Genetics Exam

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

10. You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? a. 7.5 seconds b. 15 seconds c. 30 seconds d. 1 minute e. 2 minutes

15. Which of the following enzymes do NOT aid in unwinding of DNA for replication? a. Helicase b. Single-stranded binding proteins c. Primase d. Gyrase e. Topoisomerase

3. Which of the following does NOT utilize bidirectional replication? a. Theta model b. Rolling circle model c. Linear model d. Eukaryotes e. Bacteria

b. Rolling circle model

33. _______ are tandemly repeated DNA sequences located at the ends of eukaryotic chromosomes. a. Replication bubbles b. Telomeres c. Nucleosomes d. Licensing factors e. Holliday junctions

b. Telomeres

20. Which of the following is a protein that facilitates the termination of replication in E. coli? a. Telomerase b. DNA gyrase c. Tus d. Primase e. Topoisomerase

21. DNA synthesis during replication is initiated from a. a free 5′ OH. b. DNA primers. c. RNA primers. d. telomerase. e. DNA polymerase I.

25. DNA primase requires a ____ template and _____ nucleotides to initiate primer synthesis. a. DNA; DNA b. RNA; RNA c. DNA; RNA d. RNA; DNA e. leading strand; DNA

35. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA polymerase replicates mitochondrial, chloroplast, and nuclear DNA. b. There are only two different DNA polymerases that function in the process of replication. c. Some DNA polymerases have the ability to function in DNA repair mechanisms. d. All eukaryotic DNA polymerases have 3′ → 5′ exonuclease activity. e. Leading and lagging strand synthesis are performed by the same type of DNA polymerase.

6. What type of synthesis occurs on the leading strand? a. Conservative b. Dispersive c. Continuous d. Discontinuous e. Recombination

7. In the diagram below, which letter indicates the 5′ end of the leading strand? a. A b. B c. C d. D e. C and D

The primary function of telomeres is to protect against

chromosome fusions

What is the closest type of DNA related to: gene-encoding sequence

unique-sequence DNA

a gene undergoing transcription.

"Christmas tree" represented

were RNA.

"the branches" of the christmas tree

were DNA molecules.

"tree trunks" of the christmas tree

There are _____ different codons, which encode 20 amino acids and 3 stop codons. A) 16 B) 20 C) 23 D) 61 E) 64

template strand

The nucleotide strand used for transcription

a single strand of the DNA double helix.

The template for RNA synthesis is

The mutation rate for a species is calculated as

the number of new mutations per base pair per generation

Failed separation (non-disjunction) of a homologous pair of chromosomes could occur at

The first meiotic division

the transcription start site.

The first nucleotide transcribed is numbered +1 called the

The function of aminoacyl-tRNA synthetases is to: a. transcribe tRNA genes b. match tRNA anticodons and mRNA codons at the ribosome. c. attach appropriate amino acid to corresponding tRNAs. d. form the peptide bond between amino acids at the ribosome. e. synthesize and transport amino acids to the ribosomes.

The genetic code is said to be "degenerate" because: a. there are more codons than amino acids b. there are more amino acids than codons. c. different organisms use different codons to encode the same amino acid. d. some codons specify more than one amino acid. e. there are more tRNAs than amino acids.

What is a genotype?

The genetic makeup of an organism.

Transposon "footprints" (i.e., target site duplications) are produced upon transposon insertion into target DNA.

True

Transposons and insertion sequences are flanked by indirect repeats.

True

Transposons can transfer DNA directly or through RNA intermediates.

True

True (T) or False (F)? All nucleated cells in your body contain ~2 meters of DNA

True

True (T) or False (F)? Heterochromatic regions of the genome replicate late in S-phase

True

True (T) or False (F)? The sum of purine bases in a genome is equal to the sum of pyrimidine bases

True

b) If you answered yes, how many generations would this have taken? If you answered no explain your answer. (1pt)

Two separate bands would never have been observed because, under the dispersive model, each round of replication produces daughter molecules for which each strand is made up of newly synthesized and template DNA. So there would be less 15N labeling with each generation but there would always be a single band.

Explain why DNA-DNA hybridization might be useful in helping to assess evolutionary relationships.

Two single-stranded DNA molecules will anneal if complementary; the strength of the association will be greater the more the two strands are complementary. We assume that the greater the similarity of DNA sequence, the more closely related the two species.

What if you instead knocked out the genes that comprise the dosage compensation complex in a cell line derived from a female Drosophila? Would you expect higher, lower or unchanged expression of X-linked genes? Explain! (1pt)

Unchanged expression because dosage compensation complex genes are normally only expressed in male flies/are suppressed (by Sxl) in female flies

The holoenzyme (core enzyme + sigma)

What binds to the −10 consensus sequence found in most bacterial promoters?

An individual with the chromosome 14/21 translocation associated with familial Down syndrome

will produce some normal gametes

Inverted repeats followed by a string of adenine nucleotides

What characteristics are most commonly found in rho-independent terminators?

Both b and c. The regulatory promoter is farther upstream of the gene. Transcription factors bind to the core promoter; transcriptional activator proteins bind to the regulatory promoter.

What is the difference between the core promoter and the regulatory promoter?

The results of the ENCODE project indicate that

a large fraction of our genome is involved in regulating gene expression

Which of the following RNA molecules are required for the process of translation? a. crRNA b. tRNA c. snRNA d. snoRNA e. siRNA

tRNA

TATA box

A first step in initiation is the binding of TFIID to the _____ on the DNA template.

What is the function of Helicase in DNA replication?

Helicase unwinds the DNA.

Which of the following statements about the final product of meiosis is true?

The chromosome number is reduced by half

What is the function of DNA Pol 1?

To remove RNA primers and fill in the gaps left.

What is homozygous recessive?

Histone acetylation does what

decreases chromatin condensation

The genetic code is degenerate. This means that

most amino acids are specified by more than one codon

A ___ ____ mutation results in a premature stop codon.

nonsense

How do insertion sequences and composite transposons differ?

(1) Insertion sequences contain genes required for transposition (e.g., transposase) and reinsertion flanked by inverted terminal repeats. Insertion sequences only carry genes required for transposition and reinsertion, and are thus relatively short sequences. (2) Composite transposons are complex transposons that are generally any sequence of DNA flanked by two insertion sequences. Composite transposons can be up to thousands of base pairs long and carry various genes, such as antibiotic resistance genes. One or both of the insertion sequences contains the transposase that enables the transposon to excise and reintegrate elsewhere within the genome.

List and describe the three major classes of DNA sequences in the eukaryotic genome.

(1) Single-copy sequences (1-10 copies per genome) (2) Moderately repetitive sequences (10-100,000 copies per genome; repeats average 150-300 base pairs) (3) Highly repetitive sequences (100,000 millions of copies per genome; repeats usually, but not always, 10 base pairs or fewer)

What are two advantages for cells that maintain negatively supercoiled DNA?

(1) The DNA is easier to separate (i.e., faster and less energy is required) during replication and transcription. (2) Supercoiled DNA is more condensed and thus can be packed into smaller spaces than relaxed DNA. This is very important, given the total amount of DNA in a given cell.

the amount of adenine is equal to the amount of guanine. B. the amount of cytosine is equal to the amount of thymine. C. the amount of uracil is equal to the amount of adenine. D. (adenine + guanine)/(cytosine + thymine) = 1. E. None of the above.

(adenine + guanine)/(cytosine + thymine) = 1.

Based on trio sequencing studies, ~ how many mutations would you expect to carry that you could pass on to your children but that were not present in either of your parents?

-60

Forms of DNA replication include all of the following EXCEPT: A. theta replication of circles in bacteria. B. multiple replication forks in some plasmids. C. rolling circle replication of the F factor. D. multiple replication forks in eukaryotes. Actually, all of these are observed forms of DNA replication

. multiple replication forks in some plasmids

In a Mendelian dihybrid cross, in which green is dominant to red and large is dominant to small, the probability that any one F2 individual will be green and small is (round up decimals as needed!)

0.19

Transcription factors (TFs) have a minimum of two functional domains. What is the function of each? (1pt)

1) DNA binding domain, 2) Trans-activating or trans-repressing domain

Bacteriophages are a type of virus. Like other viruses they have very small genomes. You are studying one with a genome size of 5385 nucleotides. a) What is the maximum number of amino acids that you would expect to be translated from this phage genome? (0.5pts)

1,794 [5,385/3 - 1 for stop codon]

Most eukaryotic protein coding genes have introns and exons. The introns are transcribed but are spliced out before the exons are translated into protein. Seems like a lot of extra cellular work for nothing. Identify two potential benefits of introns that could explain their persistence. (4 pts)

1. Alternative splicing of exons can increase the number and functional diversity of gene products without increasing genome size. Wouldn't be possible without introns. 2. Introns can contain cis-regulatory elements (e.g. enhancers) recognized by proteins that affect transcription of that gene. 3. Intron transcripts sometimes contain short RNAs (e.g. miRNAs) that regulate transcription. 4. Exon shuffling: this hypothesis is based on the modular nature of exons, separated by introns, and the idea that exons are sometimes equivalent to the domains of a protein, each of which has a particular function (e.g. DNA binding). Over evolutionary time, there's potential for subsets of exons from different genes to give rise to a new gene and thus a new protein.

Name two ways in which a pre-mRNA transcript can encode more than one protein product. (4 pts)

1. Alternative splicing results in alternative isoforms of the same protein 2. Posttranscriptional modification of mRNA by RNA editing can change the identity of bases, resulting in variation among protein products, depending on whether or not RNA editing occurred. [Remember the Antarctic octopus!] 3. Overlapping genes is also allowable

What is the difference between exo and endonucleases?

1. Exonucleases: remove a nucleotide only from the end of a chain. 2. Endonucleases: break bonds within a chain.

What is the probability that the child indicated as (?) will express the trait? (Be sure to show how you arrived at your answer!) (6 pts)

1/2*1/2*1/2 = 1/8 or 0.5*0.5*0.5 = 0.125 We know that this child could only inherit the trait from their mother because the father does not express the trait and therefore cannot be a carrier. In part a) we determined that the grandmother of the child was a heterozygous carrier. We also know that this is an X-linked recessive trait, so the child would have to be male to express the trait. So we are dealing with 3 probabilities: 1) the probability that the child's mother inherited the mutated X, 2) the probability that she transmits it to her child, and 3) the probability that child is male. In each case there is a 50% chance of the outcome we are interested in.

A baby boy is born with purple hair. Wow! A genetic councilor determines that both parents are carriers for the extremely rare, autosomal recessive purple hair allele (p). What are the chances?! Seriously, what are the chances that their next child will be what they are hoping for, a purple-haired girl? (1pt)

1/8 or 0.125 for a purple-haired girl. (The easiest way to solve this problem is with a Punnett square or by simply remembering the 3:1 ratio for monogenic Mendelian traits. But to get it right you have to also remember to multiply the probability of a purple-haired child x the probability of a girl: ¼ x ½)

Here is a eukaryotic gene. The numbers are base pairs (bp) for each exon and intron. a) How long (in bases) will the pre-mRNA transcript be? (0.5pts)

10,620 bp [the sum of all exons and introns.]

Who is Sutton?

1902; chromosomal theory of inheritance.

Coat color in guinea pigs is determined by an autosomal gene with six alleles. The maximum number of different alleles that one normal guinea pig can have at this locus is/are:

If you determine that 23% of an organism's genome is comprised of guanine, what percentages of the other three bases would you expect to find? (1pt)

23% cytosine; 27% adenine; 27% thymine

In a bird species that normally lays clutches of 8 eggs, how many possible sex ratios could be observed in chicks from a single clutch? Hint: the space provided is more than enough to answer this question! (4 pts)

28 = 256 (where 8 is the number of events [eggs] and 2 is the number of possible outcomes/event.)

DNA replication is semiconservative. This means that

28% adenine, 22% cytosine, 22% guanine

Multiple choice questions worth 4 pts each. For each, choose the one answer that best completes the statement or answers the question.

28% adenine, 22% cytosine, 22% guanine

What is the maximum number of amino acids that could make up this gene's protein product? (0.5pts)

282 [the sum of all exons: 849/3 = 283 - 1 stop codon = 282]

.You count a total of eight chromosomes in an animal cell at metaphase I in meiosis. (1pt) a) What is this organism's diploid number? b) How many pairs of homologous chromosomes are there? c) How many sister chromatids? d) Would you expect to see the same or different numbers of sister chromatids in a mitotic metaphase cell from the same organism?

2n = 8 (8 also OK) 4 16 Same

In a reciprocal translocation there is an exchange of genetic material between two nonhomologous chromosomes. A reciprocal translocation occurs in meiosis prophase I between the bracketed regions on the chromosomes below. Draw (neatly!) the four possible gametes that could be produced and indicate those that could cause developmental problems if fertilized by a gamete with a normal genotype. Hint: don't worry about what sister chromatids are doing, just focus on chromosomes. (1pt)

3 and 4 will likely cause developmental problems but 1 and 2 won't. This is because 1 is normal, 2 is the balanced translocation (nothing lost/gained) but 3 and 4 are unbalanced (3 has 2 copies of f and is missing a; 4 has two copies of a and is missing f).

Leading strand

3' - 5'; sugar to phosphate

DNA polymerases require all of the following for DNA replication, EXCEPT a. DNA template. b. primer. c. free 3′ OH. d. 3′ to 5′ polymerase activity. e. dNTPs

3' to 5' polymerase activity

2. Mice have a diploid number of 2n = 40. How many chromosomes will be present in the following cell types? For each, indicate whether the cell is haploid (H) or diploid (D). (1pt) a) primary oocyte b) secondary spermatocyte c) first polar body d) a cell that has undergone the second meiotic division

40, D 20, H 20, H 20, H

Lagging strand

5' - 3'; phosphate to sugar

It is estimated that transposable elements compose approximately what percent of the human genome:

50%

What is the theoretical upper limit on observed percent recombination between two linked genes? (1pt)

50%

If an organism has a 20,000,000 bp genome and, on average, 50 new mutations arise per generation, what is the mutation rate? (1pt)

50/20,000,000 = 2.5 x 10-6 or 0.0000025

If genes A and B are 25 map units (mu) apart, what percentage of non-crossover gametes would you expect to find in an individual that is heterozygous for both genes? (5 pts)

75% [Because map units are equivalent to % observed recombination, if 25% are crossover (i.e. recombinant) then the other 75% have to be non-crossover. If you had broken this down into 25% crossover between non-sister chromatids and therefore 25% from the second pair of non-sister chromatids that aren't involved in the crossover, plus the 50% that don't have a crossover at all, that would have been correct but unnecessary!]

How many sister chromatids will be present in these same cell types in mice? (1pt) a) primary oocyte 80 b) secondary spermatocyte 40 c) first polar body 40 d) a cell that has undergone the second meiotic division

80 40 40 0 (20 chromosomes also OK but in fact, there are no more sister chromatids after second division)

c) You crossed these F1s to produce an F2 generation. What were the phenotypic ratios observed in these fish? (4 pts)

9 green/forked : 3 green/blunt : 3 red/forked : 1 red/blunt 9:3:3:1 also gets full points

What percent is functional?

> 80%

A deletion occurs in the trp operon DNA of E. coli and results in the loss of the attenuation region in the 5 UTR of the RNA. The DNA sequences of the structural genes and the operator/promoter region are not affected by deletion. What effect will this deletion be expected to have on the regulation of this mutant trp operon compared to a wild-type operon? A) In the presence of tryptophan, transcription of the structural genes will be enhanced compared with a wild-type operon. B) In the absence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. C) In the presence of tryptophan, the repressor will bind to the operator/promoter region in the mutant operon more strongly than in a wild-type operon. D) In the absence of tryptophan, RNA polymerase will not bind to the operator/promoter region in the mutant operon. E) In the presence of tryptophan, transcription will be initiated at the second structural gene in the mutant operon.

A lac operon of genotype lacI+ lacP+ lacO+ lacZ+ lacY- will produce -galactosidase but not permease when: A) lactose is present. B) lactose is absent. C) in the presence or absence of lactose. D) glucose is present. E) glucose and lactose are both present.

A lac operon of genotype lacI+ lacP+ lacO+ lacZ- lacY+ will not produce -galactosidase but will produce permease when: A) lactose is present. B) lactose is absent. C) in the presence or absence of lactose. D) glucose is present. E) glucose and lactose are present.

A promoter that affects only genes that are on the same piece of DNA is referred to as a(n) _____-acting promoter. A) cis B) trans C) enhancer D) positive E) negative

An in vitro transcription system that contains a bacterial gene initiates transcription from random points on the DNA. Which of the following proteins MOST likely is missing from the reaction? A) sigma factor B) rho factor C) RNA polymerase II D) TATA-binding protein (TBP) E) TFIID

An in vitro transcription system that contains a bacterial gene initiates transcription, but from random points on the DNA. Which of the following proteins most likely is missing from the reaction? A) Sigma factor B) Rho factor C) RNA polymerase II D) TATA-binding protein (TBP) E) TFIID

An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule. The type of control illustrated is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) attenuation.

During initiation, the _____ subunit is the first part of the ribosome to associate with the mRNA. A) small B) large C) intermediary D) secondary E) tertiary

E. coli lac operon control by lacI is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) attenuation.

If the sequence of an RNA molecule is 5'-GGCAUCGACG-3', what is the sequence of the nontemplate strand of DNA? A) 5'-GGCATCGACG-3' B) 3'-GGCATCGACG-5' C) 5'-CCGTAGCTGC-3' D) 3'-CCGTAGCTGC-5' E) 3'-CGTCGATGCC-5'

In eukaryotic cells, where does the basal transcription apparatus bind? A) Core promoter B) Regulatory promoter C) Terminator D) Enhancer E) Ribozyme

In eukaryotic cells, where does the basal transcription apparatus bind? A) core promoter B) regulatory promoter C) terminator D) enhancer E) ribozyme

In transcription, to which end of the elongating strand are nucleotides always added? A) 3 B) 5 C) 3 in prokaryotes and 5 in eukaryotes D) It depends on which RNA polymerase is being used. E) It depends on which DNA strand is being used as the template.

In transcription, to which end of the elongating strand are nucleotides always added? A) 3′ B) 5′ C) 3′ in prokaryotes and 5′ in eukaryotes D) It depends on which RNA polymerase is being used. E) It depends on which DNA strand is being used as the template

In which of the following organisms would transcription be the LEAST similar to archaea? A) E. coli B) Yeast C) Plants D) Mice E) Humans

In which of the following organisms would transcription be the LEAST similar to archaea? A) E. coli B) yeast C) plants D) mice E) humans

Mechanisms that exist to detect and deal with errors in mRNA in order to ensure the accurate transfer of genetic information are collectively referred to as: A) mRNA surveillance. B) proofreading function. C) RNA interference. D) alternative processing. E) RNA transition.

Over time, DNA replaced RNA as the primary carrier of genetic information, and the chemical stability of DNA is believed to be the key reason for this. Which attribute of DNA is the reason behind its chemical stability? A) DNA lacks a free hydroxyl group on the 2′-carbon atom of its sugar. B) Unlike RNA, DNA is usually double-stranded. C) DNA does not usually form hairpin loops. D) One of the two pyrimidines found in DNA does not involve uracil. E) DNA contains thymines, which make it more chemically stable.

Over time, DNA replaced RNA as the primary carrier of genetic information, and the chemical stability of DNA is believed to be the key reason for this. Which attribute of DNA is the reason behind its chemical stability? A) DNA lacks a free hydroxyl group on the 2-carbon atom of its sugar. B) Unlike RNA, DNA is usually double stranded. C) DNA does not usually form hairpin loops. D) One of the two pyrimidines found in DNA does not involve uracil. E) DNA contains thymines, which make it more chemically stable.

Proteins with DNA-binding motifs predominantly bind to the _____ of DNA. A) major groove B) minor groove C) paired nitrogenous bases D) phosphate groups E) deoxyribose sugar

Refer to the following sequence: 5 ...GGAGCUCGUUGUAUU... 3 Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile... B) pro-arg-ala-thr-stop C) met-asn-glu-leu... D) glu-leu-val-val-phe... E) leu-glu-gln-his-asn...

The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived from: A) exons. B) introns. C) promoters. D) terminators. E) the protein-coding region.

The 5 cap on an mRNA is important for all the processes listed below except for the _____ of an mRNA molecule. A) transcription B) intron removal C) stability D) initiation of translation E) ribosomal interaction

The amino acid sequence of a polypeptide is referred to as the _____ sequence of the polypeptide. A) primary B) secondary C) tertiary D) quaternary

The genetic code is said to be "degenerate" because: A) there are more codons than amino acids. B) there are more amino acids than codons. C) different organisms use different codons to encode the same amino acid. D) some codons specify more than one amino acid. E) there are more tRNAs than amino acids.

The nucleotide sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5 GGAGACUCGUUGUAUU 3. Why does or why doesn't the amino acid sequence change? A) The reading frame changes after the mutation (the addition of an A in the fifth position) and so the amino acid sequence is modified after that point. B) The reading frame, starting at the 5 end of this sequence, would be modified because of this change and so the entire amino acid would be different. C) The amino acid is not changed since the coding sequence was not changed at the 5 position. D) A premature stop codon caused by this change would result in a truncated polypeptide. E) Just one amino acid would be changed in the resulting polypeptide.

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) 5 ACUGGACAGUCGGCACCACG 3 B) 5 GUAAGAAUACAAC 3 C) 5 UGACCUGUCAGCCGUGGUGC 3 D) 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 E) 5 AGAAUACAACACAGUCGGCACCACG 3

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. A) RNA only B) DNA only C) Both RNA and DNA D) Neither RNA nor DNA

To which part on a tRNA would an amino acid attach during tRNA charging? A) 3 acceptor arm B) anticodon arm C) TC arm D) DHU arm E) extra arm

What is the function of allolactose in regulation of the lac operon? A) inducer B) repressor C) activator D) promoter E) regulatory protein

What is the function of eukaryotic RNA polymerase I? A) Transcription of rRNA genes B) Transcription of mRNA genes C) Transcription of tRNA genes D) Transcription of snRNAs E) Initiation of transcription (but not elongation)

What is the function of eukaryotic RNA polymerase I? A) transcription of rRNA genes B) transcription of mRNA genes C) transcription of tRNA genes D) transcription of snRNAs E) initiation of transcription (but not elongation)

When a structural gene is under negative inducible control, what would be the result of a mutation that eliminates the repressor protein? A) The structural gene will be constitutively expressed due to the lack of negative inducible control. B) The transcription of the structural gene will not be affected, as a repressor is not required. C) The mutation will lead to activation of an activator upon the lack of a repressor protein, which will allow the transcription to continue. D) Since transcription will require a repressor protein, the transcription will be turned off. E) More cAMP will be produced in a cell to compensate for the lack of a repressor protein.

Where are promoters usually located? A) Upstream of the start site B) Downstream of the start site C) Near nucleotide +25 D) Near the hairpin loop E) Downstream of the terminator

Where are promoters usually located? A) upstream of the start site B) downstream of the start site C) near nucleotide +25 D) near the hairpin loop E) downstream of the terminator

Which of the following intron types is present only in eukaryotes? A) nuclear pre-mRNA B) group I intron C) group II intron D) tRNA E) group III intron

Which of the following is generally constitutively transcribed? A) regulatory gene B) structural gene C) operator element D) promoter element E) operon

Which of the following mRNA codons will bind to the tRNA anticodon 5 GCU 3, considering wobble-base pairing rules. A) 5 AGU 3 and 5 AGC 3 B) 5' UGA 3 and 5 CGA 3 C) 5 AGC 3 D) 5 CGA 3 E) 5 AGU 3, 5 AGC 3, 5 AGA 3, and 5 AGG 3

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following statements BEST explains why only pre-mRNA receives a 5 cap? A) The enzyme that initiates the capping step is known to associate with RNA polymerase II, which generates pre-mRNAs. B) Only pre-mRNAs contain proper sequences for the cap to be added on. C) The tail of the pre-mRNA can recruit the right combination of enzymes for capping. D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the cytoplasm for the capping process to begin. E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the cytoplasm.

Which of the following statements CORRECTLY describes the facts about introns and exons? A) The number of introns is always less than the number of exons in a gene. B) Introns are degraded in the cytoplasm. C) All eukaryotic genes contain an intron. D) Mitochondrial and chloroplast genes do not contain introns. E) Introns do not contain sequence-specific information.

Which of the following statements about proteins is INCORRECT? A) All proteins are made up of some combination of 20 essential amino acids. B) Like nucleic acids, polypeptides have polarity. C) A single polypeptide has primary, secondary, and tertiary structures. D) -helix and -pleated sheets do not require a specific sequence of amino acids to form. E) Some proteins contain more than one polypeptide chain.

Which of the following statements does NOT describe the events in prokaryotic translation elongation? A) The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA. B) A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP. C) If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts. D) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. E) The ribosome translocates toward the 3 end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site.

Which of the following statements is NOT true? A) Both DNA and RNA are synthesized in a 5 to 3 direction. B) During RNA synthesis, the DNA template strand is read in a 3 to 5 direction. C) During RNA synthesis, new nucleotides are added to the 3 end of the growing RNA molecule. D) RNA polymerase has 5 to 3 polymerase activity. E) RNA molecules have the same 5 to 3 orientation as the DNA template strands to which they are complementary.

Which of the following statements is TRUE regarding the termination of transcription? A) In some organisms, transcription terminates thousands of nucleotides past the coding sequence. B) Transcription typically terminates precisely at the hairpin loop terminator sequence. C) In prokaryotes, transcription terminates as soon as rho has bound to the RNA. D) In yeast, transcription terminates as soon as Rat1 has bound to the RNA.

Which of the following types of eukaryotic gene regulation takes place at the level of DNA? A) alternation of chromatin structure B) mRNA processing C) RNA interference D) mRNA stability E) posttranslational modification

Initiation of transcription in bacteria consists of all of the following steps EXCEPT: A. recognition of the promoter by RNA molecules. B. unwinding of DNA forming a transcription bubble. C. formation of the first phosphodiester bonds between rNTPs. D. movement of the RNA polymerase from the promoter. E. Actually, all of these are steps in initiation.

All of the above.

Transcription Unit

A _____ is a piece of DNA that encodes a RNA molecule and the sequences necessary for its proper transcription. It contains a promoter, a RNA-coding region, and a terminator.

A _____________________ is a piece of DNA that encodes a RNA molecule and the sequences necessary for its proper transcription. It contains a promoter, a RNA-coding region and a terminator. a. transcribed strand b. transcription apparatus c. transcription unit d. Rho-Dependent terminator

. When two nucleotides are joined to each other: A. a phosphodiester bond is formed. B. a covalent bond is formed between the 3' alcohol group of the first nucleotide and the 5' phosphate of the second. C. a covalent bond is formed between the 5' alcohol group of the first nucleotide and the 3' phosphate of the second. D. A and B. E. A and C.

A and B

You are trying to determine whether genes A and B are on the same or different chromosomes. You cross heterozygotes (AaBb) and obtain the following phenotypic ratio in their progeny: 3AB:1ab. You conclude that

A and B are on the same chromosome very close together

What is the function of okazaki fragment in DNA replication?

A building block for DNA synthesis of the lagging strand.

A) zero

How many different types of histones are found in the nucleosome that packages mitochondrial DNA? A) zero B) one C) two D) three E) four

What is a prokaryote?

A cell without a nucleus

B) highly repetitive DNA

A centromere is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

What is genetic mutation?

A change in DNA sequence.

Describe the structure and organization of a core nucleosome. What is "linker" DNA?

A core nucleosome particle consists of: approximately 200 nucleotides of DNA wrapped around a core complex composed of 4 histone (H2A, H2B, H3, and H4) homodimers, called an octamer. Histone H1 is involved in higher-level packing (condensation) of chromatin, but is not a part of the core nucleosome. Linker DNA is made up of the short stretches of DNA that link adjacent nucleosomes together.

Which of the following is NOT necessary for RNA polymerase to recognize the promoter of a bacterial gene? A) Sigma factor B) Origin of replication C) -10 consensus sequence D) -35 consensus sequence

Humans have a diploid number of 2n = 46. This means that

A first polar body contains 23 chromosomes

E) unique-sequence DNA

A gene-encoding sequence is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

Which of the following is NOT required for transcription? A) Ribonucleotides B) RNA primers C) DNA template D) RNA polymerase E) Promoter

If this limit is reached between linked genes A and B, what are the different types of gametes that a heterozygous individual (AaBb) could produce and what are the expected percentages of each? (1pt)

AB, Ab, aB, ab all in equal proportions (25% each) [This is because at 50% observed recombination there would always be a crossover event between one pair of non-sister chromatids with the other 50% accounted for by the other pair of non-sister chromatids that don't participate in the crossover.]

Which of the following statements is correct? a. All genomes are encoded in DNA only. b. All genomes are encoded in nucleic acids. c. All genomes are encoded in proteins only. d. The genetic instructions are decoded completely differently in each organism. e. The molecular mechanism suggests life evolved from multiple primordial ance

All genomes are encoded in nucleic acids

1. Amino acids consist of a central carbon surrounded by all of the following EXCEPT: A. a methyl group. B. an amino group. C. a carboxylic acid group. D. a side chain. E. Actually, all of these are attached to the central carbon.

A methyl group

Like DNA replication, transcription requires: A. a template strand of DNA. B. nucleotide monomers. C. a polymerase. D. All of the above

All of the above

Which of the following is NOT required for transcription? A) ribonucleotides B) RNA primers C) DNA template D) RNA polymerase E) promoter

The process of translation requires all of the following EXCEPT: A. charging tRNA molecules by proteins. B. initiation directed by specific sequences. C. elongation relying on base pairing. D. termination controlled by proteins recognizing stop codons. E. Actually, all of these are key parts of translation.

All of the above

Which of the following is a type of RNA that gets translated? A) rRNA B) mRNA C) tRNA D) miRNA E) A, B, and C all get translated.

B) one copy of telomere.

A normal chromosome in a higher eukaryotic species would NOT be expected to contain: A) one centromere. B) one copy of telomere. C) two copies of histone 2A per nucleosome. D) satellite DNA. E) tandem repeat sequences.

Which of the following is not necessary for RNA polymerase to recognize the promoter of a bacterial gene? A) sigma factor B) origin of replication C) -10 consensus sequence D) -35 consensus sequence

C) two

How many membranes separate the mitochondrial matrix from the cytoplasm? A) zero B) one C) two D) three E) four

A) The original plant with green leaves with multiple yellow spots is likely heteroplasmic for a mutation in the chloroplast genome. B) The yellow spots are cells that, by replicative segregation, have received only mutant chloroplast genomes. C) The plants with yellow leaves that originate from the plant with yellow spots as the egg donor received the mutant chloroplast maternally. E) When the plant is the pollen donor, the plant with nonmutant chloroplast DNA will contribute the chloroplasts, and all progeny will have all green leaves.

A plant has green leaves with multiple yellow spots. When used as an egg donor in a cross with a normal plant that has all green leaves, some of the progeny have green and yellow leaves and some have all green leaves. When used as the pollen donor in a cross with a normal plant, all the progeny have all green leaves. Which of the following statements explain(s) the result of this cross? (Select all that apply.) A) The original plant with green leaves with multiple yellow spots is likely heteroplasmic for a mutation in the chloroplast genome. B) The yellow spots are cells that, by replicative segregation, have received only mutant chloroplast genomes. C) The plants with yellow leaves that originate from the plant with yellow spots as the egg donor received the mutant chloroplast maternally. D) Presumably, eggs that are heteroplasmic for mutant chloroplasts will not produce viable plants. E) When the plant is the pollen donor, the plant with nonmutant chloroplast DNA will contribute the chloroplasts, and all progeny will have all green leaves.

Cats with white coat color are more likely to be deaf than non-white cats. This phenomenon is best explained by

A pleiotropic effect of a mutation in the coat color pathway

Individuals conceived by assisted reproductive technologies (ARTs), including in vitro fertilization, are a high risk group for imprinting disorders caused by epimutations. Why? (4 pts)

ARTs involve manipulation of germline cells during and immediately after fertilization. The latter is a time when first the paternal an then the maternal genome undergo including global demethylation. The epigenetic marks that identify the maternal and paternal alleles of imprinted genes are normally maintained through these processes but are particularly vulnerable to perturbation at this time.

the core promoter and the regulatory promoter

A promoter for a gene transcribed by RNA polymerase II typically consists of two primary parts:

What is heterozygous parent?

Which of the following nitrogenous bases is frequently modified enzymatically to become a rare type of nitrogenous base in tRNA? A) adenine B) uracil C) thymine D) cytosine E) guanine

A) moderately repetitive DNA

A tRNA gene is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

Which of the following small RNA types is unique to prokaryotes? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

How many nucleotides encode a codon? a. one b. two c. three d. five e. ten

B) highly repetitive DNA

A telomere is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

What is Anti-parallel arrangement in DNA?

A term applied to two molecules that are side by side but run in opposite directions.

What is a gene?

A unit of heredity that is transferred from a parent to offspring and is held to determine some characteristic of the offspring.

DNA replication requires all of the following EXCEPT: A. a template, that is, a strand or strands to be copied. B. the monomers that are assembled into the new strand, including dCTP. C. the enzymes that carry out the process, including primase. D. the enzymes that carry out the process, including topoisomerase. E. Actually, all of these are required for DNA replication

All of the above.

Chromatin must relax to allow DNA to undergo transcription and replication. Give a detailed mechanistic example of how chromatin relaxes in eukaryotic cells.

Acetylation alters chromatin structure, ultimately allowing histones to loosen their grip on DNA and allowing the DNA to unwind and undergo transcription and replication. During acetylation, acetyltransferases attach acetyl groups to lysine amino acids on the histone tails. This modification reduces the positive charges that normally exist on lysine and destabilizes the nucleosome structure, and so the histones hold the DNA less tightly.

Termination of transcription can be: A. rho dependent, with the rho protein binding a stop transcription sequence. B. rho independent, with the sequence forming a stem loop that terminates transcription. C. rho mediated, with the rho protein phosphorylating the RNA polymerase. D. A and B. E. All of the above

A&B

In Hershey and Chase experiment to show that DNA is the genetic material, which radioactive was used to label DNA? A. 32P B. 3H C. 14C D. 35S

A. 32P

Fill in the blanks below with the single best answer from the following list. (6 pts)

A. Acetylation B. Alpha helix C. Alternative splicing D. Chaperones E. Enhancers F. Phosphorylation G. Prions H. Quaternary I. Secondary J. Tertiary K. Ubiquitins L. Zinc-finger ___ A histone modification that condenses chromatin structure ___ A level of structure found in proteins that consist of >1 polypeptide chain ___ A type of DNA-binding domain ___ A type of secondary structure in proteins ___ An example of posttranscriptional regulation ___ Proteins that tag misfolded proteins for degradation in the proteosome

The genetic code is said to be degenerate, which means: A. more than one codon can specify an amino acid. B. more than one amino acid can specify a codon. C. more than one stop codon can be used. D. the start codon is almost always the same, AUG. E. None of the above.

A. more than one codon can specify an amino acid.

Chargaff's Rule

A=T and C=G

What it homozygous dominant?

White eye color is an X-linked trait in fruit flies. White eyes is recessive to red eyes. If a homozygous white-eyed female and a red-eyed male are crossed

All of their male progeny will have white eyes

You are working on the genetics of flower color in a plant that breeds true for either yellow or red flowers. You begin by crossing yellow and red flowered parents and produce the following F2 phenotypes: 777 red and 219 yellow. a) What did your F1 plants look like and what were their genotypes? (1pt)

All red: Yy, where Y = red and y = yellow

What fraction of embryos from this cross will have heads? (1pt)

All will have heads for the same reason the father has one: their mother has a functional bicoid allele and therefore functional bicoid protein in her eggs.

D) epigenetic

Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins is referred to as _____ changes. A) genetic B) mutational C) sensitivity D) epigenetic

True

Although RNA is usually single stranded, short complementary regions within a nucleotide strand can pair and form secondary structures. True or False?

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing? A) U1 B) U2 C) U5 D) U6 E) spliceosomal proteins

C) short interspersed elements

An Alu sequence is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to bacteriophage infection, by a wide range of bacteriophages. Which of the following genes might she explore as a possible site of the mutation that results in this phenotype? A) A gene that encodes a small nucleolar RNA B) A gene that encodes a Cas protein C) A gene that encodes a Piwi-interacting RNA D) A gene that encodes either a miRNA or a siRNA E) A gene that encodes an immune RNA

What is an allele?

An alternative version of a gene

A transcription unit includes all of the following EXCEPT: A. a promoter. B. a protein-coding sequence. C. an attenuation sequence. D. a termination sequence. E. Actually, all of these are included.

An attenuation sequence.

True

An enzyme called Rat1 attaches to the 5′ end of this RNA and moves toward the 3′ end where RNA polymerase continues the transcription of RNA. Rat1 is a 5′→3′ exonuclease—an enzyme capable of degrading RNA in the 5′→3′ direction. When Rat1 reaches the transcriptional machinery, transcription terminates. Note that this mechanism is similar to that of rho-dependent termination in bacteria, except that rho does not degrade the RNA molecule. True or False?

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces particularly high amounts of ß-galactosidase. What is a possible genotype of the cells? A) lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ B) lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ C) lacI- lacP+ lacO+ lacZ- lacY+ lacA+ D) lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ E) lacI- lacP- lacO+ lacZ- lacY+ lacA-

A partial diploid E. coli cell of lacI+ lacP- lacOc lacI+ lacY+ / lacIs lacP+lacO+ lacZ+ lacY- will synthesize: A) both lacZ and lacY functional gene products in the absence of lactose. B) neither lacZ nor lacY functional gene products in the presence of lactose. C) both lacZ and lacY functional gene products in the presence of lactose. D) lacY but not a functional lacZ gene product in the absence of lactose. E) lacZ but not a functional lacY gene product in the absence of lactose.

Describe a replication bubble with two replication forks

As DNA synthesis continues, the original DNA strands continue to unwind on each side of the bubble, forming a replication fork with two prongs. In bacteria, which have a single origin of replication on their circular chromosome, this process creates a "theta structure" θ.

True

As the transcription apparatus moves down the DNA template, it generates positive supercoiling ahead of the transcription bubble and negative supercoiling behind it. True or False?

True

At the end of initiation, RNA polymerase undergoes a change in conformation (shape) and thereafter is no longer able to bind to the consensus sequences in the promoter. This change allows the polymerase to escape from the promoter and begin transcribing downstream. The sigma subunit is usually released after initiation, although some populations of RNA polymerase may retain sigma throughout elongation. True or False?

two copies of a subunit called alpha (α) and single copies of subunits beta (β), beta prime (β′), and omega (ω)

At the heart of most bacterial RNA polymerases are five subunits (individual polypeptide chains) that make up the core enzyme:

RNA polymerase must stop synthesizing RNA, the RNA molecule must be released from RNA polymerase, the newly made RNA molecule must dissociate fully from the DNA, and RNA polymerase must detach from the DNA template.

At the terminator, several overlapping events are needed to bring an end to transcription:

5 ...GGAGCUCGUUGUAUU... 3 This sequence is RNA because: A) it is single stranded. B) it contains U (uracil) and no T (thymine). C) it runs in a 5 to 3 direction. D) it codes for amino acids . E) it is a small molecule.

A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process? A) RNA splicing of pre-mRNA B) translation C) assembly of the nucleosome D) replication E) transcription

Which of the following is NOT a common DNA-binding motif? A) the helix-loop-helix motif B) the beta sheet-alpha helix motif C) the zinc-finger motif D) the homeodomain motif E) the leucine-zipper motif

A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of XYZ protein made. B) There will be a decrease in the amount of XYZ protein made. C) There will be an increase in the transcription of the XYZ gene. D) There will be a decrease in the transcription of the XYZ gene. E) No change will result from the insertion of the miRNA.

A tRNA anticodon is 5 GCU 3. What amino acid does it carry? A) ala B) arg C) ser D) pro E) thr

An in vitro transcription system transcribes a bacterial gene but terminates inefficiently. What is one possible problem? A) There is a mutation in the -10 consensus sequence, which is required for efficient termination. B) Rho factor has not been added. C) Sigma factor has not been added. D) A hairpin secondary structure has formed at the 3 end of the mRNA, interfering with termination. E) Histones were added prematurely and interfered with termination.

An in vitro transcription system transcribes a bacterial gene but terminates inefficiently. What is one possible problem? A) There is a mutation in the -10 consensus sequence, which is required for efficient termination. B) Rho factor has not been added. C) Sigma factor has not been added. D) A hairpin secondary structure has formed at the 3′ end of the mRNA, interfering with termination. E) Histones were added prematurely and interfered with termination.

An mRNA has the codon 5 UAC 3. What tRNA anticodon will bind to it? A) 5 AUG 3 B) 5 GUA 3 C) 5ATC3 D) 5 CTA 3 E) 5 CAU 3

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule. The type of control illustrated is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) catabolite repression.

Anticodons are found in _____ molecules. A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

Both strands of a DNA molecule are used as a template when which of the following molecules is synthesized? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA? A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production. B) The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein. C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR protein. D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA. E) The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA.

During elongation, an incoming charged tRNA enters at the _____ site of the ribosome. A) peptidyl (P) B) aminoacyl (A) C) exit (E) D) Shine-Dalgarno E) Kozak

During initiation of translation: A) the initiator tRNAmet binds to the A site of a ribosome. B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon. C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble. D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing. E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind.

How many introns are present on a gene that consists of four exons? A) two B) three C) four D) five E) The number cannot be determined from the information provided.

In eukaryotes, tRNAs are A) transcribed in the nucleus and function in the nucleus. B) transcribed in the nucleus but function in the cytoplasm. C) transcribed in the cytoplasm and function in the cytoplasm. D) transcribed in both the nucleus and the cytoplasm and function in the cytoplasm. E) transcribed in the cytoplasm and function in the nucleus.

In eukaryotes, tRNAs are transcribed in: A) the nucleus and function in the nucleus B) the nucleus but function in the cytoplasm C) the cytoplasm and function in the cytoplasm D) both the nucleus and the cytoplasm and function in the cytoplasm E) the cytoplasm and function in the nucleus

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins? A) RNA polymerase I B) RNA polymerase II C) RNA polymerase III D) RNA polymerase IV E) RNA polymerase V

In the absence of tryptophan, what happens to the genes within the trp operon? A) The regulator without tryptophan-binding prevents the genes from being transcribed. B) The regulator dissociates from the operator and structural genes get transcribed. C) Lack of tryptophan increases the level of cAMP, which leads to activation of CAP protein and gene expression. D) The active repressor binds to the operator and genes do not get transcribed. E) The active activator binds to the operator and transcription of structural gene takes place.

In the presence of both lactose and glucose, which of the following occurs with the E. coli lac operon? A) The lacI gene does not produce repressor. B) The cAMP-CAP complex is not available to bind near or at the lac promoter. C) The lacZ and lacY genes are fully expressed. D) Lactose is converted to glucose and galactose. E) Lactose binds to the operator.

Suppose that you perform an experiment where you construct a plasmid that carries a copy of the lac operator region (lacO) but no other part of the lac operon. (The lac repressor can bind to single operator regions.) This plasmid is placed in an E. coli cell, which has a normal copy of the lac operon in its chromosome. When this strain is grown, the number of plasmids reaches about 50 copies per bacterial cell. What is the expected phenotype of such a strain in the absence of glucose? A) The lac operon will be turned on even in the absence of lactose. B) The lac operon will be turned off even in the presence of lactose. C) The lac operon will be regulated normally. D) The lac operon will be initially turned on in the presence of lactose but eventually it will be turned off even though lactose is still present. E) The lac operon will be expressed only if galactose is added to the Moderate.

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation? A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. C) The 5ʹ cap could assist in the identification of stop codons within the mRNA. D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters. E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

The _____ is a type of regulator protein that binds to a region of DNA in the promoter of a gene called the operator and prevents transcription from taking place. A) inducer B) repressor C) activator D) inactivator E) terminator

The calcitonin gene can encode either the hormone calcitonin or a protein called calcitonin-gene-related peptide depending on which 3 cleavage site is used. In the thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to calcitonin production. However, in the brain, the exact same transcript is cleaved after the sixth exon yielding calcitonin-gene-related peptide. This is an example of: A) multiple capping. B) alternative RNA processing. C) polyadenylation. D) environmental influence. E) mutation.

The formation of 1+2 and 3+4 secondary structures of 5 UTR region mRNA from the trp operon is triggered when: A) the tryptophan level inside the bacterial cell is extremely low. B) the tryptophan level inside the bacterial cell is high. C) the repressor protein fails to bind to the operator. D) there is a spontaneous mutation introduced into the 5 UTR. E) the structural gene transcription within the trp operon gets initiated.

The genetic code is NOT universal for: A) prokaryotes, which use a different genetic code than eukaryotes. B) a few mitochondrial genes, which substitute one sense codon for another. C) viruses, which use an entirely different genetic code. D) archaebacteria, which have their own genetic code. E) animal species whose cells are more advanced and complex.

The trp operon in E. coli contains a 5 UTR sequence that is translated into a small polypeptide of 14 amino acids, which includes two tryptophans. If the two trp codons in the 5 UTR of the RNA are changed to serine codons and the resulting cells are starved for tryptophan but not for any other amino acid, what will be the effect of the mutant codons on the operation of the trp operon? A) The trp repressor will be synthesized in greater amounts. B) Expression of the trp structural genes will be less than with a normal trp operon. C) Expression of the trp structural genes will be greater than with a normal trp operon. D) The leader polypeptide will not be synthesized. E) The expression of the operon will not be affected by these mutations.

What is the function of cAMP in regulation of the lac operon? A) It activates a repressor protein. B) It activates an activator protein. C) It inactivates a repressor protein. D) It inactivates an activator protein. E) It causes attenuation.

What may be the consequence of a mutation in the gene that encodes eukaryotic Rat1 exonuclease for eukaryotic transcription mediated by RNA polymerase II? A) The transcription may end prematurely, resulting in shorter mRNA transcript. B) The transcription may not be properly terminated, and RNA polymerase II may not be released. C) The transcription may be delayed indefinitely, which may kill the cell. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene? A) The result would be no change in the protein, since deletions are very rare. B) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. C) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. D) Since exons are not coding regions, no changes in the protein would occur. E) No change in the reading frame would occur due to the degeneracy of the genetic code.

When binding of the inducer to the repressor causes a conformational change, which then prevents the repressor from binding to DNA, the repressor is called a(n) _____ protein. A) coactivator B) allosteric C) structural D) operating E) responsive

When does sigma factor normally dissociate from RNA polymerase? A) After transcription has terminated B) After the process of initiation C) After the addition of nucleosomes D) After the binding of rho E) Following the addition of nucleosomes

When does sigma factor normally dissociate from RNA polymerase? A) after transcription has terminated B) after the process of initiation C) after the addition of nucleosomes D) after the binding of rho E) following the addition of nucleosomes

When this molecule is synthesized, both strands of a DNA molecule are used as a template. A) RNA only B) DNA only C) Both RNA and DNA D) Neither RNA nor DNA

Which of the following RNA molecules are required for the process of translation? A) crRNA B) tRNA C) snRNA D) snoRNA E) siRNA

Which of the following RNA molecules is required for the process of translation? A) crRNA B) tRNA C) snRNA D) snoRNA E) siRNA

Which of the following features is primarily responsible for rho protein to cause termination of transcription? A) Recognizing unstructured RNA B) Helicase activity C) Migrating behind RNA polymerase D) RNA-binding activity E) Polymerase activity

Which of the following features of the rho protein is primarily responsible for its ability to cause termination of transcription? A) recognizing unstructured RNA B) helicase activity C) migrating behind RNA polymerase D) RNA-binding activity E) polymerase activity

Which of the following statements about bacterial mRNA transcripts is TRUE? A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain untranslated regions. B) The Shine-Dalgarno sequence associates with an RNA component in the small subunit of ribosomes. C) Transcription and translation take place sequentially in bacterial cells. D) Most of bacterial genes contain a large number of introns and small number of exons. E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.

Which of the following statements about gene regulation concerning operons is INCORRECT? A) A negative repressible gene is controlled by a regulatory protein that inhibits transcription. B) For a gene under negative repressible control, a small molecule is required to prevent the gene's repressor from binding to DNA. C) For a gene under positive repressible control, the normal state is transcription of a gene, stimulated by a transcriptional activator. D) A regulator gene has its own promoter and is transcribed into an independent mRNA. E) Presence of operons where genes of related functions are clustered is common in bacteria but not in eukaryotes.

Which of the following statements about the formation of the peptide bond between amino acids is INCORRECT? A) The formation of peptide bonds results in the formation of a water molecule. B) The amino group of the first amino acid and the carboxyl group of the second amino acid are involved in forming a peptide bond. C) The carboxyl group of the first amino acid reacts with the amino group of the second amino group to form a peptide bond. D) A polypeptide formed by a series of peptide bonds will result in two distinct free ends, one with a free amino group and the other with a free carboxyl group. E) The number of peptide bonds formed in a polypeptide varies from protein to protein.

Which of the following types of RNA gets translated? A) rRNA B) mRNA C) tRNA D) miRNA E) rRNA, mRNA, and tRNA all get translated

Translation in prokaryotes and eukaryotes has some similarities but differs in important ways. Which of the following statements about similarities and differences in prokaryotic and eukaryotic translation are TRUE? (Select all that apply.) A) Initiation in prokaryotes and eukaryotes begins with a formylmethionine. B) Prokaryotic and eukaryotic ribosomes are different sizes. C) Prokaryotic ribosomes are sensitive to antibiotics that do not affect eukaryotic ribosomes. D) Prokaryotic and eukaryotic large subunits contain two rRNAs. E) Prokaryotic mRNAs are short-lived. Eukaryotic mRNAs vary in their half-life. F) Recognition of the start codon in prokaryotes and eukaryotes involves the 5 cap, the 3 poly(A) tail, and the Kozak sequence near the start codon. G) Prokaryotic initiation, elongation, and termination factors are different from those in eukaryotes. H) Transcription and translation routinely occur simultaneously in prokaryotes and eukaryotes. I) Elongation involves the formation of a peptide bond between the amino acids that are attached to the tRNAs in the P and A sites of the ribosome in both prokaryotes and eukaryotes.

B,C,E,G,I

. The chemical composition of nucleotides is known to include all of the following EXCEPT: A. a sugar—ribose in the case of RNA. B. a sugar—ribose in the case of DNA. C. a phosphate. D. a nitrogenous base, adenine, cytosine, guanine, or thymine. E. Actually, all of these are parts of nucleotides.

B. A ribose in the case of DNA

True

Bacterial cells do not possess pre-mRNA. True or False?

Describe the structure and packing of a bacterial chromosome.

Bacterial cells typically contain a single, circular DNA molecule associated with various proteins to make a compact structure called a nucleoid. Bacteria do not contain histones. Chromosome packing is thought to organize the genetic material into discreet looped domains containing genes that can be selectively activated by relaxing the degree of supercoiling within given domains.

True

Bacterial cells typically possess only one type of RNA polymerase, which catalyzes the synthesis of all classes of bacterial RNA: mRNA, tRNA, and rRNA. True or False?

Double-stranded DNA is, as Watson and Crick proposed, antiparallel. Why does this pose a problem for DNA polymerases? (1pt)

Because DNA polymerase can only synthesize from 5' to 3', meaning that it can only add new nucleotides to the 3' end of a growing chain. Result is that synthesis is continuous on one strand (the leading strand, along which DNA pol moves from 3' to 5') and discontinuous on the other strand (the lagging strand, which has to get looped around so DNA pol can still move 3' to 5').

Explain how transposable elements might play a role in studying gene function.

Because some transposable elements insert randomly throughout the genome and because the element has a known sequence, researchers can use the elements as a way to tag a gene in which that element has caused a disruption in that gene's function.

Before our genome was published, many geneticists expected this number to be much higher. Why? (4 pts)

Because they already knew that human cells produce about 100K proteins.

Bicoid protein is encoded by an autosomal gene and is essential to the development of the anterior part of Drosophila embryos. In the absence of bicoid protein embryos are headless! You cross a male fly in which both bicoid alleles are non-functional (bcd- /bcd- ) to a female that is heterozygous for the mutant allele (bcd- /bcd+). In case you're wondering, they both have heads. a) How is this even possible: how does this mutant male have a head? (1pt)

Bicoid is a maternal effect gene; in order for this homozygous mutant male to have a head his mother had to be heterozygous with one wildtype and one mutant copy of bicoid.

How does a prokaryote divides?

Binary fission

The role of sigma factors in bacterial transcription is to: A. instruct the RNA polymerase where to stop transcription. B. unwind the DNA to initiate transcription. C. bind the consensus sequences to identify the start site for transcription. D. provide the first nucleotide in the nascent RNA molecule. E. None of the above.

Bind the concensus sequence to identify the start site for transcription.

In a cross between two Labrador retrievers, one parent is heterozygous at the two genes that determine coat color in this breed, and the other is homozygous recessive for both genes. a) What are the colors of the parents and what are their genotypes? (0.5pt)

Black: BbEe and Yellow: bbee

You cross these F1 guinea pigs to each other. What phenotypes do you observe in their F2 progeny, what are the relative frequencies of each and what are their genotypes? (1pt)

Blonde and smooth, 25%, bbRR Orange and rough, 25%, BBrr Orange and smooth, 50%, BbRr [Easiest way to work this out would be a 2x2 Punnett square. No credit for treating this as a dihybrid cross]

Some regions of genomes are more prone to mutations than others. Briefly outline how transposable elements might contribute to this non-random distribution of mutation-prone sites. (4 pts)

Both DNA transposons and retrotransposons use specific sequences (direct repeats) as insertion sites. Sites in the host genome that contain sequence recognized by transposons as insertion sites are more vulnerable to transposon-related mutations.

True

By convention: The gene is written 5′-3′ and is the same as the transcript (sense strand) Transcript is complementary and anti-parallel to the template (anti-sense strand). True or False?

How does DNA ensure origins replicate only once/ all at the same time?

By using licensing factors containing DNA helicase. As replication tarts, the licensing factor is removed preventing any additional replication.

A lac operon of genotype lacI- lacP+ lacO+ lacZ+ lacY+ will produce -galactosidase and permease when: A) lactose is present. B) lactose is absent. C) lactose is present or not. D) glucose is present. E) glucose and lactose are both present.

An example of a gene product encoded by a regulatory gene is: A) beta-galactosidase enzyme. B) allolactose. C) repressor protein. D) an operator. E) a terminator.

An in vitro transcription system that contains a bacterial gene does not initiate transcription. What is one possible problem? A) Histones that were on the DNA when it was isolated from E. coli are blocking access to the template. B) There is a mutation in the inverted repeat sequence that prevents a hairpin secondary structure from forming. C) There is a mutation at -10, where a promoter consensus sequence is located. D) Rho factor has not been added. E) TATA-binding protein (TBP) has not been added.

What is Chargaff's rule?

Chargaff's rules state that DNA from any cell of any organisms should have a 1:1 ratio of pyrimidine and purine bases and that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine. A=T and G=C

Assume that a mutation occurs in the promoter for the lacI regulatory gene and this mutation results in a tenfold increase in the transcription of lacI. What would be the expected consequences of such a mutation? A) The lac structural genes will be fully expressed even in the presence of glucose and absence of lactose. B) The lac operon would be expected to be regulated normally. C) The lac structural genes will not be fully induced even in the absence of glucose and presence of lactose. D) The lac structural genes will be partially expressed in the presence of glucose and fully expressed if lactose is also present. E) The lac structural genes will now be fully expressed in the absence of glucose and lactose but not expressed in the absence of glucose and presence of lactose.

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5 splice site 2. Transcription of the DNA template into the pre-mRNA molecule 3. Release of lariat structure 4. Splicing together of exons 5. Transesterification reaction at the branch point adenine A) 1, 2, 3, 4, 5 B) 4, 1, 3, 5, 2 C) 2, 1, 5, 3, 4 D) 3, 5, 1, 2, 4 E) 5, 3, 4, 1, 2

E. coli lac operon control by CAP is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) regulated by riboswitches

For any sequence of nucleotides, how many reading frames are possible? A) 1 B) 2 C) 3 D) 5 E) 10

If a mutation prevents the formation of the antiterminator 2+3 loop in the trp operon, what would be the effect? A) transcription only when tryptophan is absent B) transcription only when tryptophan is present C) constitutive attenuation of transcription D) constitutive transcription E) no effect, as 2+3 loop has no function

In prokaryotes, a group of genes that are usually transcribed following a specific stimulus is organized as an "operon" under a single shared promoter. The result of the transcription of the genes in the presence of a stimulus would generate a: A) crRNA. B) miRNA. C) polycistronic mRNA. D) rRNA. E) siRNA.

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in A) the RNA polymerase that is transcribing the gene. B) the DNA template. C) the RNA that is being transcribed. D) a protein factor that binds to RNA polymerase. E) a protein factor that binds to the RNA that is being transcribed.

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in: A) the RNA polymerase that is transcribing the gene. B) the DNA template. C) the RNA that is being transcribed. D) a protein factor that binds to RNA polymerase. E) a protein factor that binds to the RNA that is being transcribed.

It is possible for a repressor to negatively regulate the expression of an operon because: A) the repressor induces the expression of the inducer by binding to the promoter that comes before the inducer gene. B) one of the structural genes expressed in the operon negatively regulates the repressor. C) the repressor-binding site overlaps the promoter site of the operon, allowing it to physically block the binding of RNA polymerase. D) the repressor-binding site on the DNA overlaps with the translation start site, thereby preventing the transcription. E) the repressor physically blocks where the activator should be binding on the operator region.

Mutations in which of the following regions upstream of the RNA coding sequence are LEAST likely to affect the transcription of a gene? A) -10 consensus sequence within the promoter region B) -35 consensus sequence within the promoter region C) the region between -10 and -35 consensus sequences D) the upstream elements at -40 to -60 position E) Any mutation on the upstream of a gene will definitely have deleterious effect on gene transcription.

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start. A) +1 B) -1 C) -10 D) -25 E) -35

Prokaryotic promoters contain the sequence TATAAT at the position -10 from the transcription start. A) +1 B) -1 C) -10 D) -25 E) -35

RNA molecules that are complementary to particular sequences on mRNA are called: A) complementary RNA. B) sense RNA. C) antisense RNA. D) riboswitches. E) ribozymes.

Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them nonfunctional. Which of the following would be seen MOST immediately in this organism? A) All translation would stop. B) tRNA bases would no longer be modified into rare bases. C) Introns would not be removed from the pre-mRNA. D) mRNA would not be able to bind the 5ʹ cap. E) rRNA would no longer be appropriately processed.

The DNA replication enzyme that most closely resembles RNA polymerase is A) DNA polymerase I. B) DNA polymerase III. C) primase. D) telomerase. E) helicase.

The DNA replication enzyme that most closely resembles RNA polymerase is: A) DNA polymerase I. B) DNA polymerase III. C) primase. D) telomerase. E) helicase.

The function of aminoacyl-tRNA synthetases is to: A) transcribe tRNA genes. B) match tRNA anticodons and mRNA codons at the ribosome. C) attach appropriate amino acids to corresponding tRNAs. D) form the peptide bond between amino acids at the ribosome. E) synthesize and transport amino acids to the ribosomes.

The polymerase that synthesizes this molecule uses DNA as a template and synthesizes new strands from 5′ to 3′. A) RNA only B) DNA only C) Both RNA and DNA D) Neither RNA nor DNA

The polymerase that synthesizes which of the following molecules uses DNA as a template and synthesizes new strands from 5 to 3? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Guide RNAs are needed in: A) transcription. B) translation. C) RNA interference. D) RNA editing. E) RNA splicing.

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it. B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site. C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site. D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site. E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

There are enzymes called aminoacyl-tRNA synthetases that attach tRNAs to the appropriate amino acid. Assume that the aminoacyl-tRNA synthetase that attaches tryptophan to its tRNA in an E. coli mutant strain is only partially active. It is active enough for the strain that carries it to be viable but is much less active than that of wild-type cells. What would be the expected effect of this mutation on attenuation in the trp operon? A) Pairing of regions 3 and 4 in the 5 UTR of the RNA will be enhanced so attenuation will increase in the presence of tryptophan. B) Pairing of regions 2 and 3 in the 5 UTR of the RNA will be decreased so attenuation will increase in the presence of tryptophan. C) Pairing of regions 3 and 4 in the 5 UTR of the RNA will be decreased so attenuation will decrease in the presence of tryptophan. D) Attenuation will not change but the trp repressor will be more active and the transcription of the trp operon structural genes will be decreased in the presence of tryptophan. E) Attenuation will be decreased in the absence of tryptophan but will be enhanced in the presence of tryptophan.

This molecule is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds. A) RNA only B) DNA only C) Both RNA and DNA D) Neither RNA nor DNA

Translating an mRNA requires two other types of RNA: A) tRNA and mRNA. B) tRNA and miRNA. C) tRNA and rRNA. D) rRNA and siRNA. E) snRNA and snoRNA.

What do group I and group II introns have in common? A) Both are found in mitochondrial genes. B) Both are found in bacteriophages. C) Both are known to be self-splicing introns. D) Both are found in protein-coding genes of chloroplasts. E) Both are frequently found in eukaryotic genes.

What types of bonds are created between nucleotides during the process of transcription? A) Ionic B) Oxygen C) Phosphodiester D) Hydrogen E) Both C and D

What types of bonds are created between nucleotides during the process of transcription? A) ionic B) oxygen C) phosphodiester D) hydrogen E) both phosphodiester and hydrogen

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron? A) A shorter than normal protein would be produced. B) Replication would be inhibited. C) A longer than normal mRNA would be produced. D) A longer than normal DNA would be produced. E) Transcription would terminate prematurely.

What would happen to the lac operon in the absence of allolactose? A) The structural genes within the lac operon will be constitutively transcribed. B) The activator protein will be bound to the operator, which will turn on the structural gene behind it. C) The repressor regulator protein binds to the operator and prevents the transcription of the structural gene. D) The catabolite activator protein becomes inactivated and no transcription occurs. E) The cAMP level rises in the absence of allolactose, which in turn inactivates the transcription.

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing. A) 5 base B) middle base C) 3 base

Which class of RNA is MOST abundant in cells? A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

Which mechanism allows for more than one polypeptide to be encoded by a single gene? A) regulated transcription B) RNA interference C) alternative RNA processing D) self-splicing of introns E) RNA methylation

Which of the following DNA-binding motifs are composed of three alpha helices? A) zinc-finger motif B) leucine-zipper motif C) homeodomain motif D) helix-turn-helix motif E) helix-loop-helix motif

Which of the following consensus sequences are NOT found in nuclear introns? A) GU at the 5 splice site at the beginning of the intron B) AG at the 3 splice site at the end of the intron C) CCA at the 3 site downstream of the branch point D) a at the lariat branch point site E) 3 CAGG consensus sequence at the 3 splice site

Which of the following events is NOT part of prokaryotic translation initiation? A) IF-3 separates ribosome subunits so that a small subunit can bind mRNA through base pairing of the 16S rRNA and the Shine-Dalgarno sequence on the mRNA. B) An initiator tRNAformylmet binds the initiation codon, with the help of IF-1 and IF-2 complexed with GTP. The tRNAformylmet is positioned in the P site. C) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. D) IF-3 dissociates, allowing a large subunit to bind the 30S initiation complex.

Which of the following is NOT required during the process of tRNA charging? A) amino acid B) tRNA C) GTP D) ATP E) aminoacyl-tRNA synthetase

Which of the following is observed in prokaryotes but not in eukaryotes? A) UGG is an example of a stop codon only found in prokaryotes. B) An mRNA can be translated by only one ribosome at a time in prokaryotes. C) The 5 ́ end of a prokaryotic mRNA can be translated while the 3 ́ end is still being transcribed. D) Translation does not require any protein factors in prokaryotes. E) In prokaryotes, ribosomes move along an mRNA in the 3 ́ to 5 ́ direction.

Which of the following mechanisms specifically allows detection and rapid degradation of mRNA containing a premature termination codon? A) RNA interference B) no-go decay C) nonsense-mediated mRNA decay D) transfer-messenger RNA mediated ribosomal removal E) nonstop mRNA decay

Which of the following molecules is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following statements are TRUE regarding transcription in most organisms? A) All genes are transcribed from the same strand of DNA. B) Both DNA strands are used to transcribe a single gene. C) Different genes may be transcribed from different strands of DNA. D) The DNA template strand is used to encode double stranded RNA. E) The DNA nontemplate strand is used to encode single stranded RNA.

Which of the following statements is TRUE regarding transcription in most organisms? A) All genes are transcribed from the same strand of DNA. B) Both DNA strands are used to transcribe a single gene. C) Different genes may be transcribed from different strands of DNA. D) The DNA template strand is used to encode double-stranded RNA. E) The DNA nontemplate strand is used to encode single-stranded RNA.

Which of the following statements regarding gene structure is TRUE? A) The amino acid sequence of a polypeptide can be precisely predicted by the nucleotide sequence of the gene that encodes it. B) The number of introns found in organisms is species specific. C) The number of exons and introns generally correlates to the complexity of the organisms. D) Intron cleavage and exon splicing are both mediated exclusively by protein enzymes. E) The number of exons is always less than the number of introns in a gene.

Which one of the following statements regarding eukaryotic transcription is NOT true? A) Eukaryotic transcription involves a core promoter and a regulatory promoter. B) There is no one generic promoter. C) A group of genes is transcribed into a polycistronic RNA. D) Chromatin remodeling is necessary before certain genes are transcribed. E) There are several different types of RNA polymerase.

siRNAs and miRNAs function in which of the following processes? A) transcription B) translation C) RNA interference D) RNA editing E) RNA splicing

15. Which of the following occurs during prometaphase? a. The chromosomes align in a single plane. b. DNA is replicated. c. Microtubules attach to the kinetochores. d. Mitotic spindles form. e. The two sister chromatids separate.

C. Microtubules attach to the kinetochores.

Write a ten base sequence that could be described as a CpG island. (1pt)

CGCGCGCGCG

What is the function of dna polymerase 1 in DNA replication?

Catalyzes the Template-Directed Polymerization of Nucleotides into Duplex DNA in a 5´→3´ Direction.

What is a eukaryote?

Cell with a nucleus

Pick one and outline the likely consequences of a mutation that changes the tertiary structure of the TF protein in this domain. (1pt)

Change in DNA binding domain would most likely reduce affinity of TF for target sequences, resulting in less binding and therefore less effect on transcription of genes it regulates; could potentially increase affinity and have opposite effect Change in trans-activating/repressing domain would most likely reduce strength/frequency of interactions with chromatin or transcription associated proteins and therefore result in less effect on transcription of genes it regulates; could potentially increase interactions w/chromatin or proteins and have opposite effect

Which one of the following pairings between the subdiscipline of genetics and the phenomenon is incorrect? a. Evolution—Population genetics b. Gene regulation—Molecular genetics c. Allelic frequency alteration—Population genetics d. Arrangement of genes on chromosome—Transmission genetics e. Chemical nature of the gene—Transmission genetics

Chemical nature of the gene- Transmission genetics.

Chromatin is composed of repeating nucleosomes that consist of about 200 base pairs of DNA wrapped around a histone octamer complex. DNA wrapped around the octamer core is protected from endonuclease degradation. However, because the linker DNA between adjacent nucleosomes is exposed, it can be cleaved by endonucleases. Thus, chromatin digested by endonucleases generates 200 base-pair-long fragments of DNA.

B) transcriptionally active D) DNAse I insensitive

Chromosomal puffs observed on polytene chromosomes indicate the region that is most likely _____. (Select all that apply.) A) transcriptionally inactive B) transcriptionally active C) DNAse I sensitive D) DNAse I insensitive

True

Cleavage cuts the pre-mRNA into two pieces: the mRNA that will eventually encode the protein and another piece of RNA that has its 5′ end trailing out of the RNA polymerase. True or False?

What percent is derived from transposable elements?

Close to 50%

Codons that specify the same amino acid are said to be... a. wobbly b. isoaccepting c. hypothetical d. synonymous e. anonymous

Synonymous

Codons that specify the same amino acid are said to be...?

What is the function of DNA poly E?

Complete leading strand synthesis

What is the function of DNA poly D?

Completes lagging strand replication.

Explain how bacterial resistance to antibiotics can be efficiently transmitted by transposons.

Composite transposons can carry antibiotic resistance genes and can be transferred via conjugation, transduction (phage infection), and transformation. Transposons can also excise and insert into plasmid elements, which can be subsequently transferred by various means to different cells. Transposons can undergo homologous recombination with plasmids or other DNA sites within a cell containing the same transposon sequence, and be transferred via conjugation, transduction, and so forth. Under the selective pressure antibiotic treatment, resistance will, of course, be highly advantageous to those bacterial cells containing resistance genes, and thus antibiotic resistance can spread very rapidly in bacterial populations.

The chromosomal theory of inheritance

Connected the behavior of chromosomes during meiosis to Mendel's principles of random segregation and independent assortment

. Models of DNA replication include: A. conservative, in which the original DNA strands are together at the conclusion of the process. B. semi-conservative, in which the original DNA strands are together at the conclusion of the process. C. dispersive, in which each double helix contains one old strand and one new strand of DNA. D. disruptive, in which each double helix contains one old strand and one new strand of DNA. E. None of the above.

Conservative

If the DNA strand 5ʹ-GTACCGTC-3ʹ were used as a template, what would be the sequence of the transcribed RNA? A) 5-GUACCGUC-3 B) 5-GACGGTAC-3 C) 5-CAUGGCAG-3 D) 5-GACGGUAC-3 E) 5-GUCGGUAC-3

B) family.

Copies of a gene that arose by gene duplication are part of a gene: A) complex. B) family. C) tandemoplex. D) structure. E) chromosome.

A bacterial protein is encoded by the following mRNA sequence: 5-AUGGUGCUCAUGCCCTAA-3. The second methionine codon (AUG) in this mRNA sequence will: A) serve as the initiation codon. B) encode N-formylmethionine. C) encode methionine that will eventually be removed. D) encode unformylated methionine. E) be skipped as the translation progresses.

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail? A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail. B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA. C) The poly(A) tail is important for proper nuclear export of the mRNA. D) The poly(A) tail at the 3 end translates to a long stretch of repeated amino acids. E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.

A mutant E. coli strain is found that synthesizes -galactosidase in the absence of glucose whether or not lactose is present. What two mutations might lead to this outcome? A) lacIs mutation or lacOc mutation B) lacP- mutation or lacI- mutation C) lacP- mutation or lacOc mutation D) lacI- mutation or lacOc mutation E) lacP- mutation or lacIs mutation

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells? A) lacI+ lacP+ lacO+ lacZ+ lacY- lacA+ B) lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ C) lacl+ lacP+ lacO+ lacZ+ lacY+ lacA+ D) lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ E) lacI- lacP+ lacO- lacZ+ lacY+ lacA-

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy? A) The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. B) If the protein sequence was not affected, no lethal phenotype manifested. C) The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change). D) The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. E) All mutations that cause a change in DNA sequence result in a lethal phenotype.

Choose the BEST consensus sequence for the following set of nucleotide sequences. TAAGACGCCATGA AAAGTCGCAATCA AAAGTTCCGTTCA AGAGTTGCTATCA AGAGTTGCAA TCA A) Y ACGTRGCA TG/CA B) AYTRTRGCATGA C) AAAGTNGANTCA D) ARAGTYGCNTCA E) ACTNCGYTGARA

Codons that specify the same amino acid are said to be: A) wobbly. B) isoaccepting. C) hypothetical. D) synonymous. E) anonymous.

During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5-5 bond 2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the pre-mRNA 3. Methylation at the 2 position of the sugar in the second and the third nucleotides 4. Methylation at position 7 of the terminal guanine base A) 1, 2, 3, 4 B) 2, 4, 1, 3 C) 4, 1, 3, 2 D) 2, 1, 4, 3 E) 3, 2, 4, 1

During transcription, which parts of a DNA molecule are transcribed into RNA? A) All of the nucleotides in DNA on both strands B) All of the nucleotides on one strand of DNA C) Only parts of the DNA that encode mRNA D) Only regions of the DNA that contain genes E) Only regions of the DNA that encode rRNA

If the following DNA strand were used as a template, what would the sequence of an RNA be? 5′ GTACCGTC 3′ A) 5′ GUACCGUC 3′ B) 5′ GACGGTAC 3′ C) 5′ CAUGGCAG 3′ D) 5′ GACGGUAC 3′ E) 5′ GUCGGUAC 3′

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT? A) Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. B) The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. C) Colinearity generally holds true for the coding regions of prokaryotic viral genes. D) The vast majority of eukaryotic genes follow the concept of colinearity. E) The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

In a transcription reaction, two phosphate groups are cleaved from the incoming A) deoxyribonucleoside diphosphate. B) deoxyribonucleoside triphosphate. C) ribonucleoside diphosphate. D) ribonucleoside triphosphate.

In a transcription reaction, two phosphate groups are cleaved from the incoming: A) deoxyribonucleoside diphosphate. B) deoxyribonucleoside triphosphate. C) ribonucleoside diphosphate. D) ribonucleoside triphosphate. E) ribozyme.

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide. A) transcription; translation B) polyadenylation; RNA transport C) DNA methylation; chromatin condensation D) alternative processing; RNA editing E) gene silencing; RNA interference

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result? A) Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. B) Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. C) Transcription would not occur as the transcription factors would not be able to bind to the promoter. D) Translation would not occur as the ribosome would not be able to bind to the mRNA. E) Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication.

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? A) It blocks access of RNA polymerase to the promoter until removed by general transcription factors. B) It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. C) It modifies histones so that nucleosomes can be removed from DNA for transcription. D) It bends and partly unwinds DNA at a promoter. E) It creates a phosphodiester bond between the nucleotides.

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? A) It blocks access of RNA polymerase to the promoter, until removed by general transcription factors. B) It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. C) It modifies histones so that nucleosomes can be removed from DNA for transcription. D) It bends and partly unwinds DNA at a promoter. E) It creates a phosphodiester bond between the nucleotides.

The spliceosome is a large, ribonucleoprotein complex located in the: A) cytoplasm. B) endoplasmic reticulum. C) Golgi aparatus. D) nucleus. E) nucleolus.

The trp operon is known to operate by both negative repressible regulation of operator and attenuation. Which of the following statements does NOT support the reason as to why dual control exists to regulate the operon? A) The repression alone is never complete, and some transcription can be initiated. B) Combined mechanism provides a much finer tuning of tryptophan synthesis regulation. C) Attenuation and repression allow the cell to more sensitively respond to the tryptophan level. D) It is most likely due to the fact that the attenuation is the evolutionary relic, which by accident has remained. E) Repression responds to the cellular levels of tryptophan, while attenuation responds to the number of tRNA charged with tryptophan.

This molecule is made of nucleotides joined by phosphodiester bonds that connect the 2′ OH to the 5′ phosphate. A) RNA only B) DNA only C) Both RNA and DNA D) Neither RNA nor DNA

What is the similarity between miRNAs, siRNAs, and piRNAs? A) All three types originate from transposons or viruses and are found in all organisms. B) They all target and degrade the gene from which they were transcribed. C) All three are generated from a single-stranded RNA that gets cleaved. D) All three can influence chromatin structure, which, in turn, can influence gene expression. E) All three associate with Piwi proteins in order to mediate RNA degradation.

When a structural gene is under positive inducible control, what would be the result of a mutation that eliminates the activator protein? A) The structural gene will be constitutively expressed due to the lack of inducible control. B) The transcription of the structural gene will not be affected, as an activator is not required. C) The mutation will lead to activation of a repressor upon the lack of an activator protein, which will block transcription. D) Since transcription will require an activator protein, the transcription will be turned off. E) More cAMP will be produced in a cell to compensate for the lack of an activator protein.

When studying a plant's protein production, a scientist found two different proteins. The first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one only contained amino acids from exons from 1, 2, and 3. Which of the following is MOST likely responsible for this difference? A) a mutation in the gene that encodes an miRNA B) posttranslational modification C) RNA editing D) alternative RNA processing E) a mutation in the gene that encodes a snoRNA

Whereas the nucleotide strand used for transcription is termed the _____, the nontranscribed strand is called the _____. A) promoter; terminator B) terminator; promoter C) transcription apparatus; TATA box D) template strand; nontemplate strand E) nontemplate strand; template strand

Whereas the nucleotide strand used for transcription is termed the _______, the nontranscribed strand is called the _________. A) promoter; terminator B) terminator; promoter C) transcription apparatus; TATA box D) template strand; nontemplate strand E) nontemplate strand; template strand

Which activity is NOT associated with DNA polymerases? a. Ability to attach a DNA nucleotide to the 3′ end of previously incorporated DNA nucleotide b. Ability to excise a newly incorporated nucleotide that does not match the template strand c. Ability to "read" a template strand 3′ to 5′ and synthesize a complementary strand d. Ability to synthesize a DNA from scratch without a primer e. Ability to synthesize new DNA in a 5′ to 3′ direction

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA? A) regulated transcription B) RNA interference C) alternative RNA processing D) RNA editing E) colinearity

Which molecule allows the release of mRNA from a stalled ribosome? A) miRNA B) snoRNA C) incRNA D) tmRNA E) siRNA

Which of the following classes of RNAs is unique to eukaryotes? A) messenger RNA (mRNA) B) ribosomal RNA (rRNA) C) transfer RNA (tRNA) D) small nuclear RNAs (snRNAs) E) CRISPR RNAs (crRNAs)

Which of the following elements would NOT be found in an mRNA molecule? A) protein-coding region B) 3 untranslated region C) 5 untranslated region D) promoter E) start and stop codons

Which of the following facts about riboswitches is INCORRECT? A) Binding of certain molecules to the riboswitches results in the formation of specific secondary structures of mRNA. B) Certain molecules that bind to riboswitches may act as repressors or inducers of transcription. C) Riboswitches are not only found in bacterial cells but also in archaeal, fungal, or plant cells. D) Riboswitches are typically found in the 3 UTR of the mRNA structure. E) The secondary structure that forms riboswitches typically contains a base stem and several branching hairpins.

Which of the following intron types requires spliceosomes for removal? A) group I intron B) group II intron C) group III intron D) nuclear pre-mRNA E) tRNA

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule? A) start codon B) promoter C) exons D) introns E) stop codon

Which of the following molecules is made of nucleotides joined by phosphodiester bonds that connect the 2 OH to the 5 phosphate? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following observations supports the notion that the gene is simply a set of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide? A) Alternative splicing—a single gene can yield multiple mRNA and protein products. B) A single ribosomal RNA transcript can liberate several RNA molecules via further processing. C) RNAs can be the functional product of a gene without being translated into a protein product. D) Within a protein coding region, each codon represents a specific amino acid that will be linked to form a polypeptide. E) Regulatory elements are part of a gene that regulate timing, degree, and specificity of gene expression but are not transcribed.

Which of the following processes does NOT support the observation that the amino acid sequence of a protein may not be the same as that encoded by its gene? A) RNA editing B) alternative splicing C) multiple 3 cleavage sites D) 5 capping E) errors that occurred during transcription

Which of the following statements about group I and group II introns is NOT true? A) Both group I and II introns form elaborate and characteristic secondary structures with loops. B) The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing. C) The length of group I and group II introns is much longer than the exons within the structures. D) Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes. E) Both group I and group II introns are both found in bacterial genes.

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT? A) All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure. B) Only eukaryotic proteins undergo alterations following translation. C) Amino acids within a protein may be modified by molecular chaperones. D) Signal sequence of a protein helps direct a protein to a specific location within the cell. E) Attachment of a protein called ubiquitin directs proteins to enter into the nucleus.

Which of the following statements about ribosomes and ribosomal RNA is NOT true? A) Ribosomes typically contain about 80% of the total cellular RNA. B) Ribosomal RNA is processed in both prokaryotes and eukaryotes. C) In eukaryotes, genes for rRNA are usually present within tandem repeats. D) Each ribosomal RNA component is encoded by a separate gene. E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the nucleus.

Which of the following statements about translation is CORRECT? A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation. B) The first three bases at the 5 end of an mRNA are the AUG at which translation begins. C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end. D) In eukaryotes, the 5 cap and the 3 poly(A) tail are involved in translation initiation. E) Ribosomes move along an mRNA in the 3 to 5 direction.

Which one of the following codons codes for a different amino acid from the rest? A) CUU B) CUC C) UUA D) UUU E) CUA

Which statement about RNA polymerase is NOT true? A) RNA polymerase adds a ribonucleotide to the 3' end of a growing RNA molecule. B) RNA polymerase binds to a promoter to initiate transcription. C) During transcription of a gene, RNA polymerase reads only one strand of DNA. D) RNA polymerase reads a template strand of DNA 5' to 3'. E) RNA polymerase has many subunits.

Mutations occurred in one of the inverted repeat sequences within the rho-independent terminator sequence of a bacterium. What would likely be the consequence of this mutation? (Select all that apply.) A) The transcription may end prematurely. B) The transcription may not be initiated at all. C) The transcription may be delayed. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

D, E

Indicate which of the following statements is TRUE. a. There are three phosphates between each sugar in a molecule of DNA. b. A-, B-, and Z-form DNA are all right-handed helixes. c. There are three hydrogen bonds between AT pairs. d. Ribose sugars have a hydroxyl on the 2′ carbon. e. All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25%

D. Ribose sugars have a hydroxyl on the 2' carbon.

What is a form of recombination in bacteria that involves the F plasmid? A. Transduction B. Transformation C. Tranfection D. Conjugation

D. conjugation

S (synthesis) phase

DNA is replicated

What is the function of DNA ligase in DNA replication?

DNA ligase is an enzyme that repairs irregularities or breaks in the backbone of double-stranded DNA molecules.

What enzyme seals the nick left between new 3' OH groups and new 5' phosphate groups?

DNA ligase.

Which pol removes incorrectly paired nucleotides?

DNA pol I

Name and briefly describe two ways in which mutations are repaired. (2pts)

DNA pol proofreading and endonuclease activity: fixes mismatched bases Postreplication repair: repairs damaged DNA (e.g. pyrimidine dimers) during replication using complementary strand Mismatch repair: corrects mismatched bases that violate A-T, G-C pairing Excision repair: cut and paste systems that remove and replace mismatched or damaged bases • Base excision repair: removes/replaces single bases • Nucleotide excision repair: removes/replaces damaged/mismatched base/s + surrounding bases DSB repair: break repaired using sister chromatid as template.

What is the function of DNA polymerase 3 in DNA replication?

DNA polymerase III will then synthesize a continuous or discontinuous strand of DNA, depending if this is occurring on the leading or lagging strand of the DNA. DNA polymerase III has a high processivity and therefore, synthesizes DNA very quickly.

In Lymnea snails, the direction of shell coiling (sinistral or dextral) is determined by a gene with two alleles, D and d. Dextral snails are produced when the D protein product is present in the fertilized egg; without it snails are sinistral. In a cross in which a dextral snail of unknown genotype contributes the eggs and the genotype of the snail contributing the sperm is unknown, all F1 progeny are dextral. These F1 snails are self-fertilized, resulting in an F2 generation that is 50% sinistral and 50% dextral. What were the genotypes of the original p

Dd (egg donor) x dd (sperm donor) • To get any sinistral F2 snails there had to be dd F1 snails so the original egg donor had to have at least one d and since all F1s were dextral the original egg donor also had to have at least one D. So that parent was Dd. • You know that the sperm donor had to also have at least one d (or there wouldn't be dd F1s) and, since 50% of the F2 snails are sinistral, 50% of the F1s were dd. That percentage is most consistent with the original sperm donor being dd.

The Meselsohn-Stahl experiment: A. demonstrated the conservative nature of DNA replication. B. relied on density gradient centrifugation to separate old and new molecules based on their use of different isotopes of carbon. C. demonstrated the dispersive nature of DNA replication. D. demonstrated that replicated double helices consisted of one old and one new strand. None of the above.

Demonstrated the dispersive nature of DNA replication

What does DNA stand for? (2 pts)

Deoxyribonucleic acid

Name one major difference and two major similarities between siRNAs and miRNAs. (2pts)

Differences: • miRNAs always transcribed from miRNA genes in nucleus; siRNAs can be products of viral infection or transposable element expression in nucleus • siRNAs can have negative effects on host cells; miRNAs function to regulate gene expression and do not have negative effects Similarities: • In cytoplasm, both are short, double-stranded RNA • Both are recognized and processed by enzyme complex, Dicer • Both can inhibit mRNA translation or trigger mRNA degradation (RISC: RNA-induced silencing complex) • Both can repress transcription via RITS (RNA-induced transcription silencing complex) targeting to promoters or other regulatory regions

Which of the following statements are TRUE regarding transcription in most organisms? a. All genes are transcribed from the same strand of DNA. b. Both DNA strands are used to transcribe a single gene. c. Different genes may be transcribed from different strands of DNA. d. The DNA template strand is used to encode double stranded RNA. e. The DNA nontemplate strand is used to encode single stranded RNA.

Different genes may be transcribed from different strand

What if you instead started with homozygous parents that were blonde and rough-coated and orange and smooth-coated, would your F2 phenotypic ratios be the same or different? Be sure to show how you arrived at this answer. (1pt)

Different. [Again, 2x2 Punnett square would be easiest. This would show 75% orange/smooth and 25% blonde/rough]

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the: A) rho factor. B) TFIID. C) TBP. D) omega subunit. E) sigma factor.

RNA-mediated repression is carried out by: A) nonsense RNA. B) sense RNA. C) antisense RNA. D) riboswitches. E) ribozymes.

The human gene encoding calcitonin contains six exons and five introns and is located on chromosome 11. The pre-mRNA transcript from this gene can generate either calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner. Calcitonin produced from the thyroid gland is 32 amino acids long and functions to regulate the calcium while CGRP, which contains 37 amino acids, is produced by the brain cells and involved in transmission of pain. Which of the following processes makes production of two functionally and structurally different proteins from the same gene possible? A) self-spicing introns B) differential transcription C) alternative replication D) 5 capping and polyadenylation E) alternative RNA processing

The information needed during RNA editing comes MOST directly from: A) pre-mRNA. B) mRNA. C) rRNA. D) tRNA. E) guide RNA.

c) Does the blue eye allele have a dominant or recessive effect on eye color? (0.5pt

Dominant (If blue-eyed females are heterozygous then the effect of the allele on eye color has to be dominant. Note that this problem is very similar to the agouti/yellow example in mice. The difference here is that the lethal effect is only seen in males, which strongly suggests that the gene is on the X chromosome)

What is allele expression?

Dominant or recessive.

Aminoacyl

During elongation, an incoming charged tRNA enters at the ___ site of the ribosome.

During elongation, an incoming charged tRNA enters at the ______ site of the ribosome. a. peptidyl b. aminoacyl c. exit d. shine-delgarno e. kozak

Small

During initiation, the ___ subunit is the first part of the ribosome to associate with the mRNA.

During initiation, the ______ subunit is the first part of the ribosome to associate with the mRNA. a. small b. large c. intermediary d. secondary e. tertiary

when do Non-sister chromatids undergo homologous recombination

During meiosis prophase I

A Holliday structure is formed

During recombination

Nitrogenous Bases

During transcription which parts of DNA molecule are transcribed into RNA?

During transcription, which parts of a DNA molecule are transcribed into RNA? a. ALL of the nucleotides in DNA on both strands b. ALL of the nucleotides on one strand of DNA c. Only parts of the DNA that encode tRNA d. Only regions of the DNA that contain genes e. Only regions of the DNA that encode rRNA

A mutation occurs in the trp operon DNA of E. coli and results in the change to the two UGG tryptophan codons in the 5 UTR of the RNA to UAG stop codons. What effect will this mutation be expected to have on the regulation of this mutant trp operon compared to a wild-type operon? A) In the presence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. B) In the absence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. C) In the presence of tryptophan, the repressor will bind to the operator/promoter region with the mutant operon more strongly than with a wild-type operon. D) In the absence of tryptophan, RNA polymerase will not bind to the operator/promoter region with the mutant operon. E) In the presence of tryptophan, transcription of the structural genes will be enhanced compared with a wild-type operon.

A partial diploid E. coli cell of lacI+lacP+lacOc lacZ-lacY-/ lacI- lacP+ lacO+lacZ-lacY+ genotype will synthesize: A) both lacZ and lacY gene products in the absence of lactose. B) neither lacZ nor lacY gene products in the presence of lactose. C) lacZ but not lacY gene product in the presence of lactose. D) lacY but not lacZ gene product in the absence of lactose. E) lacY but not lacZ gene product in the presence of lactose.

A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell, she inserts an miRNA that is complementary to a portion of the ABC mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of ABC protein made. B) There will be a decrease in the amount of ABC protein made. C) There will be an increase in the transcription of the ABC gene. D) There will be a decrease in the transcription of the ABC gene. E) No change will result from the insertion of the miRNA.

An mRNA has the stop codon 5 UAA 3. What tRNA anticodon will bind to it? A) 5ATT3 B) 5 AUC 3' C) 5' ACU 3 D) 5 UUA 3 E) none

Below is a list of steps in the processing of ribosomal RNAs. Please select the choice that lists the steps in the CORRECT sequential order. 1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars 2. Transcription of the rRNA precursors from DNA 3. Cleavage of precursor rRNA 4. Individual rRNA molecules ready for ribosome assembly 5. Trimming of precursor rRNA A) 3, 1, 2, 5, 4 B) 2, 3, 4, 5, 1 C) 4, 2, 3, 1, 5 D) 1, 3, 5, 4, 1 E) 2, 1, 3, 5, 4

If a splice site were mutated so that splicing did not take place, what would be the effect on the amino acid sequence? A) It would be shorter than normal. B) It would be longer than normal. C) It would be the same length but would encode a different protein. D) It would be unable to fold into its correct structure. E) It depends on the mutant mRNA sequence.

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the A) rho factor. B) TFIID. C) TBP. D) omega subunit. E) sigma factor

The sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5... GGAGACUCGUUGUAUU... 3. What would be the effect on the amino acid sequence? A) There would be no effect on the amino acid sequence. B) This is an insertion mutation so there would be a premature stop codon. C) The amino acid sequence would be asn-thr-thr-thr-leu. D) The amino acid sequence would be thr-ser-tyr-leu-asn. E) The amino acid sequence would be gly-asp-ser-leu-tyr.

Transcriptional control that acts by regulating the continuation of transcription is called: A) riboswitching. B) antitermination. C) negative control. D) operator mutation. E) attenuation.

Unlike DNA replication, transcription in bacteria does not involve: A. initiation. B. elongation. C. termination. D. two strands. E. Actually, it involves all of these.

What is the function of general transcription factors? A) They are DNA sequences to which RNA polymerase binds. B) They direct nucleosome assembly. C) They bind to regulatory promoters to increase the rate of transcription. D) They bind to enhancers to allow minimal levels of transcription. E) They are a part of the basal transcription apparatus

What is the function of peptidyl transferase activity? A) It charges tRNAs. B) It acetylates the end of a protein after translation. C) It cleaves the polypeptide from the last tRNA during termination. D) It moves ribosomes along mRNA during translation. E) It forms peptide bonds.

What is the minimum number of different aminoacyl-tRNA synthetases required by a cell? A) 64, one for each codon B) 61, one for each sense codon C) 30, one for each different tRNA D) 50, one for each different tRNA E) 20, one for each amino acid

Which amino acid is coded by the stop codons in most organisms? A) met B) pro C) trp D) cys E) none

Which of the following E. coli strains will synthesize permease in the presence of lactose and absence of glucose? A) lacI- lacP- lacO+ lacZ+ lacY+ B) lacIs lacP- lacO+ lacZ- lacY+/lacI+ lacP+ lacO+ lacZ+ lacY+ C) lacI- lacP+ lacO+ lacZ+ lacY- D) lacI- lacP+ lacOc lacZ-lacY-/lacI+ lacP- lacO+ lacZ- lacY+ E) lacI+ lacP+ lacOc lacZ+ lacY-/lacI- lacP+ lacO+lacZ- lacY+

Which of the following does NOT enhance the binding of the ribosome to the 5 ́ end of the mRNA? A) 5 ́ cap B) 3 ́ poly(A) tail C) cap-binding proteins D) poly(A) proteins E) enhancer

Which of the following is a sequence of DNA where transcription is initiated? A) Hairpin loop B) TBP C) Initiator D) Sigma factor E) Promoter

Which of the following is a sequence of DNA where transcription is initiated? A) hairpin loop B) TBP C) initiator D) sigma factor E) promoter

Which of the following phenomena is NOT affected by the presence of alternative splicing? A) speciation B) development C) organismal complexity D) tissue specificity E) RNA interference

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript? A) prokaryotic 16S rRNA B) prokaryotic 23S rRNA C) eukaryotic 18S rRNA D) eukaryotic 5.8S rRNA E) eukaryotic 5S rRNA

Which of the following regulatory RNA types is different from the rest in terms of its length? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

Which of the following secondary structures causes attenuation of structural genes of the trp operon? A) 1+2 loop B) 1+3 loop C) 2+4 loop D) 2+3 loop E) 3+4 loop

Which of the following statements CORRECTLY describes the concept of alternative splicing? A) Eukaryotic gene and protein sequences are precisely colinear. B) With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences. C) Every other intron is removed in an alternate manner to generate a functional mRNA transcript. D) Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus. E) Multiple protein products are often produced from single eukaryotic genes.

Which of the following statements about DNA-binding proteins is NOT true? A) Specific amino acids within the motif form hydrogen bonds with DNA. B) These proteins can affect the expression of a gene. C) Most DNA-binding proteins bind dynamically. D) Some of these proteins incorporate a metal ion such as zinc. E) Once bound, most of DNA-binding proteins remain on DNA permanently.

Which of the following statements about regulation of gene expression is CORRECT? A) An inducible gene is transcribed when a specific substance is absent. B) A gene is any DNA sequence that is transcribed into an mRNA molecule only. C) All genes are transcribed at all times as long as they have a functional promoter. D) The regulation of gene expression is the same in both eukaryotes and prokaryotes. E) The regulation of gene expression is critical for the control of life processes in all organisms.

Which of the following statements describes the "wobble" rules CORRECTLY? A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. B) The number of the genetic code exceeds the number of amino acids available in the cell. C) There are multiple tRNAs that may bind to the same amino acids. D) There are multiple codons that may code for the same amino acids. E) The third base pairing between the tRNA and mRNA is relaxed.

Which of the following statements is FALSE regarding TFIID? A) It contains a TATA binding protein. B) It aids in initiation of transcription. C) It binds to the core promoter. D) It binds to the TATA box E) It is a transcriptional activator

Which of the following statements is FALSE regarding TFIID? A) It contains a TATA-binding protein. B) It aids in initiation of transcription. C) It binds to the core promoter. D) It binds to the TATA box. E) It is a transcriptional activator protein

Which of the following statements is NOT true? A) Both DNA and RNA are synthesized in a 5′ to 3′ direction. B) During RNA synthesis, the DNA template strand is read in a 3′ to 5′ direction. C) During RNA synthesis, new nucleotides are added to the 3′ end of the growing RNA molecule. D) RNA polymerase has 5′ to 3′ polymerase activity. E) RNA molecules have the same 5′ to 3′ orientation as the DNA template strands to which they are complementary.

_____ probably began the evolution of life on Earth. A) DNA B) RNA promoters C) DNA polymerases D) RNA polymerases E) Ribozymes

____________________ probably began the evolution of life on Earth. A) DNA B) RNA promoters C) DNA polymerases D) RNA polymerases E) Ribozymes

Genetics has played a key role in which of the following areas? A. agriculture B. medicine C. pharmaceutical production D. A and B E. All of the above.

E. All of the above.

Which of the following is NOT a chromosomal mutation? A. Translocation B. Duplication C. Deletion D. Inversion E. Transversion

E. Transversion

The structure of the DNA molecule is described by all of the following EXCEPT: A. each strand is assembled by hydrogen bonding. B. it is a double helix. C. the two strands of DNA are antiparallel to each other. D. the two strands interact with each other by hydrogen bonding. E. All of these describe DNA structure.

Each strand is assembled by hydrogen bonding.

Would you expect this region to replicate early or late in S-phase? (0.5pts)

Early

True

Early life was probably centered on RNA, which served as the original genetic material and as biological catalysts. True or False?

Our genome contains almost as many long non-coding (lnc)RNA genes as protein coding genes. What, in general terms, is the functional role of lncRNAs? (4 pts)

Epigenetic regulators of gene expression: form RNA-protein complexes with chromatin proteins, deliver complexes to specific locations in genome, interact with transcription factors and participate directly in chromatin remodeling.

the nucleotide sequence of the promoter.

Essential information for the transcription unit—where it will start transcribing, which strand is to be read, and in what direction the RNA polymerase will move—is imbedded in

What type of chromatin would you expect to find in this region? (0.5pts)

Euchromatin

True

Eukaryotic cells possess three different RNA polymerases, each of which transcribes a different class of RNA and recognizes a different type of promoter. True or False?

A calico cat is crossed to a black cat and they produce a litter of 8 with an even sex ratio. How many kittens would you expect to be calico? What color and sex would the non-calico kittens be? (1pt)

Expect: 2 calico [females] 2 orange males 2 black males 2 black females

Bacterial DNA is stabilized by histone proteins.

False

Bacterial insertion sequences encode no functional gene products.

False

Centromeres and telomeres encode special gene products.

False

Mobile genetic elements are found only in prokaryotes.

False

The "selfish DNA hypothesis" holds that transposons persist in genomes because of their mutagenic capacity.

False

True (T) or False (F)? All DNA polymerases can synthesize DNA from 3' to 5'

False

True (T) or False (F)? DNA replication is continuous on the lagging strand

False

True (T) or False (F)? Mutations in the second positions of codons rarely change amino acid identity

False

True (T) or False (F)? The main function of DNA helicase is to reduce supercoiling during replication

False

Who is Gregor Mendel?

Father of genetics, used snow peas to show genetic variation.

What sex would a diploid XXY Drosophila be?

Female [because the ratio of X chromosomes to haploid sets of autosomes is still 1.0, as for regular XX females.]

Rho-independent terminators

First, they contain inverted repeats (sequences of nucleotides on one strand that are inverted and complementary). When inverted repeats have been transcribed into RNA, a hairpin secondary structure forms. Second, in rho-independent terminators, a string of seven to nine adenine nucleotides follows the second inverted repeat in the template DNA.

Piwi-interacting RNAs (piRNAs; named after Piwi proteins, with which they interact)

Found in mammalian testes, these RNA molecules are similar to miRNAs and siRNAs; they are thought have a role in the regulation of sperm development.

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA? a. Used X-ray diffraction to examine the structure of DNA b. Determined that DNA contains four different nitrogenous bases c. Found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. Found that the phosphorus-containing components are the genetic material of phages e. Discovered "the transforming principle" that could genetically alter bacteria

Found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA

In hamsters, a rare allele that produces white spots is dominant to the allele that produces solid golden coat color. You set up crosses in which both parents have spots and obtain 100 golden and 200 spotted offspring. a) You recognize that these results are not consistent with expectations for a Mendelian trait. Draw a Punnett square showing the expected phenotypic and genotypic proportions in offspring. Hint: your first step is to decide whether one or both parents were heterozygous. (4 pts)

G = spots, g = golden You know that each parent has to have at least one G allele because they have spots. You also know that spots is dominant to golden so they have to each have at least one g alleles to get any golden offspring. So they have to both be Gg, heterozygous. So you'd expect 3 spotted :1 golden

What functional class of proteins is essential to the initiation of transcription by RNA polymerase in eukaryotes? (1pt)

General transcription factors

Which of the following is NOT a key characteristic that genetic material must possess? a. Genetic material must contain complex information. b. Genetic material must replicate faithfully. c. Genetic material must encode the phenotype. d. Genetic material must have the capacity to vary. e. Genetic material must contain nitrogen but not sulfur.

Genetic materical must contain nitrogen but not sulfur

The complete genetic makeup of an organism is referred to as its a. chromosome. b. alleles. c. locus. d. genome. e. phenotype.

Genome

A tautomeric shift in genomic DNA converts a cytosine to uracil. If this change persists through at least two rounds of DNA replication, a new mutation will be introduced in which a _______is changed to an _______. However, the _________ repair system might recognize that uracil is mispaired and fix the problem before the new mutation is introduced.

Guanine adenine mismatch

True

Hairpin-loops: When two regions within a single RNA molecule pair up, the strands in those regions must be antiparallel, with pairing between cytosine and guanine and between adenine and uracil (although, occasionally, guanine pairs with uracil).True or False?

A cell with 8 chromosomes after the first meiotic division is

Haploid and is found in an organism with 2n = 16

As you may remember from Problem Set 1, there is a rare mutation that results in purple hair. What you may not know is that there is an equally rare recessive mutation that results in blue hair. A baby boy is born with blue hair and the brown-haired parents immediately get their genomes and that of their son sequenced. The blue hair mutation is found in the child but neither of the parents are carriers. What is the source of the blue hair mutation? (1pt)

Has to be a germline mutation in one of the parents. FYI: has to be on either X or Y because mutation is recessive. If X-linked could be from either parent, if Y-linked has to be from father.

Plant height (tall dominant to dwarf) and pod texture (smooth dominant to wrinkled) are two of the characters that Mendel studied in monohybrid crosses. We now know that the genes encoding these two characters are close to each other on garden pea chromosome 4. If Mendel had studied these characters together in a dihybrid cross he would have crossed homozygous dominant and homozygous recessive parents to obtain heterozygous F1 plants. If the two genes are so close together that a crossover between them is never detected, a) what fraction of F2 plants with both recessive phenotypes would Mendel have observed? b) Would this have been more or less than his expectations based on his other dihybrid crosses? To get credit, show or explain how you arrived at your answers. (6 pts)

He would have observed a) ~1/4 F2 plants with both recessive phenotypes (dwarf and wrinkled, which would have been b) more than his expectations based on other dihybrid crosses [1/16]. [To solve part a) you had to recognize that the F1 plants inherit two copies of chromosome 4, one with the two dominant alleles (DW) and one with the two recessive alleles (dw) and that each F1 transmits these same linked alleles (DW or dw) with equal probability. A Punnett square would show that this would give a 3:1 phenotypic ratio in the F2 generation. If you got that, for part b) you just had to remember the dihybrid phenotypic ratio (9:3:3:1) with plants with both recessive phenotypes being the smallest group.

What is hemophilia?

Hemophilia is a bleeding disorder Hereditary, sex-linked disorder.

What type of chromatin would you expect to find at centromeres? (0.5pts)

Heterochromatin

Tay-Sachs disease is caused by a loss-of-function mutation in an essential enzyme. It provides an example of incomplete dominance because

Heterozygote carriers of the mutated allele produce about 50% more of the enzyme than individuals homozygous for the disease causing allele, and 50% less than individuals homozygous for the normal allele

b) Are the blue-eyed females you used in your parental cross heterozygous or homozygous for the eye color gene? (0.5pt)

Heterozygous (If the blue eye allele (b) is lethal when homozygous then those females have to be heterozygous Bb).

If you knocked out the gene, Xist, in a cell line derived from a female mouse, would you expect to detect higher, lower or unchanged expression of X-linked genes? Explain! (1pt)

Higher expression because Xist expression is essential to the silencing of one X chromosome in the somatic cells of female mammals.

Additional genotyping in the father's family reveals that he inherited the mutation from one of his parents. Which one and why? (3 pts)

His mother (see above)

Both processes use a protein that binds to the RNA molecule and moves down the RNA toward the RNA polymerase. They differ in that rho does not degrade the RNA, whereas Rat1 does so.

How are the processes of RNA polymerase II termination and rho-dependent termination in bacteria similar and how are they different?

A) It loosens the chromatin and allows increased transcription.

How does histone acetylation affect chromatin? A) It loosens the chromatin and allows increased transcription. B) It allows DNA to become resistant to damage. C) It helps the histones have a greater affinity for DNA. D) It inhibits DNA replication by making it more difficult to separate the DNA strands. E) It causes the chromatin to become more condensed in preparation for metaphase.

This information is encoded by the DNA sequence.

How does the complex of enzymes and proteins that performs transcription—the transcription apparatus—recognize a transcription unit? How does it know which DNA strand to read and where to start and stop?

D) 15

How many base pairs per turn of the helix would MOST likely correspond to a negatively supercoiled DNA molecule? A) 0 B) 5 C) 10 D) 15 E) 100

B) 5

How many base pairs per turn of the helix would MOST likely correspond to a positively supercoiled DNA molecule? A) 0 B) 5 C) 10 D) 15 E) 100

C) 10

How many base pairs per turn of the helix would MOST likely correspond to a relaxed DNA molecule? A) 0 B) 5 C) 10 D) 15 E) 100

B) 5

How many complete rotations would MOST likely correspond to a negatively supercoiled DNA molecule that is 100 bp in length? A) 0 B) 5 C) 10 D) 15 E) 100

D) 15

How many complete rotations would MOST likely correspond to a positively supercoiled DNA molecule that is 100 bp in length? A) 0 B) 5 C) 10 D) 15 E) 100

C) 10

How many complete rotations would MOST likely correspond to a relaxed DNA molecule that is 100 bp in length? A) 0 B) 5 C) 10 D) 15 E) 100

True

However, because the 5′ end of the first ribonucleoside triphosphate does not take part in the formation of a phosphodiester bond, all three of its phosphate groups remain. An RNA molecule therefore possesses, at least initially, three phosphate groups at its 5′ end. True or False?

A) It would not be stable due to the lack of a eukaryotic-specific origin of replication; hence, it could not replicate properly in a eukaryotic cell. C) Due to the lack of centromeres on prokaryotic chromosomes, the chromosomes will not segregate normally during cell division. E) The bacterial chromosome would be lost and eventually degraded.

If a bacterial chromosome were inserted into a eukaryotic cell, would it be stable and segregate like eukaryotic chromosomes do during mitosis and meiosis? (Select all that apply.) A) It would not be stable due to the lack of a eukaryotic-specific origin of replication; hence, it could not replicate properly in a eukaryotic cell. B) It would be generally stable because the chemical nature of DNA is the same regardless of the cell type. C) Due to the lack of centromeres on prokaryotic chromosomes, the chromosomes will not segregate normally during cell division. D) The prokaryotic chromosome can be induced to be stabilized by cleavage of circular form to mimic linear eukaryotic chromosome. E) The bacterial chromosome would be lost and eventually degraded.

In the Luria-Delbrück fluctuation test, bacteria were cultured either in small vials (Different Cultures) or one big flask (Same Culture). After several generations bacteria from these two treatment groups were spread at equal densities on plates inoculated with T1 bacteriophage. Only bacteria with a mutation conferring resistance to T1 survived to produce colonies. Explain why the results in the table demonstrate that mutation is a random process, not an adaptive response to environment (in this case, exposure to T1). (2pts)

If mutation were an adaptive response to presence of T1 would expect ~ equal numbers resistant colonies in each treatment: little variation between plates. Large between-plate variation in numbers of resistant colonies for bacteria cultured in separate vials indicates that mutations conferring resistance arose at random time points in each separate culture in the absence of T1.

If the sequence of an mRNA molecule is 5' GGCAUCGACG 3', what is the DNA sequence of the nontemplate strand? a. 5' GGCATCGACG 3' b. 3' GGCATCGACG 5' c. 5' CCGTAGCTGC 3'

Describe Watson and Crick's model of DNA

In Watson and Crick's model, the two strands of the DNA double helix are held together by hydrogen bonds between nitrogenous bases on opposite strands. Each pair of bases lies flat, forming a "rung" on the ladder of the DNA molecule. Base pairs aren't made up of just any combination of bases.

The epigenetic marks that determine the expression pattern of imprinted genes are reset every generation. When and where does this reset occur? (1pt)

In the embryonic germline gets full credit; reset is completed shortly after birth in females.

True

In bacterial cells, promoters are usually adjacent to an RNA-coding sequence. True or False?

True

In eukaryotes, the function of sigma is replaced by that of the general transcription factors. True or False?

The probability of Down syndrome child (trisomy 21) increases with maternal but not paternal age. One explanation for this pattern involves a fundamental difference between oogenesis and spermatogenesis. Explain briefly. (5 pts)

In mammalian females, oogenesis starts in the embryonic ovary but arrests when homologous chromosomes are synapsed before the first meiotic division. At puberty, the first meiotic division is completed, but typically only for one oocyte/cycle. So one explanation for increased probability of non-disjunction in older women is that chromosomes have spent longer synapsed and are therefore more prone to nondisjunction at meiosis I. In contrast, spermatogenesis is constant from puberty on.

True

In most organisms, each gene is transcribed from a single strand, but different genes may be transcribed from different strands. True or False?

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in... a. the RNA polymerase that is transcribing the gene. b. the DNA template. c. the RNA that is being transcribed. d. a protein factor that binds to RNA polymerase. e. a protein factor that binds to the RNA that is being transcribed.

a hairpin loop

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in____?

Sigma Factor

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the ____?

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the... a. rho factor b. TFIID c. TBP d. Omega subunit e. sigma factor

True

In replication, all the nucleotides in the DNA template are copied, but, in transcription, only small parts of the DNA molecule—usually a single gene or, at most, a few genes—are transcribed into RNA. True or False?

In transcription, to which end of the elongating strand are nucleotides always added? a. 3' b. 5' c. 3' in prokaryotes and 5' in eukaryotes d. It depends on which RNA polymerase is being used. e. It depends on which DNA strand is being used as a template.

a promoter, an RNA-coding sequence, and a terminator

Included within a transcription unit are three critical regions:

microRNAs (miRNAs)

Inhibits translation of mRNA

If this was mRNA from a retrotransposon, what protein/s might this mRNA encode? (1pt)

Integrase and reverse transcriptase

Small nucleolar RNAs (snoRNAs)

Involved in processing and assembly of rRNA.

Small nuclear RNAs (snRNAs)

Involved only in processing of pre-mRNA

What is the function of Tus?

It is a protein that binds to termination sequences and blocks helicase stalling the replication fork.

What is the function of DNA Pol III?

It is the major replication enzyme.

What is semiconservative replication?

It produces two copies of the original DNA molecule, each of which contains one of original strand, and one newly-synthesized strand.

A) Heteroplasmy for mtDNA molecules in the cells of his mother is responsible. C) It is likely that Jake has a higher proportion of mutant mtDNA molecules in his cells compared to his mother.

Jack and Jill's son Jake has a severe case of myclonic epilepsy and ragged-red fiber (MERRF) syndrome. His case includes frequent and disabling myclonic seizures (involuntary twitching of the muscles) along with hearing loss, exercise intolerance, and poor night vision. Like most cases of MERRF, his case is associated with a mitochondrial mutation that he inherited from his mother Jill. His mother doesn't know that she harbors the MERRF mutation among her mtDNA molecules, but she has experienced occasional mild muscle twitching throughout her life and she does not see very well at night. What is/are the MOST likely explanation(s) for the difference in the severity of MERRF between Jake and his mother? (Select all that apply.) A) Heteroplasmy for mtDNA molecules in the cells of his mother is responsible. B) Some random mutations took place in Jack's mitochondria, which caused MERFF syndrome as his mother does not have full symptoms. C) It is likely that Jake has a higher proportion of mutant mtDNA molecules in his cells compared to his mother. D) The expression pattern of the mutant gene may be different in males than in females.

Which of the following would NOT be useful to annotation of a new genome?

Knowing the mutation rate for the species

Okazaki fragments are produced because: A. DNA polymerase functions only in the 3' to 5' direction. B. DNA strands are parallel to each other. C. leading and lagging strands are synthesized at different times. D. lagging strands are copied discontinuously. E. None of the above.

Lagging strands are copied discontinuously.

1. a DNA template; 2. the raw materials (substrates) needed to build a new RNA molecule; and 3. the transcription apparatus, consisting of the proteins necessary to catalyze the synthesis of RNA.

Like replication, transcription requires three major components:

If a region of the genome is said to be CpG rich, what does this mean in terms of base composition? (1pt)

Lots of cytosine, guanine

Below is the pedigree for a recessive X-linked trait. The two males in the second generation express the trait. No other information is provided. Indicate (with a dot) the individuals in generation I that have to be heterozygous carriers. Briefly justify your choices. (4 pts)

Males inherit their X chromosome from mothers so females 1-2 and 1-4 have to be heterozygous carriers.

How does a eukaryote divide?

Mitosis and cytokinesis

What is Huntington's disease?

Neurological disorder; symptoms appear after having children. Hidden in heterozygotes.

The Meselson-Stahl experiment was designed to discriminate between three alternative models of DNA synthesis. a) If the dispersive model were correct, would the researchers have obtained two separate bands of DNA following replication in the 14N medium? (0.5pts)

If a bacterial chromosome were inserted into a eukaryotic cell, would it be stable? Would it segregate like eukaryotic chromosomes do during mitosis and meiosis? Why or why not?

No, it would not be stable because: (1) it would not contain a eukaryotic- specific origin of replication, and therefore it could not replicate in a eukaryotic cell, and (2) bacterial chromosomes don't have centromeres, so they can't segregate in eukaryotic cells (no kinetochores, no spindle fibers, etc.). The bacterial chromosome would be lost and eventually degraded.

Do all sex chromosomes share a common evolutionary origin? Provide an example that supports your answer. (3 pts)

No. Supporting evidence includes the existence of female heterogametic (ZW) systems as in birds and butterflies and male heterogametic systems as in mammals and flies; mammals are more closely related to birds than to flies, which strongly suggests that our sex chromosomes have an origin that is independent of that in flies. Same argument applies to birds and butterflies; the fact that the mechanisms of sex determination in mammals and flies are completely different also suggests independent origin.

Interphase

Non-dividing stage of the cell cycle.

What must bind to initiate DNA replication?

ORC at the origin.

During transcription, which parts of a DNA molecule are transcribed into RNA? a. All of the nucleotides in DNA on both strands b. All of the nucleotides on one strand of DNA c. Only parts of the DNA that encode mRNA d. Only regions of the DNA that contain genes e. Only regions of the DNA that encode rRNA

Only the parts that contain mRNA

In guinea pigs, two genes that affect coat color (orange/blonde) and coat texture (smooth/rough) are very close to each other on the same autosomal chromosome. Orange (B) is dominant to blonde (b), and smooth (R) is dominant to rough (r). You set up a small number of crosses between homozygous parents, in which one is blonde and smooth-coated and the other is orange and rough-coated. a) What do their F1 offspring look like and what are their genotypes? (1pt)

Orange and smooth; BbRr [just the same as for unlinked genes]

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Organisms have evolved mechanisms to regulate transposition, either by controlling the amount of transposase produced or by direct inhibition of the transposition event.

You discover that the number is actually considerably larger than what you expected based on genome size. Having established that all the amino acids are derived from the phage (i.e., not the host) genome, how do you explain this result? (1pt)

Overlapping genes [> one translation start site for an mRNA transcript. Not to be confused with splice variants that produce different isoforms of the same protein. The latter would never produce more than the max expected number of amino acids.]

-10

PROKARYOTIC promoters contain the sequence TATAAT at the ______ position from the transcription start.

C) most gymnosperms

Paternal transmission of mitochondria is common in which group? A) humans B) mice C) most gymnosperms D) most flowering plants E) insects

True

RNA is synthesized from ribonucleoside triphosphates. Transcription is 5′→3′: each new nucleotide is joined to the 3′-OH group of the last nucleotide added to the growing RNA molecule. True or False?

True

Pausing also affects the rates of RNA synthesis. Sometimes a pause may be stabilized by sequences in the DNA that ultimately lead to the termination of transcription. True or False?

B) The plant will be able to reproduce only by cross-fertilization.

Pea plants produce both pollen and eggs. A pea plant inherits a mutation for cytoplasmic male sterility. How will this affect the plant and/or its progeny? A) The plant will be able to reproduce only by self-fertilization. B) The plant will be able to reproduce only by cross-fertilization. C) The plant will be unable to produce progeny. D) The plant will produce progeny, but the progeny will not be able to reproduce.

What type of bonds does DNA ligase create between adjacent nucleotides? a. Hydrogen b. Phosphodiester c. Ionic d. Metallic e. Ribonucleotide

Phosphodiester.

The recessive allele that causes sickle cell anemia also confers malaria resistance in heterozygotes. This is a good example of

Pleiotropy

Yellow coat color in mice is caused by the AY mutation in the agouti gene. This is most accurately defined an example of

Pleiotropy because the AY allele influences both coat color and feeding behavior

Which polymerases have exonucleases activity in the 3' to 5' direction?

Pol I,II,III

Women with the 47,XXX karyotype are usually fertile. If a 47,XXX woman has children with a normal 46,XY man, what are the possible sex chromosome genotypes of their progeny? For each, specify whether the individual will develop as male or female, and whether they are likely to be sterile or fertile. Hint: it may help to draw the possible sex chromosome constitutions of the gametes produced by the mother. (1pt)

Possible sex chromosome genotypes: 47,XXY male, probably sterile 47,XXX female, probably fertile 46,XY male, fertile 46,XX female, fertile [Figure is just to help interpret answers, not required!]

Fish in your lab are either red or green and have tails that are either forked or blunt. You have used a dihybrid cross to demonstrate that these traits are inherited according to Mendelian principles. a) The F1 progeny of true-breeding parents were all green with forked tails. What did the parents look like and what were their genotypes? Hint: there is more than one correct answer to this question. (4 pts)

R = green, r = red B = forked, b = blunt RRBB (green/forked) x rrbb (red/blunt) OR RRbb (green/blunt) x rrBB (red/forked)

b) Write the genotypes of the different gametes each F1 fish could produce. (5 pts)

RB, Rb, rB, rb

DNA synthesis during replication is initiated from a. a free 5′ OH. b. DNA primers. c. RNA primers. d. telomerase. e. DNA polymerase I

RNA Primers

ribonucleoside triphosphates

RNA is synthesized from

The DNA replication enzyme that most closely resembles RNA polymerase is a. DNA polymerase I. b. DNA polymerase III. c. primase. d. telomerase. e. helicase.

Primase

What is the function of RNA primase in DNA replication?

Primase functions by synthesizing short RNA sequences that are complementary to a single-stranded piece of DNA, which serves as its template. It is critical that primers are synthesized by primase before DNA replication can occur.

How do prions exert their pathogenic effects? In other words, what is the property of prions that ultimately causes the death of an individual with a prion disease? (1pt)

Prions self-propagate: induce abnormal conformation in normal copies of same protein Death caused by progressive accumulation of misfolded proteins in brain.

Prokaryotic promoters contain the sequence TATAAT at the ______ position from the transcription start. a. +1 b. -1 c. -10 d. -25 e. -35

If this sequence affects the transcription rate of a particular gene, where would you expect to find it in relation to that gene? (1pt)

Promoter gets full credit. FYI: probably in proximal promoter; could also be in an intron, in an enhancer, a silencer, or 3' promoter.

Genetic variation in populations: A. demonstrates descent from a common ancestor. B. provides the basis of adaptation. C. explains the use of similar genetic systems in all organisms. D. All of the above. E. None of the above

Provides the basis of adaptation.

True

RNA polymerase I and RNA polymerase III each recognize promoters that are distinct from those recognized by RNA polymerase II. True or False?

True

RNA polymerase I requires a termination factor like the rho factor utilized in the termination of some bacterial genes. Unlike rho, which binds to the newly transcribed RNA molecule, the termination factor for RNA polymerase I binds to a DNA sequence downstream of the termination site. True or False?

True

RNA polymerase III ends transcription after transcribing a terminator sequence that produces a string of uracil nucleotides in the RNA molecule, like that produced by the rho-independent terminators of bacteria. Unlike rho-independent terminators in bacterial cells, however, RNA polymerase III does not require that a hairpin structure precede the string of Us. True or False?

True

RNA polymerases IV and V transcribe RNAs that play a role in DNA methylation and chromatin structure. True or False?

RNA interference (RNAi) is currently being considered as a therapeutic treatment for a variety of diseases. Consider the following: cystic fibrosis (caused by a missense mutation in the gene CFTR that results in loss-of-function), polycystic kidney disease (caused by overexpression of the gene PKD1), rabies (caused by infection with a single-stranded RNA virus). Which might be candidates for RNAibased treatment and which would not. Explain! (4 pts)

RNAi harnesses endogenous cellular machinery that target dsRNA and targets RNA with the same sequence for degradation. So it wouldn't be useful for a disease like CF where not enough of a gene product is produced. The rabies virus is ssRNA so, unless it self-paired RNAi wouldn't be much good at knocking that down. A disease like polycystic kidney disease that is caused by over-expression of a particular gene is the best candidate for RNAi-based treatment.

Turner syndrome can result from sex chromosome non-disjunction in the germ line of either parent. If an individual with Turner syndrome is red-green color-blind and both parents have normal vision, in which parent did the non-disjunction most likely occur and why? (1pt)

Red-green color blindness is X-linked recessive so if the single X present in the Turner syndrome individual was paternally inherited their father would be color-blind. Since he's not we know that their X was maternally inherited (their mother would have to be a carrier for the mutation) and therefore XY non-disjunction occurred in paternal germ line.

Name three ways in which mutations can arise endogenously. (1pt)

Replication errors: • DNA pol inserts wrong base • Replication slippage: DNA pol either skips or duplicates small region of template DNA (common in repetitive regions) Spontaneous base modifications (chemical change to a base) • Tautomeric shifts produce alternate chemical form due to single proton shift • Deamination: chemical conversion of C to U or A to hypoxanthine Depurination: loss of single G or A due to SS break Movement of transposable elements: insertion in new site = mutation Reactive oxidants: byproducts of cellular processes (e.g. respiration) can act as mutagens [Any combination of 3 bulleted or non-bulleted examples gets full credit. Additional info just FYI.]

Several human diseases are caused by or associated with repeat expansions. How, at the molecular level, might these mutations occur? (1pt)

Replication slippage: not uncommon for DNA pol to "stutter" (become temporarily dissociated from template and continue synthesis in wrong place) in repeat-rich regions

What is sexual reproduction?

Reproduction involving 2 parent organisms combining genetic material to create diverse offspring.

What would be the result of a large deletion in the resolvase gene of a transposable element?

Resolvase is an enzyme carried by some transposons that use a replicative transposition process. A transposon with a deletion in its resolvase gene would not be able to resolve the cointegrate molecule formed during the transposition process into two separate transposons. Instead, a single cointegrate molecule containing two copies of the transposon would be formed.

True

Sigma is required only for promoter binding and initiation; when a few RNA nucleotides have been joined together, sigma usually detaches from the core enzyme. True or False?

(1) DNA sequences that produce a pause in transcription and (2) a DNA sequence that encodes a stretch of RNA upstream of the terminator that is devoid of any secondary structures. This unstructured RNA serves as a binding site for the rho protein, which binds the RNA and moves toward its 3′ end, following the RNA polymerase.

Rho-dependent terminators have two features:

What is "satellite" DNA? Explain why satellite DNA anneals rapidly after it is denatured.

Satellite DNA, also called highly repetitive DNA, is one of three major classes of DNA sequences found in eukaryotic genomes. This class of DNA is present in hundreds of thousands to millions of copies. Highly repetitive fractions of DNA exhibit rapid reassociation kinetics because they are characterized by having numerous (up to millions) copies of identical sequence repeats; thus, once melted, complementary partner strands are readily available and can rapidly reanneal.

β-pleated sheets are an example of what structural level in proteins?

Secondary

Prions are proteins that can act as pathogenic agents. What level of structural organization is altered in these proteins? (1pt)

Secondary structure: alpha helix converted to beta-pleated sheet; partial credit for tertiary structure since this is also altered.

Acetyltransferases

Several types of proteins have roles in chromatin modification. ____________ add acetyl groups to amino acids at the ends of the histone proteins, which destabilizes nucleosome structure and makes the DNA more accessible. Other types of histone modification also can affect chromatin packing.

What is random mating in nature?

Sex; species specific.

holoenzyme

Sigma factor + core enzyme =

What is 3' to 5' DNA

Since DNA polymerase requires a free 3' OH group for initiation of synthesis, it can synthesize in only one direction by extending the 3' end of the preexisting nucleotide chain. Hence, DNA polymerase moves along the template strand in a 3'-5' direction.

Polytene chromosomes are found in the salivary glands of larval fruit flies, which feed by constantly chewing and regurgitating their food. What are some possible reasons for the existence of these structures in the salivary glands of larval flies?

Since larval flies constantly chew and regurgitate their food, they use a lot of saliva. The saliva contain high levels of specific gene products (amylases, etc.) needed to digest and process the regurgitated food. Many genes in the salivary glands are continually active, and under certain conditions the demand for given gene products is extremely high. One way to ensure that extremely high demands for gene products are met is to make thousands of copies of the chromosomes containing these crucial genes and not undergo cell division. Formation of polytene chromosomes in fly salivary glands meets these extreme demands.

What is the function of single stranded binding protein in DNA replication?

Single-strand DNA-binding protein (SSB) is a protein found in E. coli bacteria, that binds to single-stranded regions of DNA. Single-stranded DNA is produced during all aspects of DNA metabolism: replication, recombination, and repair.

Which of the following is not a major difference between mitosis and meiosis?

Sister chromatids are divided between daughter cells in meiosis but not in mitosis

small cytoplasmic RNAs (scRNAs)

Small RNA molecules are also found in the cytoplasm of eukaryotic cells; these molecules, called ______ , have varied and often unknown function.

Okazaki fragments

Small fragments of DNA produced on the lagging strand during DNA replication, joined later by DNA ligase to form a complete strand.

small nuclear ribonucleoproteins (snRNPs, affectionately known as "snurps").

Small nuclear RNAs (snRNAs) combine with small protein subunits to form

True

Some snRNAs participate in the processing of RNA, converting pre-mRNA into mRNA. True or False?

If you wanted to produce an XY mouse that developed as a female, what gene would you inactivate? (4 pts)

Sry

We now know that the gene, ____, is essential to this process.

Sxl

What is RNA primase?

Synthesizes RNA primers on template strand

TATA-binding protein (TBP)

TFIID consists of at least nine polypeptides. One of them is the ___________, which recognizes and binds to the TATA consensus sequence.

. _______ are tandemly repeated DNA sequences located at the ends of eukaryotic chromosomes. a. Replication bubbles b. Telomeres c. Nucleosomes d. Licensing factors e. Holliday junctions

Telomeres

What is a telomere?

Telomeres are "caps" at the ends of chromosomes that protect your genes from being eroded each time a cell divides.

B) replication

Telomeres exist to help with the _____ of the ends of eukaryotic chromosomes. A) transcription B) replication C) metabolism D) destabilization E) translation

The amino acid sequence of a polypeptide is referred to as the ________ sequence of the polypeptide. a. primary b. secondary c. tertiary d. quarternary e. penitentiary

What is 5' to 3' DNA

The 5' and 3' mean "five prime" and "three prime", which indicate the carbon numbers in the DNA's sugar backbone. The 5' carbon has a phosphate group attached to it and the 3' carbon a hydroxyl (-OH) group. This asymmetry gives a DNA strand a "direction".

If a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I is produced. What will be the most likely consequence of this mutation? a. The DNA strands would contain pieces of RNA. b. The DNA would not exist in a supercoiled state. c. There would be no DNA replication on the leading or lagging strands. d. There would be no RNA primers laid down. e. The DNA will not be able to unwind to initiate replication.

The DNA would contain pieces of RNA

True

The RNA polymerase maintains a transcription bubble during elongation, in which about eight nucleotides of RNA remain base paired with the DNA template strand. True or False?

C) thylakoid

The _____ membrane of the chloroplast bears the enzymes and pigments required for photophosphorylation. A) outer B) middle C) thylakoid D) plasma E) double

B) endosymbiotic

The _____ theory states that the ancestors of mitochondria and chloroplasts were free-living bacteria. A) phylogenetic B) endosymbiotic C) cell D) cytoplasmic inheritance E) old world

ω subunit

The ________ is not essential for transcription, but it helps stabilize the enzyme.

What is genetic recombination?

The act of crossing over; independent assortment.

Telomere loss is associated with senescence (aging) at both the cellular and organismal level. The enzyme telomerase can prevent telomere loss. Yet this enzyme is inactive in most cell types. What is a reasonable explanation for this? (4 pts)

The activity of telomerase can confer immortality, at the cellular level! What this means is that a given cell will go on dividing indefinitely. Unchecked division and cellular immortality are defining feature of cancerous cells and >80% of human tumor cells maintain their telomeres via telomerase. Therefore, benefits of cellular longevity may be outweighed by the cost of having cells that are potentially more vulnerable to having their telomerase system hijacked.

B) It inhibits DNA methyl transferases.

The agouti locus helps determine coat color in mice, and this phenotype can vary from light to dark between genetically identical individuals. You have discovered a drug that reduces the variation in the agouti phenotype. What is a likely explanation for this drug's mechanism of action? A) It inhibits DNA polymerases. B) It inhibits DNA methyl transferases. C) It activates shelterin proteins. D) It activates mitochondrial transcription. E) It causes DNA damage.

Primary

The amino acid sequence of a polypeptide is referred to as the ____ sequence of the polypeptide.

B) the gene expression pattern changes during development. D) DNAse I sensitivity only occurs in chicken but in no other organisms.

The classic experiment that examined DNAse I sensitivity of chicken embryonic DNA from different tissues and at different developmental stages shows that: (Select all that apply.) A) the chromatin structure changes in the course of development. B) the gene expression pattern changes during development. C) DNAse I sensitivity comes from sporadic mutations occurred during development. D) DNAse I sensitivity only occurs in chicken but in no other organisms.

While working on Drosophila you find a new mutant strain with an abnormal histone H3 gene. This novel histone mutant is predicted to cause the nucleosomes to bind an extra 15 bp of DNA compared to wild type. If you digest isolated chromatin with a nuclease to release the core nucleosomes, what size DNA fragments would you expect from wild type and mutant flies?

The core nucleosome from wild type flies wraps approximately 145 bp of DNA; therefore, if the mutant histone is predicted to wrap an extra 15 bp, the mutant nucleosomes should wrap 160 bp.

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

The direct repeats indicate that staggered cuts are made in the target DNA sequence when transposable genetic elements insert themselves. The direct repeats are a consequence of repairing the staggered cuts after insertion.

False

The discovery of ribozymes complements other evidence suggesting that the original genetic material was DNA. True or False?

In the human genome, the distribution of sites prone to deletion or duplication is non-random. What is the supporting evidence for this statement? (2 pts)

The existence of named syndromes and developmental disorders associated with the deletion or duplication of specific genes/parts of chromosomes.

G1 phase

The first gap, or growth phase, of the cell cycle, consisting of the portion of interphase before DNA synthesis begins.

True

The holoenzyme binds to the -35 and -10 consensus sequences in the DNA promoter. Although it binds only the nucleotides of consensus sequences, the enzyme extends from −50 to +20 when bound to the promoter. The holoenzyme initially binds weakly to the promoter but then undergoes a change in structure that allows it to bind more tightly and unwind the double-stranded DNA. True or False?

C) 250,000

The human Y chromosome is about 50 million base pairs long. About how many nucleosomes would you expect to find associated with this chromosome? A) 2,500 B) 50,000 C) 250,000 D) 1,000,000 E) 50,000,000

True

The initiation of transcription requires modification of chromatin structure so that DNA is accessible to the transcriptional machinery. True or False?

Which of the following is NOT a mechanism of sex determination?

The number of Barr bodies present

c) State (in one or two complete sentences) whether or not your results were significant and what that means in relation to the question you were addressing. (0.5pt)

The observed phenotypic ratios were significantly different from the expected 3:1 ratio under the null hypothesis of inheritance according to Mendelian principles. This suggests that one or more of the assumptions of Mendelian inheritance were violated and that our results require an alternative explanation.

True

The orientation and spacing of consensus sequences on a DNA strand determine which strand will be the template for transcription and thereby determine the direction of transcription. True or False?

What is asexual reproduction?

The parent passes all of its genes to offspring through mitosis. Creates identical clones of parent.

What is a phenotype?

The physical characteristics of an organism.

B) heteroplasmy.

The presence of more than one variation of DNA in the organelles of a single cell is called: A) homoplasmy. B) heteroplasmy. C) hemiplasmy. D) pseudoplasmy. E) paraplasmy.

Here's a less fun scenario. A couple is expecting twins and has just learned that they are both heterozygous carriers for two autosomal recessive traits, albinism and sickle cell anemia. If they have fraternal twins, what is the probability that both twins will be phenotypically normal and that one will be a carrier for only the albinism allele and the other will be a carrier for only the sickle cell allele? (Hint: to solve this problem you need to use both the sum and product laws but do not need to mess with binomials. Also, notice that which twin has which genotype isn't specified.) (2pts)

The probability that one twin is a carrier for the albinism allele only (AaSS) and that the other is a carrier for the sickle cell allele only (AASs) is 1/32. This is a really hard problem so if you got it right you should be very pleased and if you didn't you shouldn't be discouraged. Here are the steps that would get you the right answer: Parent's genotypes: both AaSs, where a is the albinism allele and s is the sickle cell allele Take one twin at a time: what's the probability that they will be homozygous dominant for one gene and heterozygous for the other? As in a dihybrid cross you can multiply the probability of each genotype occurring separately: ¼ for homozygous dominant x ½ for heterozygous = 1/8. But this would only be right if you didn't care which gene was homozygous. To get the probability of one desired outcome (you could pick either AaSS or AASs), you need to use the product law again: 1/8 x 1/8 = 1/64. The exact same logic applies to the other twin: 1/64 for AaSS or AASs). But this would only be right if you specified that the twin born first had to be AaSS or vice versa. In fact you don't care so this means that there are two ways to get the outcome you're looking for. So, using the sum law: 1/64 + 1/64 = 1/32.

What is the definition of genetics?

The scientific study of heredity and genetic variation.

True

The results of these studies reveal that most base substitutions within the −10 and −35 consensus sequences reduce the rate of transcription; these substitutions are termed down mutations because they slow down the rate of transcription. Occasionally, a particular change in a consensus sequence increases the rate of transcription; such a change is called an up mutation. True or False?

We have talked about several molecules or molecular complexes that are comprised of both protein and RNA. Name two. (2 pts)

The ribosome and the spliceosome are examples of molecular complexes that are part protein, part RNA. The enzyme telomerase has a short RNA sequence at its catalytic site

G2 phase

The second growth phase of the cell cycle, consisting of the portion of interphase after DNA synthesis occurs.

LINES are transposable genetic elements in humans.

True

Nonhistone proteins make up about 50% of each eukaryotic chromatin.

True

b) What is the most likely explanation for the results of your cross? What are the genotypes of the golden and the spotted offspring? (4 pts)

The spotted allele is a lethal recessive Genotypes of golden are gg and spotted are Gg Logic: You'd expect 3 spotted : 1 golden but what you actually have is 2 spotted : 1 golden, which suggest that one of the three possible genotypes (GG, Gg, gg) is missing in your hamster offspring. Since you know the gg are golden and that both parents are heterozygotes, you can assume that those genotypes are represented. So GG is likely missing and a reasonable explanation is that this allele is a lethal recessive.

True

The string of uracils in the RNA molecule causes the RNA polymerase to pause, allowing time for the hairpin structure to form. Evidence suggests that the formation of the hairpin destablizes the DNA-RNA pairing, causing the RNA molecule to separate from its DNA template. Separation may be facilitated by the adenine-uracil base pairings, which are relatively weak compared with other types of base pairings. True or False?

True

The termination of transcription by RNA polymerase II is not at specific sequences. Instead, RNA polymerase II often continues to synthesize RNA hundreds or even thousands of nucleotides past the coding sequence necessary to produce the mRNA. True or False?

True

The transcription apparatus is said to move downstream during transcription: it binds to the promoter (which is usually upstream of the start site) and moves toward the terminator (which is downstream of the start site). True or False?

What is heredity?

The transmission of traits from one generation to the next.

There are ___ different codons, which encode 20 amino acids and 3 stop codons.

There are _____ different codons, which encode 20 amino acids and 3 stop codons. a. 16 b. 20 c. 23 d. 61 e. 64

Wild-type eye color in mice is black. You are studying the genetics of a rare mutation that results in blue eyes. Your prior work indicates that this eye color phenotype is monogenic. You set up a large number of crosses between blue-eyed females and black-eyed males and obtain the following: 26 blue-eyed females 22 black-eyed females 27 black-eyed males a) What could explain the observed frequencies or these eye color phenotypes and their distribution between males and females in the offspring produced from your crosses? (Hint: what is missing? What is the mode of inheritance?) (1pt)

There are no blue-eyed males and there are half as many males as females. So a reasonable interpretation is that the blue eye allele acts as a recessive lethal and is on the X chromosome.

B) At high temperatures, the condition is more conducive for the strands to denature. D) Positive supercoiling would allow the DNA to maintain its double-stranded structure at higher temperature.

There are some genomes that have been reported to be positively coiled instead of negatively supercoiled, which is the status of most genomes that we have studied. The genomes that are positively supercoiled seem to belong to viruses and cells that exist at very high temperatures. Why might positive supercoiling be an advantage at high temperatures? (Select all that apply.) A) Negative supercoiling makes it more difficult for strands to separate while positive supercoiling would allow the strands to separate more readily. B) At high temperatures, the condition is more conducive for the strands to denature. C) The high temperature would increase the formation of the hydrogen bonds between bases. D) Positive supercoiling would allow the DNA to maintain its double-stranded structure at higher temperature. E) Positive supercoiling would allow the DNA to readily separate for transcription and replication.

What are single strand binding proteins?

They bind to and stabilize single-stranded DNA

How do topoisomerase enzymes control the degree of supercoiling in DNA?

They do it by cleaving one strand of the double helix, rotating the cut end around the uncut strand, and resealing the nick.

What is the function of a telomere?

They function to protect the ends of chromosomes from sticking to each other. They also protect genetic information during cell division because a short piece of each chromosome is lost every time DNA is replicated.

Trio genome sequencing for a child with evelopmental deficits in growth reveal that both child and father are heterozygous for a loss-of-function mutation in an autosomal gene. The mother is genotypically normal and both parents are phenotypically normal. Assuming that this mutation is the sole cause of the child's growth abnormality, what could explain the father's normal phenotype? (4 pts)

This could be an imprinted gene that is normally expressed from the paternally inherited allele while the maternally inherited allele is silenced. If the father inherited his functional copy from his father and his mutated allele from his mother, the mutated allele would be silent anyway so his phenotype would be normal. He had a 50/50 chance of transmitting the mutated allele to his child. Other solutions exist...

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine and uracil. a. RNA only b. DNA only c. Both RNA and DNA d. Neither RNA nor DNA

You are studying a new virus that has DNA as its genetic material but does not produce Okazaki fragments during DNA replication. What do these observations suggest about the genome of this virus? (there are several possible answers to this question) (4 pts)

This virus has a single-stranded DNA genome (viruses can do that!) so it wouldn't have a lagging strand or Okazaki fragments. The textbook has as similar question about an alien organism and their solution is that the DNA strands are replicated separately, or the DNA is parallel rather than antiparallel (Now Solve This 11.2). Basically, if your answer demonstrates that you know what Okazaki fragments are and why they exist (DNA pol can only synthesize 5' to 3'), you get full credit.

True

Thus, within a gene, only one of the nucleotide strands is normally transcribed into RNA (there are some exceptions to this rule). True or False?

Retrotransposons are transcribed before moving from one location in the genome to another.

True

Single transposons can carry multiple genes.

True

Target site duplications are direct DNA repeats.

True

What are the functions of DNA pol II, IV,and V?

To repair DNA damage

tRNA and rRNA

To translate an mRNA requires two other types of RNA. These are:

To translate an mRNA requires two other types of RNA. These are: a. tRNA and mRNA b. tRNA and miRNA c. tRNA and rRNA d. rRNA and siRNA e. snRNA and snoRNA

True

Topoisomerase enzymes probably relieve the stress associatedwith the unwinding and rewinding of DNA in transcription, as they do in DNA replication. True or False?

What is the function of topoisomerase in DNA replication?

Topoisomerases are enzymes that participate in the overwinding or underwinding of DNA.

1) initiation -> 2) elongation -> 3) termination

Transcription can be conveniently divided into three stages:

Provide two examples of cis-acting regulatory elements. (1pt)

Transcription factor binding sites, TATA box, enhancers, silencers and many others. No credit for promoter.

True

Transcription in eukaryotes is initiated through the assembly of the transcriptional machinery on the promoter. This machinery consists of RNA polymerase II and a series of transcription factors that form a giant complex consisting of 50 or more polypeptides. True or False?

Transcription is initiated by which of the following structures/substrates in prokaryotes? a. Hairpin loop b. TBP c. Initiator d. Sigma factor e. Pre-motor

True

Transcription is, in fact, a highly selective process: individual genes are transcribed only as their products are needed. True or False?

enhancers

Transcriptional activator proteins also regulate transcription by binding to more-distant sequences called

Which class of RNA is correctly paired with its function?

Transfer RNA (tRNA): attaches to an amino acid

small interfering RNAs (siRNAs)

Triggers degradation of other RNA molecules

Cot curves can be used to examine reassociation kinetics for genomic DNA.

True

Hybrid dysgenesis is facilitated by the absence of transposition repressor activity.

True

Unlike DNA synthesis, RNA synthesis does not require a primer. True or False?

True

Unlike replication, however, the transcription of a gene takes place on only one of the two nucleotide strands of DNA. True or False?

-10

Unwinding begins within the ___ consensus sequence and extends downstream for about 14 nucleotides, including the start site (from nucleotides −12 to +2).

What is genetic variation?

Visible phenotypic differences between individuals of the same species.

The template strand is the DNA strand that is copied into an RNA molecule, whereas the nontemplate strand is not copied.

What is the difference between the template strand and the non-template strand?

What is the function of general transcription factors? a. they are DNA sequences to which RNA polymerase binds. b. they direct nucleosome assembly. c. they bind to regulatory promoters to increase the rate of transcription. d. they bind to enhancers to allow minimal levels of transcription. e. they are a part of the basal transcription apparatus.

It forms peptide bonds

What is the function of peptidyl transferase activity?

What is the function of peptidyl transferase activity? a. it charges tRNAs b. it acetylates the end of a protein after translation c. it cleaves the polypeptide from the last tRNA during termination d. it moves ribosomes along mRNA during translation e. it forms peptide bonds between amino acids

The sigma factor recognizes the promoter and controls the binding of RNA polymerase to the promoter.

What is the function of the sigma factor?

TFIID binds to the TATA box and helps to center the RNA polymerase over the start site of transcription.

What is the role of TFIID in transcription initiation?

E) a gene for a histone protein

What kind of gene would NOT be found in a chloroplast genome? A) a tRNA gene B) a gene for a subunit of the photosynthesis enzyme RuBisCO C) a gene for a ribosomal protein D) a gene for ribosomal RNA E) a gene for a histone protein

Hydrogen Bond

What types of bonds are created between nucleotides during the process of Transcription?

What types of bonds are created between nucleotides during the process of transcription? a. Ionic b. oxygen c. phosphodiester d. hydrogen e. both C and D

True

When RNA polymerase encounters the terminator, it pauses, allowing rho to catch up. The rho protein has helicase activity, which it uses to unwind the RNA-DNA hybrid in the transcription bubble, bringing transcription to an end. True or False?

True

When RNA polymerase incorporates a nucleotide that does not match the DNA template, it backs up and cleaves the last two nucleotides (including the misincorporated nucleotide) from the growing RNA chain. RNA polymerase then proceeds forward, transcribing the DNA template again. True or False?

A) The 200-base-pair-long DNA fragments represent the approximate length of DNA wrapped around the histone core. D) The result reveals the conserved composition of the nucleosome, which is the repeating unit that makes up chromatin in all eukaryotes. E) The cleavage occurs at the exposed linker region between adjacent nucleosomes that does not directly interact with the histone core.

When chromatin from any eukaryote is digested with micrococcal nuclease (an endonuclease) and fractionated using electrophoresis, DNA fragments of approximately 200 base pairs in length are observed. Which of the following statements explain(s) the observation? (Select all that apply.) A) The 200-base-pair-long DNA fragments represent the approximate length of DNA wrapped around the histone core. B) The 200-base-pair-long DNA fragment is a characteristic behavior of micrococcal nuclease on any given free DNA strand. C) The eukaryotic DNA has an enormous number of repetitive sequences, and the nuclease is cleaving certain repetitive sequences, generating these fragments. D) The result reveals the conserved composition of the nucleosome, which is the repeating unit that makes up chromatin in all eukaryotes. E) The cleavage occurs at the exposed linker region between adjacent nucleosomes that does not directly interact with the histone core.

Describe the leading and lagging strand of DNA and how it is replicated

When replication begins, the two parent DNA strands are separated. One of these is called the leading strand, and it is replicated continuously in the 3' to 5' direction. The other strand is the lagging strand, and it is replicated discontinuously in short sections.

Upstream from the transcription start site.

Where are promoters usually located in bacterial genomes?

Where are promoters usually located? a. upstream from the start site b. downstream of the start site c. near the nucleotide +25 d. near the hairpin loop e. downstream of the terminator

C) centromere

Where would you expect to find the variant histone CenH3? A) telomere B) euchromatin C) centromere D) mitochondria E) chloroplast

.In humans, autosomal monosomies are lethal early in development and only three autosomal trisomies are associated with live birth. In contrast, individuals with Turner syndrome (45,X) are monosomic for the second sex chromosome and viable individuals with up to five X chromosomes (49,XXXXX) are reported. Why are X chromosome aneuploidies generally better tolerated than autosomal aneuploidies? (6 pts)

Whereas cells with one X express most X-linked genes at ~the same level as cells with two, cells with one copy of an autosome have an ~50% reduction in the expression of all genes on that chromosome. Similarly, all but one X chromosome is silenced in mammalian somatic cells (the n - 1 rule) whereas no such mechanism exists to silence extra copies of autosomes, resulting in an ~50% increase in expression of all genes on the extra autosome but not the extra X(s).

Whereas the nucleotide strand used for transcription is termed ________, the nontranscribed strand is called the __________. a. promoter; terminator b. terminator; promoter c. transcription apparatus; TATA box d. template strand; nontemplate strand e. nontemplate strand; template strand

None

Which amino acid is coded by the stop codons in most organisms?

Which amino acid is coded by the stop codons in most organisms? a. met b. pro c. trp d. cys e. none

DNA is more stable because it lacks the free hydroxyl group on the 2'-carbon atom

Which is more stable, RNA or DNA?

B) arginine

Which of the following amino acids has a positive charge that helps to hold the DNA in contact with the histones? A) alanine B) arginine C) leucine D) valine E) serine

B) It makes up most chromosomal material and is where most transcription occurs.

Which of the following descriptions is NOT true of heterochromatin? A) It remains in a highly condensed state throughout the cell cycle. B) It makes up most chromosomal material and is where most transcription occurs. C) It exists at the centromeres and telomeres. D) It occurs along one entire X chromosome in female mammals when this X becomes inactivated. E) It is characterized by the absence of crossing over and replication late in the S phase.

B) transcriptionally inactive

Which of the following does NOT fit the description of euchromatin? A) less condensed state B) transcriptionally inactive C) chromosomal arms D) common crossing over sites

A) telomere B) centromere

Which of the following has/have repetitive DNA sequences in heterochromatin state? (Select all that apply.) A) telomere B) centromere C) mitochondria D) chloroplast

Which of the following is NOT required for transcription? a. ribonucleotides b. RNA primers c. DNA template d. RNA polymerase e. Promoter

B) the addition of methyl groups to cytosines in the promoter region of a gene

Which of the following is an example of an epigenetic change in eukaryotes? A) a loss of an AT base pair from a gene B) the addition of methyl groups to cytosines in the promoter region of a gene C) the substitution of an AT base pair by a GC base pair in a gene as a result of a mistake during DNA replication D) a deletion that simultaneously removes two genes from the genome E) None of these examples represents epigenetic changes.

Which of the following is not required during the process of tRNA charging? a. amino acid b. tRNA c. GTP d. ATP e. aminoacyl-tRNA synthetase

GTP

Which of the following is not required during the process of the tRNA charging?

Primer

Which of the following is not required for transcription?

Signals where transcription ends

Which of the following phrases does not describe a function of the promoter?

A) Most proteins in the human mitochondrion are encoded by nuclear genes.

Which of the following statements is TRUE? A) Most proteins in the human mitochondrion are encoded by nuclear genes. B) One piece of evidence supporting the endosymbiotic theory is the extreme similarity between mitochondrial DNAs from different organisms. C) Heteroplasmy refers to the presence of different alleles in a single organelle. D) Plants contain chloroplasts, not mitochondria. E) cpDNA evolves faster than nuclear DNA.

Which of the following statements describes the "wobble" rules correctly? a. There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. b. The number of genetic code exceeds the number of amino acids available in the cell. c. There are multiple tRNA that may bind to the same amino acids. d. There are multiple codons that may code for the same amino acids. e. The third base pairing between the tRNA and mRNA is relaxed.

B) Bacterial DNA is not attached to any proteins that help to compact it.

Which of the following statements is NOT true of bacterial DNA? A) Most bacterial genomes consist of a single circular DNA molecule. B) Bacterial DNA is not attached to any proteins that help to compact it. C) Bacterial DNA is confined to a region in the cell called the nucleoid. D) Many bacteria contain additional DNA in the form of small circular molecules called plasmids. E) About 3 to 4 million base pairs of DNA are found in a typical bacterial genome.

E) Oxidative phosphorylation capacity is constant throughout a person's lifetime.

Which of the following statements is NOT true? A) Both the mitochondria and the chloroplast generate ATP. B) A single eukaryotic cell may contain thousands of copies of the mitochondrial genome. C) According to the endosymbiotic theory, chloroplasts are thought to have evolved from cyanobacteria. D) The mutation rate of mitochondrial DNA is higher than the mutation rate of nuclear DNA. E) Oxidative phosphorylation capacity is constant throughout a person's lifetime.

A) maternal inheritance D) homoplasmy

Which of the following terms CORRECTLY describe(s) the inheritance pattern of mtDNA and cpDNA in eukaryotic cells? (Select all that apply.) A) maternal inheritance B) circular C) heteroplasmy D) homoplasmy E) high copy number

A) uniparental inheritance B) circular C) heteroplasmy E) high copy number

Which of the following terms describe the feature(s) of mtDNA and cpDNA that differ from the eukaryotic nuclear DNA? (Select all that apply.) A) uniparental inheritance B) circular C) heteroplasmy D) homoplasmy E) high copy number

polycistronic RNA

a group of genes is often transcribed into a single RNA molecule. Thus, polycistronic RNA is produced when a single terminator is present at the end of a group of several genes that are transcribed together, instead of each gene having its own terminator.

D) All copies of the mitochondrial genome within a cell are identical.

Which statement about mitochondrial genomes is NOT true? A) In most animals, the mitochondrial genome consists of a single circular DNA molecule. B) Plant mitochondrial genomes often include multiple circular DNA molecules. C) Each mitochondrion typically contains many copies of the mitochondrial genome. D) All copies of the mitochondrial genome within a cell are identical.

C) It has less than 10 bp per turn of its helix.

Which statement is NOT true of negatively supercoiled DNA? A) It eases the separation of nucleotide strands during replication and transcription. B) It allows DNA to be packed into small spaces. C) It has less than 10 bp per turn of its helix. D) It is more negatively charged due to additional phosphates per turn of the helix. E) It is found in most cells.

D) Approximately 145 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~160 bp.

While working on Drosophila, you find a new mutant strain with an abnormal histone H3 gene. This novel histone mutant is predicted to cause the nucleosomes to bind an extra 15 bp of DNA compared to wild type. If you digest isolated chromatin with a nuclease to release the core nucleosomes, what size DNA fragments would you expect from wild-type and mutant flies? A) Approximately 50 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~65 bp. B) Approximately 100 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~115 bp. C) Approximately 125 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~140 bp. D) Approximately 145 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~160 bp. E) The size of the DNA fragments cannot be determined.

True

Without sigma, RNA polymerase will initiate transcription at a random point along the DNA. True or False?

What is hemizygous?

X-linked genes in males, represented as A.

In mammals and Drosophila, recessive _______ mutations can always affect male phenotype.

X-linked/Y-linked/sex-linked

Name one and outline this gene's specific function. (3 pts)

Xist, initiates inactivation of the X chromosome from which it is expressed

Yeast artificial chromosomes are small DNA constructs with the telomeric, centromeric, and replication origin sequences needed for replication in yeast. Artificial chromosomes could have great promise in biotechnology by serving as vectors for genes; however, there have been difficulties in creating artificial chromosomes from other species. Given what you know about the nature of centromeres in species other than yeast, can you explain why such difficulties might have arisen?

Yeast has well-defined centromeres and expressing yeast centromeric DNA sequences result in functional centromeres that allow for segregation to take place. In many other species, however, although there seem to be short tandem repeats of DNA that are found in centromeres, there do not appear to be any sequences that absolutely characterize a centromere. In addition, many species have centromeres that span hundreds of thousands of base pairs and appear to be diffuse with spindle fibers attaching all along the chromosome. The difficulties in identifying small, functional centromeric sequences that might be used in constructing artificial chromosomes has delayed their development and use in biotechnology.

A) 10

You are studying a small eukaryotic gene of about 2000 bp in length. Estimate how many copies of histone H1 you would find along this region of the chromosome. A) 10 B) 20 C) 40 D) 80 E) 100

B) 20

You are studying a small eukaryotic gene of about 2000 bp in length. Estimate how many copies of histone H4 you would find along this region of the chromosome. A) 10 B) 20 C) 40 D) 80 E) 100

You conduct a series of crosses in your favorite model system, Drosophila, with the goal of making a genetic map involving three genes that are linked on chromosome 2: no-hoper (nh), feckless (f), and deadbeat (db). You obtain the following results:

[db, nh, f also correct; mu instead of cM also correct] Draw the genetic map based on these results. Be sure to include genetic distances and units. (1pt)

1. All DNA polymerases synthesize new DNA by adding nucleotides to the _____ of the growing DNA chain. a. 3′ OH b. 5′ OH c. 3′ phosphate d. 5′ phosphate e. nitrogenous base

19. What is the function of DNA ligase? a. Connects Okazaki fragments by sealing nicks in the sugar- phosphate backbone b. Unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork c. Reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding d. Binds to oriC and causes a short section of DNA to unwind e. Prevents the formation of secondary structures within single-stranded DNA

2. Okazaki fragments are found in all of the following EXCEPT a. leading strand. b. lagging strand. c. eukaryotic DNA. d. bacterial DNA. e. linear replication models.

29. If a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I is produced. What will be the most likely consequence of this mutation? a. The DNA strands would contain pieces of RNA. b. The DNA would not exist in a supercoiled state. c. There would be no DNA replication on the leading or lagging strands. d. There would be no RNA primers laid down. e. The DNA will not be able to unwind to initiate replication.

37. Which of the following best describes heteroduplex DNA? a. A single-stranded DNA molecule of one chromosome pairs with a single-stranded DNA molecule of another chromosome. b. A single-stranded DNA molecule of one chromosome pairs with a single-stranded RNA molecule of another chromosome. c. DNA that consists of sequences from two different species brought together through homologous recombination. d. DNA that consists of an RNA primer and newly synthesized DNA on the lagging strand. e. Newly synthesized DNA that has yet to be reassembled into nucleosomes.

4. Which of the following typically only has one origin of replication? a. Prokaryotes b. Eukaryotes c. Linear model of replication d. Humans e. Plants

promoter

a DNA sequence that the transcription apparatus recognizes and binds. It indicates which of the two DNA strands is to be read as the template and the direction of transcription. The promoter also determines the transcription start site, the first nucleotide that will be transcribed into RNA. In most transcription units, the promoter is located next to the transcription start site but is not, itself, transcribed.

In order to leave the nucleus, most mature mRNA needs

a cap and tail

basal transcription apparatus

a group of proteins that assemble near the start site and are sufficient to initiate minimal levels of transcription. So general transcription factors + RNA polymerase =

RNA interference (RNAi)

a process in which these small RNA molecules help trigger the degradation of mRNA or inhibit its translation into protein.

The regulatory region immediately upstream (5') of the transcription start site of a gene is called

a promoter

RNA-coding region

a sequence of DNA nucleotides that is copied into an RNA molecule.

terminator

a sequence of nucleotides that signals where transcription is to end. Terminators are usually part of the RNA-coding sequence; that is, transcription stops only after the terminator has been copied into RNA.

You are doing some genome annotation. In what order (reading from 5' to 3') would you expect to find the following in association with a eukaryotic protein-coding gene? (You can just put the letters in order but you may find it helpful to make a diagram and add the letters to that.) (2pts) a) Binding site for a gene-specific transcription factor, b) first exon, c) first intron, d) 5' splice site for second intron, e) poly-A tail, f) TATA box, g) translation stop codon, h) transcription initiation sequence, i) 3' splice site for first intron

a) Binding site for a gene-specific transcription factor f) TATA box h) transcription initiation sequence b) first exon c) first intron i) 3' splice site for first intron g) translation stop codon e) poly-A tail

Which of the following will likely have a larger effect on protein function? a) A single base deletion in the DNA sequence that encodes an exon. b) A three base deletion in the DNA sequence encoding the same exon. Explain why you chose a) or b). (4 pts)

a) because a single base deletion would change the identity of the codon and all codons that followed, whereas a three base deletion would remove a whole codon but wouldn't affect those that followed if it was in the same reading frame.

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.) a. The RNA sugar is ribose instead of deoxyribose. b. RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. c. The bases in RNA include uracil instead of thymine. d. RNA nucleotides are generally less chemically stable than DNA. e. The 2'-carbon of ribose has an H, unlike the OH in that position of deoxyribose.

a,b,c,d

30. What is the total number of chromosomes in a polar body cell from a rat? a. 21 b. 40 c. 41 d. 42 e. 84

a. 21

12. The nuclear genome of a single human cell (i.e., the entire diploid complement) contains about 6.6 billion (6.6 × 109) base pairs of DNA. If synthesis at each replication fork occurs at an average rate of 50 nucleotides per second, all the DNA is replicated in 5 minutes. Assume that replication is initiated simultaneously at all origins. How many origins of replication exist in a human diploid genome? a. 220,000 b. 440,000 c. 880,000 d. 2.64 x 107 e. 1.32 x 108

a. 220,000

1. All DNA polymerases synthesize new DNA by adding nucleotides to the _____ of the growing DNA chain. a. 3′ OH b. 5′ OH c. 3′ phosphate d. 5′ phosphate e. nitrogenous base

a. 3′ OH

13. The nuclear genome of a single human cell (i.e., the entire diploid complement) contains about 6.6 billion (6.6 × 109) base pairs of DNA. If synthesis at each replication fork occurs at an average rate of 50 nucleotides per second, all the DNA is replicated in 5 minutes. Assume that replication is initiated simultaneously at all origins. Assuming that the origins are approximately equally distributed across the chromosomes, what is the average number of origins per human chromosome? a. 4783 b. 19,130 c. 4.6 x 106 d. 1.21 x 109 e. 2.9 x 1010

a. 4783

Give the inverted repeat of the following sequences: a. 5'-ATCCGCT-3' 3'-TAGGCGA-5' b. 5'-AAATTT-3' 3'-TTTAAA-5' c. 5'-GGAATTCC-3' 3'-CCTTAAGG-5'

a. 5'-AGCGGAT-3' 3'-TCGCCTA-5' (inverted; non-palindrome) b. 5'-AAATTT-3' 3'-TTTAAA-5' (inverted; palindrome) c. 5'-GGAATTCC-3' 3'-CCTTAAGG-5' (inverted; palindrome) Note that sequences (b) and (c) are identical when read 5'␣ 3' (top strand), or 3'␣ 5' (bottom strand). Sequences like this are called palindrome sequences and are characteristic of restriction enzyme recognition/cleavage sites.

You perform interrupted-mating experiments on three Hfr strains (A, B, and C). Genes are transferred (from last to first) in the following order from each strain: strain A, thi-his-gal-lac-pro; strain B, azi-leu-thr-thi-his; strain C, lac-gal-his-thi-thr. How are the F factors in these strains oriented? a. A and B are cooriented. b. B and C are cooriented. c. A and C are cooriented. d. All of them are cooriented.

a. A and B are cooriented.

a. A single-stranded DNA molecule of one chromosome pairs with a single-stranded DNA molecule of another chromosome.

a. Connects Okazaki fragments by sealing nicks in the sugar- phosphate backbone

The following table shows Chargaff's data that demonstrate base composition of DNA from different biological sources. Source A T G C E. coli 26.0 23.9 24.9 25.2 Yeast 31.3 32.9 18.7 17.1 Sea urchin 32.8 32.1 17.7 18.4 Rat 28.6 28.4 21.4 21.5 Human 30.3 30.3 19.5 19.9 Which of the following is NOT a general conclusion that is supported by these data? a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence. b. The amount of adenine is always equal to the amount of thymine. c. The amount of guanine is always equal to the amount of cytosine. d. Although the ratio of A/T and G/C is the constant, the relative amount of any particular base varies between species. e. (A + G) / (T + C) = 1

a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence.

1. Which of the following statements is false? a. Errors in chromosome separation are rarely a problem for an organism. b. Errors in chromosome separation can result in a miscarriage. c. Errors in chromosome separation can result in cancer. d. Errors in chromosome separation can result in a child with severe handicaps. e. Errors in chromosome separation can cause numerous problems for an organism.

a. Errors in chromosome separation are rarely a problem for an organism

Here is the regulatory region and first two exons of a six exon eukaryotic gene. Indicate where the sites and structures listed below would go by writing the letter that identifies that site or structure. Note that not all terms will be used. (5 pts) Here is the regulatory region and first two exons of a six exon eukaryotic gene. Indicate where the sites and structures listed below would go by writing the letter that identifies that site or structure. Note that not all terms will be used. (5 pts)

a. Exon 1 b. Translation start c. Core promoter d. Distal promoter. Transcription start g. TATA binding protein binding site h. 3' end i. 5' end j. 7-methylguanicine cap k. Exon 2 l. Intron 1 m. General transcription factor binding site n. Intron 2

A bacterial cell transfers chromosomal genes to F- cells, but it rarely causes them to become F+. The bacterial cell is: a. Hfr. b. lysogenic. c. auxtrophic. d. lytic.

a. Hfr

4. Which of the following typically only has one origin of replication? a. Prokaryotes b. Eukaryotes c. Linear model of replication d. Humans e. Plants

a. Prokaryotes

a. The DNA strands would contain pieces of RNA

n a eukaryotic cell, two different transposons, each containing an intron, excise and insert in different locations within the genome. After transposition, the transposons are sequenced at their new sites. Explain the following sequencing results: a. Neither of the translocated transposons contains any intron sequences. b. One of the transposons contains the intron, but the other transposon does not.

a. The transposition process itself must result in loss of the introns. It is therefore likely that, in this case, the transposition process involves transcription, and the elements moved via RNA intermediates (e.g., retrotransposons). b. Retention of the intron in one transposon suggests that this particular transposon moved through a DNA intermediate (i.e., not transcription dependent), and therefore didn't require an RNA intermediate.

Why were bacteriophages used in the Hershey-Chase experiment? (Select all that apply.) a. They had a protein coat and an internal DNA molecule. b. They had a DNA coat and an internal protein molecule. c. Their proteins and DNA were mixed together. d. They injected protein inside bacterial cells. e. They injected their genetic material into bacterial cells.

a. They had a protein coat and an internal DNA molecule e. They injected their genetic material into bacterial cells.

38. Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA? a. circle a b. circle b c. circle c

a. circle a

Which circle shows a phosphodiester bond? a. circle a b. circle b c. circle c d. circle d

a. circle a

Cotransformation between two genes is more likely if they are: a. close to one another. b. far apart from one another. c. both next to the F factor. d. both oriented in the same direction.

a. close to one another

10. The process of splitting the cytoplasm, which separates one cell into two, is termed a. cytokinesis. b. mitosis. c. anaphase. d. diakinesis. e. fusion.

a. cytokinesis.

16. Chromosome movement during anaphase is a result of a. disassembly of tubulin molecules by molecular motor proteins. b. kinetochore shortening causing chromosomes to pull apart. c. metaphasal plate splitting resulting in chromosomal disassembly. d. the cohesion protein attaching to the centromeres of sister chromatids. e. cilia movement inside the cellular structure.

a. disassembly of tubulin molecules by molecular motor proteins.

How does histone acetylation affect chromatin? a. It loosens the chromatin and allows increased transcription. b. It allows DNA to become resistant to damage. c. It helps the histones have a greater affinity for DNA. d. It inhibits DNA replication by making it more difficult to separate the DNA strands. e. It causes the chromatin to become more condensed in preparation for metaphase.

a. it loosens the chromatin and allows increased transcription

2. Okazaki fragments are found in all of the following EXCEPT a. leading strand. b. lagging strand. c. eukaryotic DNA. d. bacterial DNA. e. linear replication models

a. leading strand

24. In a flowering plant, the male part of the flower (the stamen) produces haploid microspores that divide by _____to produce sperm. a. mitosis b. meiosis c. gametogenesis d. spermatogenesis e. fertilization

a. mitosis

A tRNA gene is an example of which type of DNA sequence in eukaryotes? a. moderately repetitive DNA b. highly repetitive DNA c. short interspersed elements d. long interspersed elements e. unique-sequence DNA

a. moderately repetitive DNA

5. In eukaryotes, chromosomes do not contain a. ribosomes. b. chromatin. c. proteins. d. histones. e. DNA.

a. ribosomes

An in vitro transcription system that contains a bacterial gene initiates transcription, but from random points on the DNA. Which of the following proteins most likely is missing from the reaction? a. sigma factor b. rho factor c. RNA polymerase II d. TATA-binding protein

a. sigma factor

The Holliday model refers to homologous recombination and involves ___. a. single-strand breaks b. homologous recombination c. end replication d. double-strand breaks e. rolling-circle replication

a. single-strand breaks

What is the function of eukaryotic RNA polymerase I? a. transcription of rRNA genes b. transcription of mRNA genes c. transcription of tRNA genes d. transcription of snRNAs e. initiation of transcription (but not elongation)

a. transcription of rRNA genes

All about the human genome (2pts): a) ~ How many protein-coding genes does the human genome contain?

about 20,000

Genetics as a discipline can be subdivided into all of the following EXCEPT: A. transmission genetics. B. acquisition genetics. C. molecular genetics. D. population genetics. E. Actually, all of these are found in the discipline.

acquisition genetics.

Arrange the following taxa with respect to the total size of their genomes: human, fruit fly, lily, amoeba, bacteria.

amoeba > lily > human > fruit fly > bacteria

amino acids bind to which part of the tRNA? a. anticodon b. DHU arm c. 3' end d. 5' end e. the green wobbly thingy

Histone methylation is

an example of posttranslational modification

Rho-independent terminators (also known as intrinsic terminators)

are able to cause the end of transcription in the absence of rho.

Rho-dependent terminators

are able to cause the termination of transcription only in the presence of an ancillary protein called the rho factor.

pre-messenger RNAs (pre-mRNAs)

are the immediate products of transcription in eukaryotic cells. Pre mRNAs are modified extensively before becoming mRNA and exiting the nucleus for translation into protein.

11. You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses theta replication, how long will it take to replicate its genome? a. 7.5 seconds b. 15 seconds c. 30 seconds d. 1 minute e. 2 minutes

23. What type of bonds does DNA ligase create between adjacent nucleotides? a. Hydrogen b. Phosphodiester c. Ionic d. Metallic e. Ribonucleotide

24. The proofreading function of DNA polymerases involves a. 5′ → 3′ exonuclease activity. b. 3′ → 5′ exonuclease activity. c. 5′ → 3′ telomerase activity. d. 3′ → 5′ telomerase activity. e. 5′ → 3′ gyrase activity.

3. Which of the following does NOT utilize bidirectional replication? a. Theta model b. Rolling circle model c. Linear model d. Eukaryotes e. Bacteria

31. For which of the following is the "end-replication problem" relevant? a. Circular DNA b. Linear chromosomes c. The centromere region of a chromosome d. Rolling circle model of replication e. Theta model of replication

33. _______ are tandemly repeated DNA sequences located at the ends of eukaryotic chromosomes. a. Replication bubbles b. Telomeres c. Nucleosomes d. Licensing factors e. Holliday junctions

36. What would be a likely result of expressing telomerase in somatic cells? a. Premature aging b. Cancer c. Lower rates of replication d. Immortality of gametes e. Early termination of replication

39. The Holliday model describes which process? a. Semiconservative replication b. Homologous recombination c. End replication d. RNA primer synthesis e. Rolling-circle replication

5. Meselson and Stahl showed that DNA is replicated by a __________ system. a. conservative b. semiconservative c. dispersive d. semidispersive e. conservative in prokaryotes and dispersive in eukaryotes

b. 15 seconds

You are studying a small eukaryotic gene of about 2000 bp in length. Estimate how many copies of histone H4 you would find along this region of the chromosome. a. 10 b. 20 c. 40 d. 80 e. 100

b. 20

1. The proofreading function of DNA polymerases involves a. 5′ → 3′ exonuclease activity. b. 3′ → 5′ exonuclease activity. c. 5′ → 3′ telomerase activity. d. 3′ → 5′ telomerase activity. e. 5′ → 3′ gyrase activity.

b. 3′ → 5′ exonuclease activity.

29. A What is the total number of chromosomes present in the cell during metaphase I of meiosis? a. 21 b. 42 c. 84 d. 126 e. 168

b. 42

How many complete rotations would MOST likely correspond to a negatively supercoiled DNA molecule that is 100 bp in length? a. 0 b. 5 c. 10 d. 15 e. 100b.

b. 5

19. Pea plants have seven different types of chromosomes. The nucleus of a megaspore in a pea ovary would contain how many chromosomes? a. 3 ½ b. 7 c. 14 d. 21 e. 30

b. 7

The following diagram represents two nonhomologous chromosomes: A B • C D E F G R S • T U V W X Which one of the following chromosome mutation is nonreciprocal translocation? a. A B • C D X R S • T U V W E F G b. A U V B • C D E F G R S • T W X c. A B • T U V F G R S • C D E W X d. A B • C W G R S • T U V D E F X

b. A U V B • C D E F G R S • T W X

Which is a mechanism that allows a single gene to encode more than one polypeptide? a. Regulation of mRNA stability b. Alternative RNA splicing c. RNA interference d. Reverse transcription

b. Alternative RNA splicing

3. Which statement is true? a. Eubacteria are more closely related to archaea than they are to eukaryotes. b. Archaea are more closely related to eukaryotes than they are to eubacteria. c. Eukaryotes are more closely related to eubacteria than they are to archaea. d. Viruses are more closely related to prokaryotes than they are to eukaryotes. e. Eubacteria, archaea, and eukaryotes are all equally related.

b. Archaea are more closely related to eukaryotes than they are to eubacteria

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. You wish to discover which of the three molecules could be the genetic material. The classic experiment of which of the following scientists would be the MOST appropriate to mimic? a. Hershey, Chase b. Avery, MacLeod, McCarty c. Franklin d. Griffith e. Chargaff

b. Avery, MacLeod, McCarty

Which of the following statements is NOT true of bacterial DNA? a. Most bacterial genomes consist of a single circular DNA molecule. b. Bacterial DNA is not attached to any proteins that help to compact it. c. Bacterial DNA is confined to a region in the cell called the nucleoid. d. Many bacteria contain additional DNA in the form of small circular molecules called plasmids. e. About 3 to 4 million base pairs of DNA are found in a typical bacterial genome.

b. Bacterial DNA is not attached to any proteins that help to compact it.

36. What would be a likely result of expressing telomerase in somatic cells? a. Premature aging b. Cancer c. Lower rates of replication d. Immortality of gametes e. Early termination of replication

b. Cancer

21. DNA synthesis during replication is initiated from a. a free 5′ OH. b. DNA primers. c. RNA primers. d. telomerase. e. DNA polymerase I.

b. DNA primers

13. If a healthy cell passes the G1/S checkpoint, a. it will enter the G0 stage of the cell cycle. b. DNA will be replicated. c. it will not divide. d. it will proceed immediately to cytokinesis. e. it will die.

b. DNA will be replicated.

21. What process is unique to plants? a. Meiosis b. Double fertilization c. Crossing over d. Haploid gametes e. Spermatogenesis

b. Double fertilization

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ to result in different denaturation temperatures? a. Fragment A has a higher C+C content than fragment B. b. Fragment B has a higher C+G content than fragment A. c. Fragment A has a secondary structure of B form, while fragment B is an A form. d. Fragment B is methylated more than fragment A.

b. Fragment B has a higher C+G content than fragment A

69. What is the difference in hydrogen bonding between A/T pairs versus G/C pairs? a. A/T pairs have one more hydrogen bond than G/C pairs. b. G/C pairs have one more hydrogen bond than A/T pairs. c. A/T pairs have two more hydrogen bonds than G/C pairs. d. G/C pairs have two more hydrogen bonds than A/T pairs. e. G/C pairs have three more hydrogen bonds than A/T pairs.

b. G/C pairs have one more hydrogen bond than A/T pairs.

39. The Holliday model describes which process? a. Semiconservative replication b. Homologous recombination c. End replication d. RNA primer synthesis e. Rolling-circle replication

b. Homologous recombination

Which of the following descriptions is NOT true of heterochromatin? a. It remains in a highly condensed state throughout the cell cycle. b. It makes up most chromosomal material and is where most transcription occurs. c. It exists at the centromeres and telomeres. d. It occurs along one entire X chromosome in female mammals when this X becomes inactivated. e. It is characterized by the absence of crossing over and replication late in the S phase.

b. It makes up most chromosomal material and is where most transcription occurs

b. Linear chromosomes

23. What type of bonds does DNA ligase create between adjacent nucleotides? a. Hydrogen b. Phosphodiester c. Ionic d. Metallic e. Ribonucleotide

b. Phosphodiester

An intron is a section of a. protein that is clipped out post-translationally. b. RNA that is removed during RNA processing. c. DNA that is removed during DNA processing. d. transfer RNA that binds to the anticodon. e. carbohydrate that serves as a signal for RNA transport.

b. RNA that is removed during RNA processing.

Why was the idea that genes are made of nucleic acids NOT widely accepted until after 1950? a. Proteins are more abundant than nucleic acids, so it seemed more logical that proteins would carry genetic information. b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear. c. Amino acids existed in the prebiotic environment, so they would have most likely been the first to carry genetic information for life. d. DNA was not chemically stable for long enough to be a good method of storing genetic information. e. Nothing was known about the chemistry of DNA until after 1950.

b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.

Telomerase is a ribonucleoprotein that is an enzyme which adds DNA sequence repeats ("TTAGGG" in all vertebrates) to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. It ___________________________________. a. can synthesize telomere DNA without a primer. b. carries its own RNA molecule as a template for telomere extension. c. uses a protein as a primer to extend the telomere. d. is a RNA polymerase. e. none of the above.

b. carries its own RNA molecule as a template for telomere extension.

9. The attachment point on the chromosome for spindle microtubules is the a. telomere. b. centromere. c. origin of replication. d. sister chromatid. e. allele.

b. centromere.

14. How did Albert Kossel contribute to our understanding of DNA? a. used X-ray diffraction to examine the structure of DNA b. determined that DNA contains four different nitrogenous bases c. found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. found that the phosphorus-containing components are the genetic material of phages e. discovered "the transforming principle" that could genetically alter bacteria

b. determined. that DAN contains four different nitrogen bases

The agouti locus helps determine coat color in mice, and this phenotype can vary from light to dark between genetically identical individuals. You have discovered a drug that reduces the variation in the agouti phenotype. What is a likely explanation for this drug's mechanism of action? a. It inhibits DNA polymerases. b. It inhibits DNA methyltransferases. c. It activates shelterin proteins. d. It activates mitochondrial transcription. e. It causes DNA damage.

b. it inhibits DNA methyltransferases

During gene expression, which molecule(s) carries the information that encodes polypeptides? a. tRNA b. mRNA c. rRNA d. snRNA e. More than one of the above

b. mRNA

During replication, the short single-stranded stretches of DNA that are created on the lagging strand are called A. Leading strand B. Okazaki fragment C. Promoter D. Poly A tail

b. okazaki fragment

A normal chromosome in a higher eukaryotic species would NOT be expected to contain: a. one centromere. b. one copy of telomere. c. two copies of histone 2A per nucleosome. d. satellite DNA. e. tandem repeat sequences.

b. one copy of telomere

7. In prokaryotes, replication usually begins at a specific place on the chromosome called the a. binary fission site. b. origin of replication. c. origin of mitosis. d. anchoring site. e. kinetochore.

b. origin of replication.

Which of the following elements is found in both prokaryotes and eukaryotes? A. Introns B. Promoters C. 5'-capping D. RNA splicing

b. promoters

b. semiconservative

The most common aneuploidy seen in living humans has to do with ___________. a. autosomes b. sex chromosomes c. chromosome 1 d. chromosome 13

b. sex chromosomes

17. What is the function of DNA gyrase? a. Connects Okazaki fragments by sealing nicks in the sugar- phosphate backbone b. Unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork c. Reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding d. Binds to oriC and causes a short section of DNA to unwind e. Prevents the formation of secondary structures within single-stranded DNA

Crossing over takes place when?

between non-sister chromatids in meiosis, prophase I

Xist in mammals and Sxl in Drosophila are similar genes because

both are regulators of dosage compensation

9. You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation results, what type of replication would you propose for these new bacteria? a. Conservative b. Semiconservative c. Dispersive d. Semiconservative or Dispersive e. Conservative or Dispersive

11. In order to be functional, a eukaryotic chromosome requires all of the following except a. a centromere. b. origins of replication. c. a plasmid. d. telomeres.

c. a plasmid.

25. A pollen grain that lands on a stigma grows a pollen tube to deliver ___ (how many?) sperm to the ovary. Fusion of a sperm with an egg produces a ___ n cell called a___. a. 1; 1; zygote b. 2; 1; megasporocyte c. 2; 2; zygote d. 1; 2; microsporocyte e. 1; 2; megasporocyte

c. 2; 2; zygote

If the sequence of one strand of DNA is 5'-GCTAGCGTCG-3', what is the sequence of the complementary strand? a. 3'-GCTAGCGTCG-5' b. 5'-GCTGCGATCG-3' c. 3'-CGATCGCAGC-5' d. 5'-CGATCGCAGC-3' e. 5'-CGAUCGCAGC-3'

c. 3'-CGATCGCAGC-5'

c. 30 seconds

26. To provide food for the developing embryo, a tissue called endosperm is produced through double fertilization. Endosperm has a ploidy of a. 1n. b. 2n. c. 3n. d. 4n. e. 5n.

c. 3n

Which activity is not associated with DNA polymerases? a. Ability to "read" a template and incorporate appropriate nucleotides in the growing strand b. 5' to 3' synthesis of the new strands c. Ability to initiate DNA synthesis from scratch without a primer d. 3' to 5' exonuclease e. Proofreading

c. Ability to initiate DNA synthesis from scratch without a primer

6. What type of synthesis occurs on the leading strand? a. Conservative b. Dispersive c. Continuous d. Discontinuous e. Recombination

c. Continuous

25. DNA primase requires a ____ template and _____ nucleotides to initiate primer synthesis. a. DNA; DNA b. RNA; RNA c. DNA; RNA d. RNA; DNA e. leading strand; DNA

c. DNA; RNA

4. Which of the following statements is false? a. Generally, chromosomes of prokaryotes are circular. b. Prokaryotes usually have a single molecule of DNA. c. Generally, chromosomes of eukaryotes are circular. d. Eukaryotes usually have multiple chromosomes.

c. Generally, chromosomes of eukaryotes are circular.

15. Which of the following enzymes do NOT aid in unwinding of DNA for replication? a. Helicase b. Single-stranded binding proteins c. Primase d. Gyrase e. Topoisomerase

c. Primase

c. Reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding

c. Some DNA polymerases have the ability to function in DNA repair mechanisms.

20. Which of the following is a protein that facilitates the termination of replication in E. coli? a. Telomerase b. DNA gyrase c. Tus d. Primase e. Topoisomerase

c. Tus

2. Which of these are NOT prokaryotes? a. Eubacteria b. Archaea c. Viruses d. Ancient bacteria

c. Viruses

A high-resolution X-ray diffraction technique was used to obtain detailed secondary structure of a DNA molecule. The characteristics of the DNA showed it was a left-handed helix with a general shape that was longer and narrower than the classic Watson-Crick model of DNA. Which form of DNA was resolved? a. A-DNA b. B-DNA c. Z-DNA d. H-DNA e. single-stranded DNA

c. Z-DNA

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA? a. used X-ray diffraction to examine the structure of DNA b. determined that DNA contains four different nitrogenous bases c. found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. found that the phosphorus-containing components are the genetic material of phages e. discovered "the transforming principle" that could genetically alter bacteria

c. found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA

Which of the following is NOT characteristic of A-form DNA compared to B- or Z-form DNA? a. has right-handed helices b. exists when less water is present c. is long and narrow d. has 50% purines, 50% pyrimidines

c. is long and narrow

The loss of a single chromosome is called: a. tetrasomyl. b. trisomy. c. monosomy. d. nullisomy. e. None of the above.

c. monosomy.

The DNA replication enzyme that most closely resembles RNA polymerase is a. DNA polymerase I. b. DNA polymerase III. c. primase. d. telomerase. e. helicase.

c. primase.

How did Chargaff's rules contribute to Watson and Crick's elucidation of the structure of DNA? a. The rules suggested an equal concentration of sugars and phosphates. b. The rules suggested the amounts of all four bases were equal. c. The rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine. d. The rules suggested that each base corresponds to an amino acid.

c. the rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine

12. Diploid cells are cells with a. a single set of chromosomes. b. circular chromosomes. c. two sets of chromosomes. d. many sets of chromosomes. e. three sets of chromosomes

c. two sets of chromosomes.

Mutations

can be a source of adaptive phenotypes

RNA polymerase

carries out all the required steps of transcription

Messenger RNA (mRNA)

carries the coding instructions for polypeptide chains from DNA to a ribosome. (the message). After attaching to the ribosome, an mRNA molecule specifies the sequence of the amino acids in a polypeptide chain and provides a template for joining amino acids.

core enzyme

catalyzes the elongation of the RNA molecule by the addition of RNA nucleotides.

sigma (σ) factor

controls the binding of RNA polymerase to the promoter. σ factor binds to promoter to recruit RNA polymerase.

What is topoisomerase?

corrects "overwinding" ahead of replication forks by breaking, swiveling, and rejoining DNA strands

The best way to maximize the number of tortoiseshell kittens in a litter is to

cross an orange female to a black male

Which diagram shows a nucleotide as it would appear in DNA? a. diagram A b. diagram B c. diagram C d. diagram D e. diagram E

d. diagram d

16. DNA polymerase I and DNA polymerase III both have ______but only DNA polymerase I has _______. a. 5′→ 3′ exonuclease activity; 3′→5′ exonuclease activity b. 5′→ 3′ polymerase activity; 3′→5′ polymerase activity c. 3′→5′ polymerase activity; 5′→ 3′ polymerase activity d. 3′→5′ exonuclease activity; 5′→ 3′ exonuclease activity e. 5′→ 3′ polymerase activity; 3′→5′ exonuclease activity

22. DNA polymerases require all of the following for DNA replication, EXCEPT a. DNA template. b. primer. c. free 3′ OH. d. 3′ to 5′ polymerase activity. e. dNTPs.

26. Which one of the following statements is not true for all E. coli DNA polymerases? a. They require a primer to initiate synthesis. b. They use dNTPs to synthesize new DNA. c. They produce newly synthesized strands that are complementary and antiparallel to the template strands. d. They possess 5′ → 3′ exonuclease activity. e. They synthesize in the 5′ → 3′ direction by adding nucleotides to a 3′-OH group.

27. Which activity is NOT associated with DNA polymerases? a. Ability to attach a DNA nucleotide to the 3′ end of previously incorporated DNA nucleotide b. Ability to excise a newly incorporated nucleotide that does not match the template strand c. Ability to "read" a template strand 3′ to 5′ and synthesize a complementary strand d. Ability to synthesize a DNA from scratch without a primer e. Ability to synthesize new DNA in a 5′ to 3′ direction

30. Telomerase activity is most likely to be found in which cells in humans? a. Red blood cells b. Muscle cells c. Neurons d. Germ line e. Any type of somatic cell

34. Which of the following is TRUE regarding nucleosome formation during DNA replication? a. Nucleosomes are only reassembled on the lagging strand. b. Nucleosome assembly consists entirely of newly synthesized histones. c. Nucleosome assembly occurs at a faster rate in prokaryotes than in eukaryotes. d. The addition of newly synthesized histones is a part of nucleosome assembly. e. Nucleosome assembly does not occur during semiconservative replication.

32. Telomerase uses _____________ to synthesize new DNA. a. exonuclease activity b. a licensing factor c. strand invasion d. a DNA template e. an RNA template

If a diploid species (2n) has 52 chromosomes, how many chromosomes would a tetraploid have? a. 26 b. 52 c. 78 d. 104 e. 156

d. 104

22. Suppose that a diploid cell contains 8 chromosomes (2n = 8). How many different combinations in the gametes are possible? a. 2 b. 4 c. 8 d. 16 e. 64

d. 16

20. Pea plants have seven different types of chromosomes. A nucleus in the pea endosperm contains how many chromosomes? a. 3 ½ b. 7 c. 14 d. 21 e. 30

d. 21

22. DNA polymerases require all of the following for DNA replication, EXCEPT a. DNA template. b. primer. c. free 3′ OH. d. 3′ to 5′ polymerase activity. e. dNTPs.

d. 3′ to 5′ polymerase activity.

d. 3′→5′ exonuclease activity; 5′→ 3′ exonuclease activity

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5′ GTACCGTC 3′ a. 5′ GUACCGUC 3′ b. 5′ GACGGTAC 3′ c. 5′ CAUGGCAG 3′ d. 5′ GACGGUAC 3′ e. 5′ GUCGGUAC 3′

d. 5′ GACGGUAC 3′

Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? a. A + T = G + C b. (A + T)/(C + G) =1. 0 c. A/C=G/T d. A/G=T/C

d. A/G=T/C

d. Ability to synthesize a DNA from scratch without a primer

. Indicate which of the following statements is FALSE. a. Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure. b. Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring. c. Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria. d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses. e. The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.

d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.

The following figure shows the results of interrupted-mating experiments with 3 different Hfr strains. What is the order of the genes, starting with C? Hfr strain Order of transfer 1 A, B, E, D, F 2 D, F, C, G, A 3 D, E, B, A, G a. C, G, A, D, F, B, E b. C, F, D, B, A, E, G c. C, B, E, D, F, G, A d. C, G, A, B, E, D, F e. C, D, F, G, A, B, E

d. C, G, A, B, E, D, F

What type of secondary structure is formed by the pairing of three strands of DNA? a. A-DNA b. B-DNA c. C-DNA d. H-DNA e. Z-DNAd

d. H-DNA

18. A dividing eukaryotic cell is treated with a drug that inhibits the molecular motors associated with kinetochores. At which cell cycle stage would it stop? a. G1 b. S c. G2 d. M (metaphase) e. M (telophase

d. M (metaphase)

Which statement about RNA polymerase is not true? a. RNA polymerase can initiate RNA synthesis from scratch and does not require a primer. b. RNA polymerase synthesizes RNA 5' to 3'. c. RNA polymerase reads DNA 3' to 5'. d. RNA polymerase normally transcribes both strands of DNA during expression of a particular gene. e. RNA polymerase must bind to a promoter in order to initiate transcription.

d. RNA polymerase normally transcribes both strands of DNA during expression of a particular gene.

Indicate which of the following statements is TRUE. a. There are three phosphates between each sugar in a molecule of DNA. b. A-, B-, and Z-form DNA are all right-handed helices. c. There are three hydrogen bonds between A-T pairs. d. Ribose sugars have a hydroxyl on the 2¢-carbon. e. All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25% C.

d. Ribose sugars have a hydroxyl on the 2¢-carbon.

1. Which of the following is TRUE regarding nucleosome formation during DNA replication? a. Nucleosomes are only reassembled on the lagging strand. b. Nucleosome assembly consists entirely of newly synthesized histones. c. Nucleosome assembly occurs at a faster rate in prokaryotes than in eukaryotes. d. The addition of newly synthesized histones is a part of nucleosome assembly. Nucleosome assembly does not occur during semiconservative replication

d. The addition of newly synthesized histones is a part of nucleosome assembly

14. Which of the following does NOT occur during the G2 phase of the cell cycle? a. The G2/M checkpoint is reached. b. DNA replication and error checking is completed. c. The cell completes preparation for mitosis. d. The cell divides.

d. The cell divides.

Which one of the following statements is not true for all E. coli DNA polymerases? a. They require a primer to initiate synthesis. b. They use dNTPs to synthesize new DNA. c. They produce newly synthesized strands that are complementary and antiparallel to the template strands. d. They possess 5′ 3′ exonuclease activity. e. They synthesize in the 5′ 3′ direction by adding nucleotides to a 3′-OH group.

d. They possess 5′ 3′ exonuclease activity.

6. Prokaryotic chromosomes do not have telomeres because they a. do not go through mitosis. b. do not go through DNA replication. c. are in the cytoplasm. d. are circular. e. have no centromeres.

d. are circular.

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA? a. used X-ray diffraction to examine the structure of DNA b. determined that DNA contains four different nitrogenous bases c. found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. found that the phosphorus-containing components are the genetic material of phages e. discovered "the transforming principle" that could genetically alter bacteria

d. found that the phosphorus-containing components are the genetic material of phages

The activity of which enzyme or protein would be needed to unwind the double helix during DNA replication? a. Gyrase b. DNA polymerase c. DNA ligase d. Helicase e. Primase

d. helicase

Most cases of Down syndrome arise from: a. inversions. b. deletions. c. X-rays. d. maternal nondisjuction. e. unequal crossing over.

d. maternal nondisjuction.

14. Suppose Meselson and Stahl had obtained the following results in their experiment. These results would be consistent with which model of replication? a. Conservative replication only b. Semiconservative and conservative replication c. Semiconservative replication only d. Dispersive replication only e. Semiconservative and dispersive replication

18. What is the function of single-strand-binding proteins? a. Connects Okazaki fragments by sealing nicks in the sugar- phosphate backbone b. Unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork c. Reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding d. Binds to oriC and causes a short section of DNA to unwind e. Prevents the formation of secondary structures within single-stranded DNA

28. If ribonucleotides were depleted from a cell during S phase, how would DNA synthesis be affected? (Ignore energetic considerations.) a. There would be no effect because ribonucleotides are used in RNA synthesis, not DNA synthesis. b. DNA synthesis would continue, but at a slower rate. c. There would only be an effect during M phase, not in S phase. d. DNA synthesis would not be affected because ribonucleotides are only used during the process of transcription. e. Replication would cease because ribonucleotides are required to initiate DNA synthesis.

38. Which of the following is a necessary step in the Holliday model of recombination? a. DNA primase generates an RNA primer. b. The RNA template of telomerase binds to the telomere. c. Topoisomerases aid in supercoiling. d. DNA polymerase α initiates DNA synthesis. e. A single-strand break occurs in the DNA molecule.

8. Suppose that some cells are grown in culture in the presence of radioactive nucleotides for many generations so that both strands of every DNA molecule include radioactive nucleotides. The cells are then harvested and placed in new medium with nucleotides that are not radioactive so that newly synthesized DNA will not be radioactive. What proportion of DNA molecules will contain radioactivity after two rounds of replication? a. 0 b. 1/8 c. 1/4 d. 1/3 e. 1/2

In the following double-stranded DNA molecule, how many ribose sugars are present?AATAGCGGATGCCCGAATACGAGTTATCGCCTACGGGCTTATGCTC a. 48 b. 24 c. 4 d. 2 e. 0

e. 0

e. 1/2

28. What is the total number of telomeres in a rat cell in G2? a. 21 b. 42 c. 84 d. 126 e. 168

e. 168

If a double stranded DNA molecule is 30% cytosine (C), what is the percentage of adenine (A)? a. 30% b. 60% c. 35% d. 70% e. 20%

e. 20%

e. A single-strand break occurs in the DNA molecule

30. Telomerase activity is most likely to be found in which cells in humans? a. Red blood cells b. Muscle cells c. Neurons d. Germ line e. Any type of somatic cell

e. Any type of somatic cell

How did Fred Griffith contribute to our understanding of DNA? a. Used X-ray diffraction to examine the structure of DNA b. Determined that DNA contains four different nitrogenous bases c. Found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. Found that the phosphorus-containing components are the genetic material of phages e. Discovered "the transforming principle" that could genetically alter bacteria

e. Discovered "the transforming principle" that could genetically alter bacteria

e. Genetic material must contain nitrogen but not sulfur.

e. Prevents the formation of secondary structures within single-stranded DNA

e. Replication would cease because ribonucleotides are required to initiate DNA synthesis

1. Telomerase uses _____________ to synthesize new DNA. a. exonuclease activity b. a licensing factor c. strand invasion d. a DNA template e. an RNA template

e. an RNA template

How did Fred Griffith contribute to our understanding of DNA? a. used X-ray diffraction to examine the structure of DNA b. determined that DNA contains four different nitrogenous bases c. found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA d. found that the phosphorus-containing components are the genetic material of phages e. discovered "the transforming principle" that could genetically alter bacteria

e. discovered "the transforming principle" that could genetically alter bacteria

Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of___________________. siRNA plays many roles, but its most notable is in the RNA interference (RNAi) pathway, where it interferes with the expression of specific genes with complementary nucleotide sequence. a. mobile RNA molecules b. small nuclear RNA molecules c. single-stranded RNA molecules d. short messenger RNA molecules e. double-stranded RNA molecules

e. double-stranded RNA molecules

17. Pea plants have seven different types of chromosomes. A chromosome with a centromere at the very end is called a. submetacentric. b. metacentric. c. acrocentric. d. acentric. e. telocentric.

e. telocentric.

DNA replication is semiconservative. This means that

each newly synthesized DNA molecule contains a template strand and a new strand

The function of dosage compensation is to

equalize X chromosome expression between females and males

Copies of a gene that arose by gene duplication are part of a gene _______.

family

The theoretical upper limit on observed percent recombination between two linked genes is 50% because

for every pair of non-sister chromatids that cross over and recombine there is a pair that does not

A two base deletion in an exon will create a _____ mutation.

frameshift

Eukaryotic RNA polymerases can't initiate transcription without

general transcription factors

What is the closest type of DNA related to: centromeres

highly repetitive DNA

What is the closest type of DNA related to: controlling elements

highly repetitive DNA

What is the closest type of DNA related to: telomeres

highly repetitive DNA

Double-stranded DNA is wrapped around eight _______, which collectively form _________, which are organized into structures called ________. (1.5pts)

histones nucleosomes solenoids

initation

in which the transcription apparatus assembles on the promoter and begins the synthesis of RNA. comprises all the steps necessary to begin RNA synthesis, including (1) promoter recognition, (2) formation of the transcription bubble, (3) creation of the first bonds between rNTPs, and (4) escape of the transcription apparatus from the promoter.

What is the function of DNA pol A?

initiates both leading and lagging strand, primase activity - synthesize RNA primer and a short segment of DNA nucleotides (30 to 40).

Replication slippage can result in _________

insertion/deletion/repeat expansion/frameshift

RNA

is a polymer consisting of nucleotides joined together by phosphodiester bonds. However, there are several important differences in the structures of DNA and RNA. Whereas DNA nucleotides contain deoxyribose sugars, RNA nucleotides have ribose sugars (Figure 13.1a). With a free hydroxyl group on the 2′-carbon atom of the ribose sugar, RNA is degraded rapidly under alkaline conditions.

regulatory promoter

is located immediately upstream of the core promoter. A variety of different consensus sequences can be found in the regulatory promoters, and they can be mixed and matched in different combinations. Transcriptional activator proteins bind to these sequences and either directly or indirectly make contact with the basal transcription apparatus and affect the rate at which transcription is initiated.

Luria and Delbrück's experiment with e. coli and T1 bacteriophage was important because

it demonstrated that mutation is a random process

core promoter

located immediately upstream of the gene and is the site to which the basal transcription apparatus binds. The core promoter typically includes one or more consensus sequences.

Calico cats are never

male

Which of the following is consistent with a maternal effect?

maternal genotype determines offspring phenotype

chromatin-remodeling proteins

may bind to the chromatin and displace nucleosomes from promoters and other regions important for transcription.

Which statement best describes a key difference between the two main classes of small regulatory RNAs, miRNA and siRNA?

miRNAs are transcribed as ssRNA in the nucleus; siRNAs originate from dsRNA in the cytoplasm

Brain diseases such as bovine spongiform encephalopathy and CreutzfeldtJakob are caused by

misfolding of the prion protein

Fill in the blanks fun with mutations. (Don't freak out: because there are different ways to describe mutations, there is more than one correct term for some of these.) (10 pts) A mutation that changes one amino acid codon to another is an example of a ________mutation

missense

The endosymbiotic theory proposes that

mitochondria were once free-living bacteria

What is the closest type of DNA related to: genes for ribosomal RNA

moderately repetitive DNA

What is the closest type of DNA related to: genes for tRNA

moderately repetitive DNA

-10 consensus sequence (Pribnow box)

often written as 5'-TATAAT-3'. In most prokaryotic promoters, the actual sequence is not TATAAT. is centered about 10 bp upsteam of the start site.

A mutation in a part of the genome with no known function would probably be _________ with respect to fitness.

neutral

A couple has a son with Klinefelter syndrome (47,XXY) who also a skin condition that is X-linked dominant. The mother has normal skin but the father has the same skin condition as his son. The son's sex chromosome genotype resulted from

non-disjunction of the father's sex chromosomes at meiosis I

Which of the following proteins identifies specific sequences during the DNA replication process? A. helicase B. single-stranded binding proteins (SSBPs) C. primase D. DNA ligase E. None of the above.

none of the above?

8. The highly organized internal scaffolding of the nucleus is called the a. histone complex. b. spindle microtubules. c. nuclear cohesion. d. nuclear matrix. e. nuclear envelope.

nuclear matrix.

Pyrimidine dimers are a type of mutation that would activate

nucleotide excision repair

Use a chi-square test to address the following question: is the F2 phenotypic ratio significantly different from that expected for a monogenic character that is inherited according to Mendelian principles? Remember that you'll need to look at Fig. 3-11 to get a semi-accurate p-value. (1pt)

p ≤ 0.05, p = 0.05, 0.01 < p < 0.05 are all correct!

The chemical bonds that connect nucleotides in the same strand of DNA are

phosphodiester bonds

DNA polymerase has the ability to detect and correct ______________mutations right after it creates them.

point/base substitution

Transposition can involve exchange of DNA sequences and recombination, which often leads to DNA ________.

rearrangements

consensus sequences

refers to sequences that possess considerable similarity, or consensus. The presence of consensus in a set of nucleotides usually implies that the sequence is associated with an important function.

Satellite sequences at centromeres are an example of

repetitive DNA that serves an essential function

.A mutation that inactivates an miRNA is likely to

result in altered expression of the genes it regulates

Ribosomal RNA (rRNA)

ribozymes that catalyze protein synthesis using the message. Along with ribosomal protein subunits, this makes up the ribosome.

Transfer RNA (tRNA)

serves as the link between the coding sequence of nucleotides in the mRNA and the amino acid sequence of a polypeptide chain.

What is the closest type of DNA related to: Alu sequence

short interspersed elements

Transposable element (TE) sequences are highly repetitive. Consequently, mRNA transcripts from TEs may self-pair in the cytoplasm. What cellular defense mechanism would this likely activate? (1pt)

siRNA pathway

A _____ mutation will not be transmitted to the next generation.

somatic

transcription unit

stretch of DNA that encodes an RNA molecule and the sequences necessary for its transcription

Comparative analysis of modern human and Neanderthal genomes has revealed

that a small percentage of alleles in non-African populations are derived from Neanderthals

What is DNA helicase?

the enzyme that breaks the h-bond bxt the two strands of DNA to "unzip" double helix

.A tRNA anticodon binds to

the mRNA codon that matches the tRNA's amino acid

In somatic cells, the monoallelic expression of a paternally expressed imprinted genes depends on

the maintenance of epigenetic marks that distinguish paternal and maternal alleles

In the early 1900's, Calvin Bridges established that sex determination in Drosophila depends on ____

the ratio of X chromosomes to [haploid] sets of autosomes

nontemplate strand

the strand not transcribed

Silent mutations are typically found in

the third position of codons

ribozymes

these catalytic RNA molecules can cut out parts of their own sequences, connect some RNA molecules together, replicate others, and even catalyze the formation of peptide bonds between amino acids.

Several species of sunflowers are allopolyploids. This means that

these species are of hybrid origin

upstream element

this sequence contains a number of A-T pairs and is found at about −40 to −60. A number of proteins may bind to sequences in and near the promoter; some stimulate the rate of transcription and others repress it.

RNA polymerase III

transcribes other small RNA molecules—specifically tRNAs, small rRNA, some miRNAs, and some snRNAs

RNA polymerase II

transcribes pre-mRNAs, snoRNAs, some miRNAs, and some snRNAs

RNA polymerase I

transcribes rRNA

One of the main differences between transcription in eukaryotes and transcription in prokaryotes is that

transcription and translation can't happen simultaneously in eukaryotes

A mutation that changes a purine to a pyrimidine or vice versa is called a _________

transversion

Non-disjunction between a pair of homologous chromosomes at the first meiotic division results in aneuploid gametes that, if fertilized by a normal haploid gamete, result in a zygote that is either

trisomic or monosomic

transcriptional activator proteins

which bind to specific DNA sequences and bring about higher levels of transcription by stimulating the assembly of the basal transcription apparatus at the start site.

TATA box

which has the consensus sequence TATAAA and is located from −25 to −30 bp upstream of the start site.

−35 consensus sequence

written as TTGACA, which lies approximately 35 nucleotides upstream of the start site.

Approximately how many protein coding genes are there in the human genome?

~20K

c) What fraction would you expect to be chocolate? (1pt)

¼ chocolate (to figure this out you could have drawn a 4x4 or a 1x4 Punnett square as shown. This is because the yellow parent's gametes will always be be)

You have a black lab whose father was yellow. If you cross her to a yellow male, what fraction of yellow pups would you expect to get?

b) What fraction of their puppies would you expect to be yellow? (1pt)

½ yellow (because ee produces yellow, regardless of genotype at B locus, this is just the probability of inheriting e from the black parent)

Provide two reasons why Beadle and Tatum's one-gene:one-enzyme hypothesis is no longer considered completely accurate. (4 pts)

• Almost all enzymes are proteins but not all proteins are enzymes • Polypeptide chains, not proteins, are primary products of translation on ribosomes • Proteins are often comprised of multiple polypeptide chains (subunits) • Thanks to alternative splicing, many genes encode more than one protein

True

−75 would be 75 nucleotides upstream of the start site. There is no nucleotide numbered 0. True or False?

Lihat semua set pelajaran

Genetics Exam

Set pelajaran terkait

27.1 World History

pH and indicators

DEP3305 Chapter 3 QUIZ

Strat practice exam

Chapter 3 Quiz: The English Come to Stay 1600-1660

Lecture 7: Hormones/Endocrine System

Year 7 Maths - Equivalent fractions / Fractions of a Quantity / Writing one Number as A Fraction of Another

Class quiz 7

Defensive Driving Course: Final Exam

U.S. History II

Physics: edX Projectile Motion

BIO Chapter 2

Quiz de culture générale sur la France

BUS 450 Chapter 1 Quiz

Environmental Problems, Their Causes, and Sustainability

prepu ch28

Chapter 1

Evolve HESI 1

WWII

International Relations