoacyl-tRNA synthetase do?
Catalyzes attachment of correct amino acid to tRNA.
Neurons structure
Cell body (nucleus and organelles), dendrites, axons, and synapse.
Binary fission
Cell division in bacteria. Single, circular chromosome of DNA; duplicated chromosome is separated by cell growth.
Structural molecule for plant cell walls
Cellulose.
Telophase I
Chromosomes reach poles, two new nuclei form.
Does a prokaryotic cell have linear or circular DNA?
Circular DNA.
Sulfhydryl
Commonly form thiols. Disulfide bonds can form between molecules. Disulfide bonds are important for protein structure.
Interneurons
Communicate information between neurons.
Sensory neurons
Communicate information from sensory receptors.
Animalia
Consists of multicellular eukaryotes that ingest other organisms.
Function of cytoskeleton
Controls cell shape and mediates movement of cells and organelles.
Motor neurons
Convey impulses to effector cells.
Dendrites
Convey signals from tips.
Axons
Convey signals toward tips.
Where does glycolysis occur?
Cytoplasm.
Cytokinesis
Cytoplasmic division in animal cells or plant.
What does guanine bond with?
Cytosine (purine to pyrimidine).
From one glucose molecule, glycolysis provides the cell with: A. 1 GTP, 1 ATP, and 1 NADH B. 1 GTP, 2 ATP, and 1 FADH2 C. 2 GTP and 2 NADPH D. 2 ATP and 2 NADH E. 1 ATP, 3 NADH, and 1 FADH2
D. 2 ATP and 2 NADH.
What is the approximate atomic mass of an atom with 16 neutrons, 15 protons, and 15 electrons? A. 15 daltons B. 16 daltons C. 30 daltons D. 31 daltons E. 46 daltons
D. 31 daltons.
What is the result when a diploid cell undergoes meiosis? A. 2 diploid cells B. 2 haploid cells C. 4 diploid cells D. 4 haploid cells E. 2 haploid cells and 2 diploid cells
D. 4 haploid cells.
One strand of DNA has the sequence 5' T-C-T-A-T-G-G-T 3'. What is the sequence of the complementary strand? A. 5' T-G-T-A-T-G-G-T 3' B. 5' G-A-G-C-G-T-T-G 3' C. 5' A-G-A-T-A-C-C-A 3' D. 5' A-C-C-A-T-A-G-A 3' E. 5' A-C-A-T-A-G-G-A 3'
D. 5' A-C-C-A-T-A-G-A 3'.
What type of molecule is ATP? A. A carbohydrate B. A protein C. A lipid D. A nucleotide
D. A nucleotide.
Which of the following mutations would most likely have a negative effect on an organism? A. A deletion of three nucleotides near the middle of a gene. B. A single nucleotide deletion in the middle of an intron. C. A single nucleotide deletion near the end of the coding sequence. D. A single nucleotide insertion downstream of, and close to, the start of the coding sequence.
D. A single nucleotide insertion downstream of, and close to, the start of the coding sequence.
The primary role of oxygen in cellular respiration is to: A. Combine with lactate, forming pyruvate. B. React with ADP and Pi to form ATP. C. Combine with carbon, forming CO2. D. Act as an acceptor for electrons and hydrogen ions, forming water. E. Catalyze the reactions of glycolysis.
D. Act as an acceptor for electrons and hydrogen ions, forming water.
In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts? A. DNA does not contain sulfur, whereas protein does. B. DNA contains phosphorus, whereas protein does not. C. DNA contains nitrogen, whereas protein does not. D. Answers A and B are correct. E. Answers A, B, and C are correct.
D. Answers A and B are correct.
The selective permeability of biological membranes is dependent on which of the following? A. The type of transport proteins that are present in the membrane. B. The lipid bilayer being permeable to primarily small, non-polar molecules. C. The types of carbohydrates on the surface of the membrane. D. Answers A and B are correct. E. Answers A, B, and C are all correct.
D. Answers A and B are correct.
In what type of photosynthesis are the leaf stomates open at night and closed during the day? A. Calvin cycle photosynthesis B. C3-type photosynthesis C. C4-type photosynthesis D. CAM-type photosynthesis E. No type of photosynthesis does this.
D. CAM-type photosynthesis.
What four elements make up 96% of living matter? A. Carbon, sodium, chlorine, nitrogen B. Carbon, sulfur, phosphorus, hydrogen C. Oxygen, hydrogen, calcium, sodium D. Carbon, hydrogen, nitrogen, oxygen E. Carbon, oxygen, sulfur, calcium
D. Carbon, hydrogen, nitrogen, oxygen.
Which statement about DNA is true? A. DNA binds to ribosomes during protein synthesis. B. DNA contains the sugar ribose. C. DNA contains the base uracil. D. DNA contains the base adenine. E. All of the above.
D. DNA contains the base adenine.
In chemiosmotic phosphorylation, what is the most direct source of energy that is used to convert ADP+ Pi to ATP? A. Energy released as electrons flow through the electron transport system. B. Energy released from substrate-level phosphorylation. C. Energy released from ATP synthase pumping hydrogen ions against their concentration gradient. D. Energy released from movement of hydrogen ions through ATP synthase. E. No external source of energy is required because the reaction is exergonic.
D. Energy released from movement of hydrogen ions through ATP synthase.
You are trying to identify an organism by looking at a group of its cells under the microscope. It is a multicellular and the cells clearly have a cell wall. The cells have many internal organelles but no chloroplasts. To which kingdom does this organism belong? A. Monera B. Animal C. Calamari D. Fungi E. Plant
D. Fungi.
A molecule becomes more reduced when it: A. Changes shape B. Gains a H+ ion C. Loses a H+ ion D. Gains an electron E. Loses and electron
D. Gains an electron.
Which pathway is common or reaction is used both in aerobic respiration and alcohol fermentation? A. The electron transport chain B. The Calvin cycle C. The Krebs cycle D. Glycolysis E. Production of lactic acid
D. Glycolysis.
Where are ribosomes assembled in eukaryotic cells? A. On the endoplasmic reticulum B. In lysosomes C. In the cis golgi D. In the nucleus E. In the mitochondria
D. In the nucleus.
When you cut your arm or leg the skin cells grow and fill in the damaged area. What type of cell division is occurring? A. RNA transcription B. DNA replication C. Meiosis D. Mitosis E. Prokaryotic fission
D. Mitosis.
The nucleus and the mitochondria contain ____ but the lysosome and the cell wall do not. A. Carbohydrate B. Lipid C. Protein D. Nucleic acid E. All of the above
D. Nucleic acid.
When compared with oxidized NAD, reduced NADH has: A. An extra phosphate group B. One less phosphate group C. One more carbon=carbon double bond D. One less carbon=carbon double bond E. One less oxygen atom
D. One less carbon=carbon double bond.
If somebody knows only their ABO blood type, do they also know their genotype? A. Only if their genotype is O. B. Only if their genotype is AB. C. Only if their genotype is A or B. D. Only if their genotype is AB or O. E. Yes, if you know your blood type you always know your genotype.
D. Only if their genotype is AB or O.
Which hormone raises blood calcium levels? A. Insulin B. Glucagon C. Calcitonin D. Parathyroid hormone
D. Parathyroid hormone.
Cholesterol is carried in the blood on lipoproteins. These will bind to a cell and invagination of the plasma-membrane occurs forming a vesicle. The cholesterol is brought into the cell inside this vesicle. What type of transport is this? A. Facilitated diffusion B. Active transport C. Exocytosis D. Receptor mediated endocytosis E. Phagocytosis
D. Receptor mediated endocytosis.
Which of the following functional groups helps stabilize the tertiary structure of proteins by forming covalent cross links within protein molecules? A. Hydroxyl B. Amino C. Carboxyl D. Sulfhydryl E. All of the above
D. Sulfhydryl.
The overall three-dimensional shape of a single-polypeptide is called the _____. A. Double helix B. Primary structure C. Secondary structure D. Tertiary structure E. Quaternary structure
D. Tertiary structure.
In the experiment, DNA extracted from baboon skin cells is mixed with living cells of the non pathogenic R strain of Streptococcus pneumoniae and this mixture is injected into mice. What will happen? A. The mice will die and the bacteria taken from the dead mice will look like the S strain. B. The mice will die and the bacteria taken from the dead mice will look like the R strain. C. The mice will live, any surviving bacteria will look like the S strain. D. The mice will live, any surviving bacteria will look like the R strain.
D. The mice will live, any surviving bacteria will look like the R strain.
Which of the following relationships is true of an uncharged atom? A. The atomic mass is equal to the atomic number. B. The atomic mass is equal to the number of neutrons. C. The number of electrons is equal to the number of neutrons. D. The number of protons is equal to the number of electrons. E. C and D are correct.
D. The number of protons is equal to the number of electrons.
In class, I did a demonstration of the following reaction: 2H2O2 --> 2H2O + O2. This reaction did not occur until the catalase was added. What did the catalase do? A. The reaction is normally endergonic, but the catalase changed the reaction and it became exergonic. B. The reaction is normally exergonic, but the catalase changed the reaction and it became endergonic. C. The reaction is always endergonic, but catalase provided ATP to drive the reaction. D. The reaction is always exergonic, but catalase lowered the activation energy. E. Peroxide breaks down catalase releasing O2.
D. The reaction is always exergonic, but catalase lowered the activation energy.
In biological molecules, nitrogen atoms normally form _____ bonds. A. Two ionic B. Three ionic C. Two covalent D. Three covalent E. Four covalent
D. Three covalent.
Modern variations of the influenza virus can be recombinations of ______. A. Two or more old human viruses. B. Pig viruses and human viruses. C. Duck viruses and human viruses. D. Pig viruses, duck viruses, and human viruses. E. All of the above are correct.
E. All of the above are correct.
This component is found in prokaryotic cells _____. A. Carbohydrate B. Lipid C. Protein D. Nucleic acid E. All of the above
E. All of the above.
Which of the following is a function of a protein: A. Transport molecules. B. Move vesicles along microtubules. C. Microtubules are made of proteins. D. Some hormones are made of proteins. E. All of the above.
E. All of the above.
Place the following in the correct order from smallest to biggest. A. Human fibroblast cell, amino acid, lysosome, triglyceride B. Triglyceride, human fibroblast cell, amino acid, lysosome C. Amino acid, lysosome, triglyceride, human fibroblast D. Triglyceride, amino acid, lysosome, human fibroblast cell E. Amino acid, triglyceride, lysosome, human fibroblast cell
E. Amino acid, triglyceride, lysosome, human fibroblast cell.
It is presently thought that chlorophyll is essential for photosynthesis. Which of the following observations would disprove this hypothesis? A. A plant is discovered that performed photosynthesis but has no chlorophyll. B. It is found that a part of the plant that does not contain chlorophyll (like the root) does photosynthesis. C. It is found that a part of the plant cell that does not contain chlorophyll (like the central vacuole) does photosynthesis. D. Chlorophyll is removed from a plant and it is still able to do photosynthesis. E. Any of the above observations would disprove the hypothesis.
E. Any of the above observations would disprove the hypothesis.
In the scientific method, which step comes directly after formulating your hypothesis? A. Making observations. B. Conclusion. C. Formulating a theory. D. Searching for relevant materials in the library. E. Conducting a controlled experiment.
E. Conducting a controlled experiment.
Flask A contains no O2 and no glucose and is kept in the dark. Flask B contains no O2 and no glucose and is kept in the light. Flask C contains O2 but no glucose and is kept in the dark. Flask D contains no O2 but has glucose and is kept in the dark. Flask E contains O2 and has glucose and is kept in the dark Which flask(s) is/are growing? A. Only B B. Only E C. Only B and E D. C and E E. D and E
E. D and E.
Flask A contains no O2 and no glucose and is kept in the dark. Flask B contains no O2 and no glucose and is kept in the light. Flask C contains O2 but no glucose and is kept in the dark. Flask D contains no O2 but has glucose and is kept in the dark. Flask E contains O2 and has glucose and is kept in the dark. Which flask(s) is/are producing CO2? A. Only B B. Only E C. Only B and E D. C and E E. D and E
E. D and E.
What type of bond results from a complete transfer of electron(s) between atoms? A. Hydrogen bond B. Hydrophobic interaction C. Nonpolar covalent bond D. Polar covalent bond E. Ionic bond
E. Ionic bond.
Compare the process of spermatogenesis and oogenesis in humans. Which process takes longer? A. Spermatogenesis takes much longer (days or more) than oogenesis. B. Spermatogenesis takes only a little longer (hours or less) than oogenesis. C. Spermatogenesis takes about the same time as oogenesis. D. Oogenesis takes only a little longer (hours or less) than spermatogenesis. E. Oogenesis takes much longer (days or more) than spermatogenesis.
E. Oogenesis takes much longer (days or more) than spermatogenesis.
A woman is pregnant at age 40. The egg that was fertilized resulting in the pregnancy began the process of meiosis about how long before completing the process? A. A few hours B. About one week C. About one month D. 27 year (started at age 13) E. Over 40 years
E. Over 40 years.
When a neutrophil cell chases down and engulfs a bacterium like we saw in the video, what type of transport is occurring? A. Simple diffusion B. Facilitated diffusion C. Active transport D. Endocytosis E. Phagocytosis
E. Phagocytosis.
Which enzyme synthesizes small pieces of RNA to help DNA polymerase start making a new DNA strand during replication? A. Helicase B. DNA polymerase C. Ligase D. Single stranded binding proteins E. Primase
E. Primase.
Which enzyme is responsible for making the RNA strand during transcription? A. DNA ligase B. The ribosome C. DNA polymerase I D. DNA polymerase III E. RNA polymerase
E. RNA polymerase.
What types of fermentation can the brain perform? A. Alcohol fermentation only B. Lactic acid fermentation C. Both alcohol and lactic acid fermentation D. CAM type fermentation - like in tequila E. The brain cannot do any fermentation
E. The brain cannot do any fermentation.
What happens when an ionic compound is dissolved in water?
Each ion is surrounded by a sphere of water molecules called a hydration shell.
Ionic bonds
Electrons transferred.
Difference between endocrine and paracrine signaling
Endocrine is actually putting out the hormone whereas paracrine is signaling to surrounding cells.
What happens during RNA splicing?
Enzymatic removal of non-coding regions (introns).
Our cells take up iron from the blood. Iron is usually bound to transferrin and when transferrin binds to its receptor on the outside of the cells it is brought inside the cell in coated vesicles. What type of transport is this? A. Pinocytosis B. Exocytosis C. Endocytosis D. Phagocytosis E. Clathrin-mediated endocytosis F. Answers C and E are correct G. Answers B and E are correct
F. Answers C and E are correct.
What is the name of the protein that makes DNA using RNA as the guide? A. DNA polymerase B. RNA polymerase C. A ribosome D. Transcriptase E. Replicase F. Reverse transcriptase
F. Reverse transcriptase.
True or False: Only eukaryotic cells possess ribosomes.
False; Both eukaryotic and prokaryotic cells possess ribosomes.
True or False: DNA is an extremely short-lived molecule.
False; DNA is an extremely long-lived molecule.
True or False: Most metabolic pathways are unregulated.
False; Most metabolic pathways are regulated.
