Genetics: Exam 4 Pearson Quizlet
In what ways can proto-oncogenes be converted to oncogenes?
(all) translocations point mutations gene amplification repositioning of regulatory sequences
A hypothetical population of 300 wolves has two alleles, FB and FW, for a locus that codes for fur color. The table below describes the phenotype of a wolf with each possible genotype, as well as the number of individuals in the population with each genotype. Which statements accurately describe the population of wolves? select 4
-Based on the equation for Hardy-Weinberg equilibrium, the expected number of wolves with the FBFB genotype is 12. -Based on the equation for Hardy-Weinberg equilibrium, the expected number of wolves with the FBFW genotype is 96. -The population may be evolving because the actual number of individuals with each genotype differs from the expected number of individuals with each genotype. -The population is not at Hardy-Weinberg equilibrium.
A hypothetical population of 200 cats has two alleles, TL and TS, for a locus that codes for tail length. The table below describes the phenotypes of cats with each possible genotype, as well as the number of individuals in the population with each genotype. Which statements about the population are true? Select 5
-Heterozygotes make up 20% of the population. -Homozygotes make up 80% of the population. -In the entire cat population, 60% of the alleles are TS. -In the entire cat population, the frequency of the TL allele is 0.4. -Assuming random mating, each gamete has a 40% chance of having a TL allele and a 60% chance of having a TS allele.
Which of the following will be true in a cell with PSM-RB? Select the three correct answers.
-pRB will never be phosphorylated. -pRB will always be bound to E2F transcription factor. -The cell will be stuck in G1 phase and never progress to S phase.
Assume that the population described in Part A is in Hardy-Weinberg equilibrium. What is the frequency of females who have hemophilia A in this population?
.0004
Assuming that p = 0.3 for a population in Hardy-Weinberg equilibrium, what would be the expected frequency of heterozygotes for the involved allelic pair?
.42
If the botanist also counted 20 plants with scalloped leaves in the pond, what is the inbreeding coefficient F for this population? To calculate the inbreeding coefficient from population data, use the following equation: F=(He−H0)He where He is the number of heterozygotes expected in the population (determined by this calculation: 2pq× Number of individuals in the population) and H0 is the number of heterozygotes observed in the population. Express your answer using two decimal places.
.43
Calculate the frequency of the T alleles. Express your answer using three decimal places.
.456
Calculate the frequency of the t alleles. Express your answer using three decimal places.
.544
If a recessive disease is found in 50 out of 100,000 individuals, what is the frequency of the heterozygote carriers for this disease?
0.043
Populations evolve for many reasons. Suppose there is a population of plants that have either purple flowers or white flowers, and the allele for purple flowers is dominant. This means that plants with two purple alleles have purple flowers. Plants with one purple allele and one white allele also have purple flowers. Only plants with two white alleles have white flowers. For each event or condition described below, answer the following questions. Which mechanism of evolution is at work? How does this event affect the population's gene pool? Do the frequencies of the two alleles change, and if so, how?
1. During an extreme heat wave, plants with white flowers survive better a. Natural Selection b. White allele increases 2. A person uproots the five closest plants, which all happens to have white flowers c. genetic drift d. frequency of purple allel increases 3. a storm kills many plants e. genetic drift f. allele frequencies change but not predictably 4.plants with purple flowers attract more insects, which pollinate the plants g. Natural selection h. frequency of purple allele increases 5.workers in a greenhouse... i. gene flow j. frequency of white allele increases
What are the steps in the shotgun approach to whole-genome sequencing?
1. multiple copies 2. chromosome copies 3. 1-kb fragments are cloned 4. the plasmids 5. a computer combines
Label the sequences in the eukaryotic gene below that could be used by a computer program to identify a gene.
1. transcription regulatory sequences 2. promoter 3. start codon 4. splice sites 5. stop codon 6. transcription termination sequence
The questions below will help determine which restriction enzyme should be used to make a plasmid that contains both an intact vgp gene and a functional ampR gene. Answer questions 1-4 by selecting from the answer choices on the left. Drag the correct answer to the right of each question.
1. which enzymes would cut the human.... BamHI HaeIII HindIII 2.which enzyme would cut the plamid... BamHI ECoRI HaeIII 3. which enzyme would produce... BamHI ECoRI HindIII 4.which one restriction... BamHI only
If the frequency of the disorder in the population is 0.000079, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
1.76
If the frequency of the disorder in the population is 0.000083, what is the percentage of heterozygous carriers? Express your answer using two decimal places.
1.81
If the frequency of the disorder in the population is 0.0069, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
15.2
If the frequency of the disorder in the population is 0.0072, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
15.5
Below is a diagram of the PCR product ligated into the plasmid. Drag the restriction enzyme names to the appropriate places on the plasmid diagram.
16Kb- B 19Kb- X 4Kb- E 9Kb- H 10Kb- S
A certain form of albinism in humans is recessive and autosomal. Assume that 1% of the individuals in a given population are albino. Assuming that the population is in Hardy-Weinberg equilibrium, what percentage of the individuals in this population is expected to be heterozygous?
18
In a population that meets the Hardy-Weinberg equilibrium assumptions, 81% of the individuals are homozygous for a recessive allele. What percentage of the individuals would be expected to be heterozygous for this locus in the next generation?
18
If the frequency of the disorder in the population is 0.01, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
18.0
To estimate the number of cleavage sites in a particular piece of DNA with a known size, you can apply the formula, N/4 n where N is the number of base pairs in the target DNA and n is the number of bases in the recognition sequence of the restriction enzyme. If the recognition sequence for AluI is AGCT and the Nanoarchaeum equitans genome contains approximately 490,000 bp, how many cleavage sites would you expect? Round your answer to the nearest whole number.
1914
After cutting the plasmid with HindIII and NotI, how many pieces of DNA will you have?
2
Hemophilia A is an X-linked recessive disorder characterized by lack of a functional Factor VIII, a protein involved in blood clotting. In one population, the frequency of the normal allele, X 1, is 0.98 and the frequency of the mutant allele that causes hemophilia A, X 2, is 0.02. What percentage of males in this population have hemophilia A?
2
Calculate the frequency (in %) of the genotype TT in this population. Express your answer using one decimal place.
20.8
If this woman marries individual II-1 (from Part A), predict the probability that their first child will have ARK14 disease.
25%
Calculate the frequency (in %) of the genotype tt in this population. Express your answer using one decimal place.
29.6
After cutting the PCR product with HindIII and NotI, how many pieces of DNA will you have?
3
Assume that a plasmid (circular) is 2800 base pairs in length and has restriction sites for EcoRI at the following locations: 400, 700, 1400, and 2600. Give the expected sizes of the restriction fragments following complete digestion with EcoRI.
300 700 1000 1200
If the frequency of the disorder in the population is 0.04, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
32.0
BamHI cuts the sequence 5′ G|GATCC 3′. Which of the following sequences would not be recognized by this enzyme?
3′ TCTTAAG 5′
If there are five molecules of DNA containing the target region at the beginning of a PCR reaction, how many copies of the target will be present after three rounds of amplification?
40
A restriction enzyme that uses a six (6) base recognition sequence will cut DNA, on average, every ________ bases, if all four nucleotides are present in equal proportions.
4096
Assume that a trait is caused by the homozygous state of a gene that is recessive and autosomal. Nine percent of the individuals in a given population express the phenotype caused by this gene. What percentage of the individuals would be heterozygous for the gene? Assume that the population is in Hardy-Weinberg equilibrium.
42
In a population of 100 individuals, 49% are of the NN blood type. What percentage is expected to be MN assuming Hardy-Weinberg equilibrium conditions?
42%
If the frequency of the disorder in the population is 0.09, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
42.0
If the frequency of the disorder in the population is 0.15, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
47.5
The lambda phage genome is 48.5 kb in size and has 50% GC content. Approximately how many times would you expect HincII to cut lambda phage DNA?
48
Assume that in a Hardy-Weinberg population, 9% of the individuals are of the homozygous recessive phenotype. What percentage are homozygous dominant?
49
Calculate the frequency (in %) of the genotype Tt in this population. Express your answer using one decimal place.
49.6
If the frequency of the disorder in the population is 0.22, what is the percentage of heterozygous carriers? Express your answer using one decimal place.
49.8
Below is the sequence of the coding strand of DNA that flanks the coding region of the GFP gene. Diagram of the DNA coding strand with this sequence: 5'-ATCGG--GFP gene--TTAGAC-3' Select the sequence of the forward primer that you would use to amplify the GFP gene using PCR. Remember that the forward primer hybridizes to the template strand of DNA.
5' ATCGGG 3'
Which of the following DNA sequences is one strand of a restriction enzyme recognition sequence?
5' GGATCC 3'
Now, select the sequence for the reverse primer that you would use to amplify the GFP gene shown in Part C. Remember that the reverse primer hybridizes to the coding strand of DNA.
5' GTCTAA 3'
The final step of the cloning procedure is to screen the plasmid library for clones that carry the vgp gene, shown in red below. To accomplish the screening, researchers synthesize a single-stranded DNA probe using vgp mRNA as a template. What will be the sequence of nucleotides in the probe? Drag the labels to their appropriate locations in the probe. Labels can be used once, more than once, or not at all.
5' T C A C A C T G ........G A A T T C A T 3'
If this sequence contains one gene, which frame is most likely the correct reading frame for this gene? (Remember that Met represents a potential start codon and Stop represents a stop codon.)
5'-3 direction Frame 3 which start with Met and only one stop codon at the end of sequences.
Applying Hardy-Weinberg equilibrium, how many genotypes are predicted for a gene that has three alleles?
6
How many possible open reading frames can a bioinformatics program translate from one DNA sequence? Enter your answer numerically (for example: 2).
6
How many potential reading frames are there in a 1500-bp segment of double-stranded DNA?
6
In chickens, having feathers on legs is dominant to having featherless legs. In a population of 200 chickens, 128 have featherless legs. How many chickens are heterozygous for the "feathered leg" allele? Assume the population is in Hardy-Weinberg equilibrium.
64
Use this information to deduce the results of the RFLP and Southern blot analysis for the father (II-3) on the gel below.
700-blank spot 600-blank spot 400-bold line 300-bold line 200-bold line
What would the RFLP pattern look like for an individual who has ARK14 disease caused by this C-to-G mutation?
700-blank spot 600-bold line 400-blank spot 300-bold line 200-blank spot
Red-green color blindness is an X-linked recessive disorder. In a population (n = 1000) that contains an equal number of males and females, the frequency of the normal allele, X 1, is 0.90 and the frequency of the mutant allele that causes color blindness, X 2, is 0.10. How many females in this population are carriers of the red-green colorblindness trait? Assume that the population is in Hardy-Weinberg equilibrium.
90
Albinism is an autosomal recessive trait in humans. Assume that there are 100 albinos (aa) in a population of 1 million. How many individuals would be expected to be homozygous normal (AA) under equilibrium conditions?
980,100
Which of the following best describes a cloning vector?
A DNA molecule that accepts DNA fragments and replicates the fragment in a host.
What is a probe in molecular biology?
A DNA or an RNA molecule used in hybridization reactions
How can these individuals carry a fusion gene that is transcriptionally active and not develop CML?
A single gene alteration is not the only requirement for CML.
You cut a gene of interest with HincII and would like to insert it into the multiple cloning site (MCS) of a plasmid. The plasmid's MCS contains the cut sites listed below. Which of these sites could you use to insert the gene of interest? Select all that apply.
A. GTC*AAC CTG*TTG B. GGT*ACC CCG*TGG C. GTA*TAC CAT*ATC
How does the Ras protein transmit a signal from outside the cell into the cytoplasm?
Activated Ras proteins transduce a signal, which activates the transcription of genes that start cell division.
In the context of molecular genetics, reverse transcription PCR (RT-PCR) refers to ________.
Assembling a DNA sequence from a mRNA
The ability of restriction enzymes to cut DNA at specific sites makes DNA cloning possible. The diagram below shows a section of human DNA that contains an imaginary gene for video game proficiency (the vgp gene), shown in red. Shaded areas mark the restriction sites (also called recognition sites) of four restriction enzymes: EcoRI, HaeIII, BamHI, and HindIII. Arrows indicate where each enzyme cuts the two DNA strands. Which enzyme(s) will produce a DNA fragment that contains the entire vgp gene (shown in red) and has "sticky ends"? Select all that apply.
BamHI HindIII
Place the fragments of DNA in the proper places to form the contig for this sequence of DNA, using the central CAT sequence as a guide
CCAGGCC CCATCGA GGCCATC --CAT-- AGGCCAT CATCGAG
Choose the correct explanation of the apparent paradox that both hypermethylation and hypomethylation of DNA are often found in the same cancer cell.
Complex regulatory systems are involved. For example, hypomethylation of oncogenes and hypermethylation of tumor-suppressor genes are expected in cancer cells.
Genomic libraries are often screened using probes derived from organisms that are different than the one from which the library was generated. Therefore, there are often mismatches between the probe and the most similar matching clones in the library. As a result, it's possible that no matching clones may initially be identified by hybridization. How can these potential problems be overcome or minimized? Select the two correct statements.
Create smaller probes using regions of your DNA of interest that are thought to be more highly conserved. Alter the hybridization conditions such that hybridizations with a few mismatches are tolerated.
What role does DNA ligase perform in a DNA cloning experiment? How does the action of DNA ligase differ from the function of restriction enzymes?
DNA ligase generates the covalent bonds of the phosphodiester backbone, while restriction enzymes break those bonds.
In which of the following biochemical reactions is it common to use ddNTPs (dideoxyribonucleoside triphosphates)?
DNA sequencing
Why are cyclins expressed at different times and at different levels during the cell cycle?
Different cyclins combine with protein kinases at different stages of the cell cycle to affect the cell cycle.
In a population of birds in Africa, it was observed that birds with small or large beaks could efficiently crack and eat small or large seeds, respectively. Birds with intermediate beaks had trouble with both types of seeds. What type of selection would be expected to occur in this population if small and large seeds were the only types of food available to these birds?
Disruptive
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, in Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95oC. Why would such a heat-stable polymerase be beneficial in PCR?
Each cycle includes a "hot" denaturation phase (95°C), which separates the hydrogen bonds that hold the strands of the template DNA together.
When referring to tumor-suppressor genes and cancer, loss of heterozygosity is likely to suppress cancer formation.
False
Which three stages or transitions in the cell cycle of those listed seem to serve as points of control (checkpoints)? G1/S, S, S/G2, G2/M, M, M/G1
G1/S, G2/M, M
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
GATGACATGGCGTCAGTCGATGCG
What advantages do cDNA libraries provide over genomic DNA libraries? List cloning applications where the use of either a genomic library or a cDNA library is necessary to provide information. Sort each item to the appropriate bin.
Genomic libraries only: -Likely to contain entire genome -Contain noncoding DNA cDNA libraries only: -Rarely contain introns -Originate from mRNA -Dependent on expression levels of genes -Dependent on tissue type Both genomic and cDNA libraries: -Cloned into vectors
What advantages do cDNA libraries provide over genomic DNA libraries? List cloning applications where the use of either a genomic library or a cDNA library is necessary to provide information. Sort each item to the appropriate bin. 2
Genomic libraries only: -Likely to contain entire genome -Contain noncoding DNA cDNA libraries only: -Rarely contain introns -Originate from mRNA -Dependent on expression levels of genes -Dependent on tissue type Both genomic and cDNA libraries: -Cloned into vectors
Complete this pedigree for the patient's family by dragging the symbols to their correct locations to indicate which family members have ARK14 disease and which do not.
I.1. white circle I.2. dark square II.1. white square II.2. dark circle
The following are four processes common to most cloning experiments: i) transforming bacteria ii) plating bacteria on selective medium iii) cutting DNA with restriction endonucleases iv) ligating DNA fragments Place the components of this list in the order in which they would most likely occur during a cloning experiment.
III, IV, I, II _3__ transforming bacteria __4__ plating bacteria on selective medium __1__ cutting DNA with restriction endonucleases __2__ ligating DNA fragments
Which of the following statements best describes the relationship between the Hardy-Weinberg principle and the effects of natural selection?
If selection can be quantified, relative fitness values can be calculated and used to appropriately modify the Hardy-Weinberg equation.
Which features make yeast artificial chromosomes (YACs) an excellent cloning tool?
In their linear form, YACs contain telomeres at each end for stability, an origin of replication, and they can be used to clone up to 2-Mb pairs of DNA. A YAC also contains a yeast centromere along with selectable markers and a number of restriction sites. This allows for the insertion of up to 2-Mb pairs of DNA.
What happens in cases where the ras gene is mutated?
It continually signals cell division.
________ regulate other proteins by adding phosphate groups. ________ bind to them, switching them on and off. _______binds to cyclin D, moving cells from G1 to S. At the G2/mitosis border, a _________combines with another cyclin (cyclin B). Phosphorylation occurs, bringing about a series of changes in the nuclear membrane via caldesmon, cytoskeleton, and ______.
Kinases Cyclins CDK4 CDK1 histone H1.
Indicate the enzyme(s) used for each reaction by dragging the enzyme(s) above the appropriate lanes in the gel.
Lane 1 S Lane 2 X Lane 3 H and N Lane 4 B and X
To clone the entire coding region of p53 into the plasmid, which restriction enzyme(s) could you use to cut both your PCR product and the pCDNA3 plasmid?
N and H
Can she consider herself free of risk for breast cancer?
No, she will still have the general population risk of about 10 percent.
The frequency of carriers for a rare autosomal recessive genetic condition is 0.04 in a population. Assuming this population is in Hardy-Weinberg equilibrium, what is the allele frequency of the recessive allele?
Not enough information is provided.
To help sort out those bacteria that have the vgp gene, scientists first attempt to grow the bacteria both in a medium with ampicillin and in a medium without ampicillin. Demonstrate your understanding of this step by sorting the four bacterial classes based on where they will grow. Drag the icon for each bacterial class to the appropriate bin.
ONLY grow in medium without ampicillin: no plasmid will ONLY grow in medium containing ampicillin: (blank) will grow in both media: nonerecombinant plasmid, recombinant plasmid but no vgp gene, recombiant plasmid with vgp gene
Distinguish between oncogenes and proto-oncogenes.
Oncogenes are genes that induce or maintain uncontrolled cellular proliferation associated with cancer. They are mutant forms of proto-oncogenes, which normally function to regulate cell division.
What is the relationship between proto-oncogenes and oncogenes?
Oncogenes are mutant forms of proto-oncogenes.
A portion of the β‑globin allele responsible for sickle‑cell anemia contains the sequence CCTGTGGAG, whereas the same region of the normal β‑globin allele contains the sequence CCTGAGGAG. Which allele would be cut by the restriction enzyme DdeI, which cuts at the sequence CTNAG, where N is any base?
Only the normal allele will be cut.
Restriction enzymes are used in all of the following molecular biology techniques EXCEPT __________.
PCR
Place the steps involved in making a genomic library and a cDNA library in their correct order in the flow charts below. Drag the labels onto these two flow charts in the correct order.
Steps in Genomic DNA Library 1. Isolate genomic DNA from an organism. 2. Partially digest genomic DNA with a restriction enzyme. 3. Ligate pieces of genomic DNA into a cloning vector. Steps in cDNA Library 1. Isolate mRNA from a specific cell or tissue using an oligo dt-primer that hybridize to the mRNA poly - A tail. 2. Create a single standard DNA molecule complementary to the mRNA using reverse transcriptase. 3. Partially degrade the mRNA with RNAse H 4. Synthesize a strand of cDNA using DNA polymerase with mRNA fragments as primers. 5. Ligate cDNA into a cloning vector.
What is the significance of this table in the context of examining a family or population for BRCA1 mutations that predispose an individual to cancer?
Such neutral polymorphisms make screening difficult in that one cannot always be certain that a mutation will cause problems for the patient.
Considering the same population of cats as in Part A, what is the expected frequency of each genotype (TLTL, TLTS, TSTS ) based on the equation for Hardy-Weinberg equilibrium?
TLTL, TLTS, TSTS = .16,.48,.36
Which of the following statements describes metastasis?
The ability to form secondary tumors at another site
You are the couple's genetic counselor. When consulting with you, they express their conviction that they are not at risk for having an affected child because they each carry different mutations and cannot have a child who is homozygous for either mutation. What would you say to them?
The answer is all of them EXCEPT that they are correct.
If there are two alleles of a gene controlling coat color in a population of mice and the frequency of the dominant allele is 0.3, which of the following must be true?
The frequency of the recessive allele is 0.7.
RFLPs can be used to identify point mutations through which of the following mechanisms?
The mutation can occur in a restriction site, causing a change in the cutting pattern for restriction enzymes.
Which of the following statements best describes the relationship between fitness and selection coefficient (s)?
The stronger the selection against a given genotype, the lower the fitness associated with that genotype.
Sanger sequencing is based on the order in which ddNTPs are added to a growing polynucleotide. Why are ddNTPs integral to the Sanger sequencing method?
They do not have a 3 hydroxyl, which does not allow the extension of the polynucleotide.
What is the function of restriction endonucleases in bacteria?
They provide a defense mechanism against infection by viruses.
The mutation resulting in the allele for sickle‑cell anemia removes a restriction site from the β‑globin gene such that a specific probe hybridizes to one 1.3‑kb fragment instead of two fragments of 1.1 kb and 0.2 kb. What restriction pattern will be seen in sickle‑cell carriers?
Three fragments of 1.3, 1.1, and 0.2 kb
What is the purpose of raising the temperature to 90-95°C at the beginning of each cycle of PCR?
To separate the double‑stranded DNA
A common term for a plasmid or other DNA element that serves as a cloning vehicle is vector.
True
An RFLP marker that cosegegrates with a disorder exists in most people who have the disorder and is absent in most people who don't have the disorder.
True
Place components of this list in the order in which they would most likely occur during a cloning experiment.
__2__ ligating DNA fragments __1__ cutting DNA with restriction endonucleases __4__ plating bacteria on selective medium __3__ transforming bacteria
What is meant by a neutral polymorphism?
a difference in DNA sequence that has no physiological effect
Using these two sequences, determine if the following functional features are present in the genomic DNA sequence: TATA box, start of translation, start of transcription, and first intron.
a) TATA Box: 31 b) Start of translation: N/A c) Start of transcription: 61 d) First intron: 102
Probes that bind under very stringent hybridization conditions resulting in the differential binding over one nucleotide are called ________.
allele-specific oligonucleotides (ASOs)
Below is an image of a typical cloning plasmid. Match each element in the plasmid with its most important function in cloning.
allows for selection of bacterial cells that contain a cloned DNA fragment - lacZ gene region where pieces of DNA are cloned into the plasmid - Multiple cloning site (MCS) enables replication of the plasmid within the bacterial cell - Origin of replication (ori) allows for selection of bacterial cells that contain the cloned plasmid - Ampicillin resistance gene (ampr) allows for identification of the DNA segment cloned into the plasmid - DNA sequencing primer site
Sort each statement depending on whether it is is true of cells that remain at the G1 checkpoint or of cells that progress from G1 to S phase.
arrest: -pRB not phosphorylated -pRb bound to EF2 progression: -CDK4 bound to Cyclin D1 -E2F bound to DNA -pRb not bound to E2F -pRB phosphorylated
In a different population, suppose that 38.40% of people are blood type A, and 46.24% are blood type O. Assuming this population is in Hardy-Weinberg equilibrium, what percentage of the population is blood type B? What percentage is blood type AB? Enter your answers to two decimal places.
blood type B=.1152 blood type AB=.0384
In the beetles described in the animation, there were two alleles for color, brown and green. Suppose that you discover a very small population of these beetles, consisting of the individuals shown below. How can you calculate the frequency of each allele in this population?
brown alleles 8 20 0.4 0.6
To ensure that a human gene is translated properly in a bacterial cell, you should clone the _____________ for the gene instead of the genomic DNA fragment that contains the gene.
cDNA
Which type of DNA library represents the genes expressed by a given cell at a certain time?
cDNA
When activated, the p53 protein initiates ______ followed by______and apoptosis. This process involves stimulating transcription of p21, which inhibits the_________complex. Activated p53 also prevents the cell from initiating the phase. Through a series of steps, BAX homodimers are formed that lead to________. Individuals who are heterozygous for p53 need only have a mutation in the existing normal gene to______the protection of the p53
cell cycle arrest DNA repair CDK4/cyclinD1 S apoptosis lose
What is the name of the protein that combines with cyclins to exert local control of the cell cycle?
cyclin-dependent kinase
A scientist is troubleshooting the synthesis of a cDNA library. The scientist performs both a Northern and a Southern blot. The Northern blot demonstrated the presence of RNA while the Southern blot indicated that no cDNA was present in the sample. What is likely to be the cause of the failed synthesis of the cDNA library?
defective reverse transcriptase
Which three steps constitute a PCR cycle?
denaturation, annealing, extension
A standard PCR cycle includes three steps: denaturation (95°C), annealing (55°C), and elongation (65°C).
denaturation: template DNA annealing: primeres elongation: taq pol and dNTPs
_______are those that confer a growth advantage to a cancer cell. _______increase in cancer cells over time, possibly due to the genomic instability of cancer cells.
driver passenger
One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that ________.
each vector can take up only a relatively small fraction of the eukaryotic DNA
Selective breeding has been used for centuries to ________.
enhance growth and yield from domesticated plants and animals
If the frequency of the M allele in the human MN blood group system is 0.65 in a population at equilibrium, then the frequency of the N allele must be 0.04.
false
In large random mating populations, random genetic drift is usually a significant factor in changing gene frequencies.
false
Inbreeding by itself can change gene frequencies.
false
Mutations are regarded as a strong evolutionary mechanism for changing allelic frequencies.
false
Restriction endonucleases cut DNA at specific recognition sequences and then bond two strands covalently with the same "sticky ends."
false
The thermostability of Taq polymerase is required during the annealing phase of PCR.
false
Cystic fibrosis is an autosomal recessive disorder. In one population, the frequency of affected individuals (A 2 A 2) is 0.0004. Assuming that this population is under Hardy-Weinberg equilibrium, calculate all allele frequencies and genotype frequencies. Enter your numerical answers in the boxes below. Express each answer to four decimal places.
freq of A1 allele=.98 freq of A2 allele=.02 freq of homo dom individuals=.9604 freq of heterzygous individuals=.0392 freq of homo rec individuals=.0004
Assuming this population is in Hardy-Weinberg equilibrium, determine the expected phenotype frequencies. Enter your answers to four decimal places.
freq of A=.2025 freq of B=.3625 Freq of AB=.075 Frequency of O=.36
Galactosemia is an autosomal recessive disorder. If untreated, the disease can cause mental retardation in children. It is characterized by an inability to metabolize galactose (which comprises part of lactose found in milk), due to a deficient enzyme. In one population, the frequency of the normal allele, A1 , is 0.92. The frequency of the galactosemia allele, A2 , is 0.08. Assuming that this population is in Hardy-Weinberg equilibrium, calculate the frequency of homozygous dominant individuals, heterozygous individuals, and homozygous recessive individuals. Enter your numerical answers in the boxes below. Express each answer to four decimal places.
freq of homozygous dominant individuals=.8464 freq of heterozygous individuals=.1472 freq of homozygous recessive individuals=.0064
Cancer is best described as a ________.
genetic disorder at the cellular level
In small isolated populations, gene frequencies can fluctuate considerably. The term that applies to this circumstance is ________.
genetic drift
Which of the following general mechanisms appear to be involved in the formation of cancer cells?
genomic instability, DNA repair failure, chromatin modifications
Sort the statements below according to whether they are true for a genomic library, a cDNA library, or both types of genetic libraries. Drag each statement into the correct bin.
genomic: -can be used to study promoter regions of genes -is the same regardless of which cell type is used to make the library -can be used to study splice sites and introns cDNA: -can be used to study genes expressed at different developmental stages both: -can be used to study coding regions of genes
Complete the table by answering each question about the colonies of bacteria that grow on each type of media.
going across the rows: med/med+amp/med+amp+xgal 1. white only/white only/white and blue 2. no/yes/yes 3. no/no/yes
Order the steps involved in screening a genomic library. Rank the steps involved in screening a genomic library from first to last.
grow genomic library colonies and transfer to membranes lyse colonies and denature DNA hybridize desired labeled probe identify targeted library colonies
Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot, one generally ________.
hybridizes filter-bound DNA with a DNA probe
What is the main purpose of a DNA probe?
hybridizes to a target sequence
X-Gal is included in the growth medium on which cells transformed with bacterial plasmids are grown. The reason X-Gal is included is to _______.
identify bacteria that contain a recombinant plasmid.
Under what circumstances might a lethal dominant allele persist in a population? Select the two correct answers.
incomplete penetrance late onset (lethality occurs after reproductive age)
Which of the following molecules is not required for a PCR reaction?
ligase
When propagating a clone in the lambda phage, would you have more immediate success if the phage entered the lysogenic or the lytic cycle?
lytic
In a population of 10,000 individuals, 3600 individuals are MM, 1600 individuals are NN, and 4800 individuals are MN. What is the frequency of the M allele? What is the frequency of the N allele?
m=.6 n=.4
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. Which term is given to this advantageous arrangement of restriction sites?
multiple cloning site
The three major mechanisms of evolution differ in how they work, and as a result often have different effects on a population. Review your understanding of natural selection, genetic drift, and gene flow by sorting the statements below into the correct bins.
natural selection: -consistently -a result of the differential -cannot genetic drift: -responsible for bottle -responsible for founder -causes gene flow: -can introduce -a result of the movement
Is the PM3 polymorphism likely to result in a neutral missense mutation or a silent mutation?
neutral missense mutation
Determine whether the following two sets of data represent populations that are in Hardy-Weinberg equilibrium (use chi-square analysis if necessary). Sickle-cell hemoglobin: AA, 75.6 percent; AS 24.2 percent; SS 0.2 percent
no
All of the following processes can alter allele frequencies within a population EXCEPT __________.
non-random mating
Mutant versions of genes that are normally involved in promoting the cell cycle are known as ________.
oncogenes
What essential feature of a plasmid that is required for cloning is missing from the pCDNA3 plasmid?
origin of replication
A protein functions as a cell-cycle regulator that causes cell death (apoptosis) to a damaged cell. What is the symbol given to this protein?
p53
Driver mutations provide a growth advantage to a tumor cell. Which type of mutation is known to accumulate in cancer cells but has no direct contribution to the cancer phenotype?
passenger mutations
_____cut at restriction sites _____express foreign genes introduced in the recombinant DNA _____are plasmids, bacteriophages, or cosmids that receive, through litigation, a piece or pieces of foreign DNA
restriction enzymes host cells vectors
Nucleic acid blotting is commonly used in molecular biology. Northern blotting is used to detect the presence of which type of nucleic acid?
ribonucleic acids
Northern blots are used to study what type of molecule?
rna
The function of the ras gene family involves ________.
signal transduction
Is the PM2 polymorphism likely to result in a neutral missense mutation or a silent mutation?
silent mutation
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky?
single-stranded complementary tails
Agarose gels separate DNA fragments based on what property?
size of the fragment
What is the function of a ddNTP in DNA sequencing?
termination of DNA synthesis
Suppose that you would like to make a human protein in bacteria. You clone a fragment of genomic DNA that contains the human gene into a plasmid, transform the plasmid into the bacteria, and isolate colonies containing the recombinant plasmid. Which of the following results would you expect from this experiment? Select the two correct answers.
the bacteria could produce a truncated, nonfunctional human protein the bacteria could produce a much longer protein with an incorrect amino acid sequence
A common first separation technique in 2D gels is isoelectric focusing. What property is isoelectric focusing taking advantage of?
the pH at which the overall charge is zero
Transcriptomics is ________.
the quantification of gene expression
Immediately after the primers have annealed to the target sequence, _______.
the temperature is raised so that taq polymerase can extend the primers
The role of the primers in PCR is _______.
to define the target region and provide a 3' end that can be extended by taq polymerase
You would like use PCR to amplify the GFP gene from jellyfish DNA. The red region in the diagram below represents the GFP gene.
top left: x bottom left: 5' --> 3' top right: 3' <-- 5' bottom right: x
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
transformation
A tumor-suppressor gene normally functions to suppress cell division.
true
Any agent that causes damage to DNA is a potential carcinogen.
true
Given an inheritance pattern of incomplete dominance and 81 flowers that are red (R1R1), 18 flowers that are pink (R1R2), and 1 flower that is white (R2R2), the frequency of the R1 allele is 0.9.
true
Natural selection occurs when there is nonrandom elimination of genotypes from a population due to differences in viability or reproductive success.
true
Selection is the differential reproduction of genotypes, resulting from their variable fitness.
true
There are two types of retinoblastoma, familial and sporadic. In the familial form, one generally inherits a defective gene from one parent.
true
When the normal retinoblastoma protein is dephosphorylated, it acts to suppress cell division by binding to and inactivating the E2F transcription factor.
true
Within a six-base DNA recognition sequence, an enzyme that cuts between the 3rd and 4th bases from the 5' end will generate blunt ends.
true
The retinoblastoma protein (pRB), like p53, serves as a(n) ________ in regulating the cell cycle.
tumor suppressor
A plasmid contains a multiple cloning site inside the coding region of the lacZ gene and also contains an ampicillin resistance gene at a separate locus. When cells are transformed with a successfully recombinant plasmid containing a piece of DNA cloned into the multiple cloning site, what color will the colonies be when grown on an agar plate containing ampicillin and X-gal?
white
Assume that one conducted a typical cloning experiment using a typical plasmid, transformed an appropriate host bacterial strain, and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant plasmid?
white
Next, you would like study the gene that you ligated into the plasmid in Part B. From that experiment, which colonies should you select to culture for further experimentation?
white colonies that grew on complete media + ampicillin + X-gal
Determine whether the following two sets of data represent populations that are in Hardy-Weinberg equilibrium (use chi-square analysis if necessary). CCR5 genotypes: 1/1, 60 percent; 1/Δ32, 35.1 percent; Δ32/Δ32, 4.9 percent
yes
