Genetics Final

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

Species A has 2n = 8 chromosomes, and species B has 2n = 14 chromosomes. Calculate all possible chromosome numbers for an allotriploid offspring of AB. (Select all that apply).

-18 -15

Identify the statements that describe the structure of DNA. (Select all that apply).

-A DNA double helix contains two sugar-phosphate backbones oriented in opposite directions. -The five-carbon sugar of DNA is called deoxyribose. -Adenine is paired with thymine, and guanine is paired with cytosine.

Which of the following statements describes purines and pyrimidines in DNA molecules? (Select all that apply).

-Pyrimidines form hydrogen bonds with purines. -pyrimidines consist of one-ring structure

What reagents are needed for a typical polymerase chain reaction (PCR)? (Select all that apply).

-Taq polymerase -four deoxynucleoside triphosphates -template DNA strand -two primers

Which of the following statements about primers are correct? (Select all that apply.)

-They are needed for the start of DNA synthesis. -They are synthesized by an enzyme called primase. -They provide a 3′-OH group for attachment of DNA nucleotides.

Select the true statements regarding the roles of sex chromosomes in human development. (Select all that apply).

-XO females are often sterile -XXX females develop normally except for some slight physical abnormalities -an individual missing the SRY region of the Y chromosome will be phenotypically female

Which of the following genotypes would result an individual that is phenotypically male? (Select all that apply).

-XX with SRY on X -XYY -XXY

What is a purine? (Select all that apply.)

-a base with two rings -adenine or guanine

Which of the following statements about X-linked recessive traits is true? (Select all that apply).

-affected individuals often have phenotypically normal parents -affected females almost always have an affected father -males are more commonly affected than females -they often skip generations

Which of the following is a true statement about transcription? (Select all that apply).

-catalyzed by RNA polymerase -localized in the cytoplasm of prokaryotic cells -acts on only one strand

Gene maps represent the distribution of loci in a genome. A variety of techniques are used to construct gene maps because gene maps of organisms with large genomes are typically constructed by piecing together genome components. In particular, physical mapping approaches provide high resolution and accuracy by using molecular biology techniques. select the physical mapping methods

-deletion mapping -somatic-cell hybridization -DNA fingerprinting -Fluorescence in situ hybridization

The bacterium Streptococcus pneumoniae has a virulent S strain and a nonvirulent R strain. The S strain is lethal to mice. The S strain contains a chemical factor that can transform the R strain to be virulent. If DNA is the transforming factor, for each set of substances injected into mice, indicate which of these injected substances will result in live mice?

-heat treated S strain -R strain -R strain and heat-treated S with polysaccharides, lipids, RNA, proteins and DNA destroyed

Identify the statements that are features of a promoter.(Select all that apply).

-in both prokaryotes and euks the promoter is located in the 5' direction upstream from the transcription start site -in proks the promoter contains a -35 and -10 regions upstream of the transcription start site -in euks the promoter recruits the preinitiation complex which includes the TATA-binding protein

the Siamese cat breed has a light-colored body and dark-colored head, tail, and feet, all of which are called points. The Burmese cat breed has a dark-colored body and points that are almost the same color as the body. Crossing Siamese with Burmese can produce the Tonkinese cat breed, which has coat and point color that is intermediate to the Siamese and Burmese parents. In all three breeds, a temperature sensitive enzyme is responsible for the dark coloration of the points. However, it is active only at the extremes of the body where it is coolest. Select the statements that are true regarding the evidence of incomplete dominance and incomplete penetrance in these breeds. (Select all that apply).

-intermediate coat color in tonkinese demonstrates incomplete dominance -development of points in Burmese demonstrates incomplete penetrance

Which of the following is a true statement about polymerase chain reaction (PCR). (Select all that apply).

-it duplicates a specific fragment of the genome -involves leading strand synthesis only -synthesizes DNA in a 5' to 3' direction

n butterflies, sex is determined by the ZW sex-determination system. Female butterflies are heterogametic and have both a Z sex chromosome and a W sex chromosome for sex determination. In contrast, male butterflies are homogametic and have two Z sex chromosomes. Select all of the relatives from which a female butterfly could have inherited her Z sex chromosome. (Select all that apply).

-paternal grandmother -father

Which of the following statements are true about eukaryotic transcription? (Select all that apply).

-promoter includes a TATA box -includes addition of a 5' cap

Identify the functions of an enhancer in transcription. (Select all that apply).

-regulates transcription by catalyzing the formation of an enhanceosome activating transcription -a cis-regulatory element that increases gene transcription in specific tissues or cells

Which does the termination of translation require? (Select all that apply).

-release factors -GTP -stop codon on the mRNA

Meiosis and mitosis are both forms of cell division. However, the outcomes of these processes differ. Consider a diploid organism with two sexes. Select the reasons why meiosis typically produces genetic variation, whereas mitosis does not. (Select all that apply).

-sister chromatids are not genetically identical as a result of crossing over during meiosis -gametic chromosomes have a different combination of alleles than parental chromosomes as a result of independent assortment -meiosis produces four genetically different haploid cells

Which of the following statements about euchromatin and heterochromatin are correct? (Select all that apply).

-the majority of transcription takes place on euchromatin -euchromatin undergoes condensation and decondensation throughout the cell cycle

Which of these choices describe Y-linked traits? (Select all that apply).

-the phenotype is solely expressed in males -the trait is passed down to a son by his father

A key discovery leading to the structure of DNA was done by Chargaff. He found that ____. (Select all that apply.)

-the tetranucleotide hypothesis was false -that the amount of A equals the amount of T and the amount of G equals the amount of C

A strain of bacteria possesses a temperature‑sensitive mutation in the gene that encodes the sigma factor. The mutant bacteria produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures. What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures? (Select all that apply).

-transcription that begin prior to the temperature shifts will be completed -transcription initiation will not occur normally at the elevated temperature

When conducting his initial genetic experiments, Gregor Mendel chose the pea plant as his research organism. He began conducting his genetic research on pea plant traits such as plant height, seed color, and seed shape. He started by using true-breeding, or pure-breeding, lines of pea plants. Select the characteristics of a true-breeding plant line. (Select all that apply).

-when selfed all of the offspring show the trait of interest -in most cases is homozygous for the trait of interest

Marfan syndrome is an autosomal dominant disorder caused by a mutation of the FBN1 gene that affects the connective tissue of the body. Suppose that two parents, a father with genotype FBN1 fbn1 and a mother with genotype fbn1 fbn1, are planning to have a family. What is the probability that they will have an affected daughter as their first child? Enter your answer as a decimal.

.25

Hemophilia was called "the royal disease" because many of the European royal families had members afflicted with hemophilia. Hemophilia is a sex-linked, recessive, X-chromosome disorder. It was known that Queen Victoria was unaffected but was a carrier of the hemophilia gene (XHXh). Suppose Queen Victoria's husband, Prince Albert, was affected with hemophilia (XhY). What is the probability that a son of Queen Victoria and Prince Albert would be unaffected? Enter your answer as a decimal

.5

In domestic chickens, some males display a plumage pattern called cock feathering. Other males and all females display a pattern called hen feathering. Cock feathering is an autosomal recessive trait that is exhibited in males only. Two heterozygous birds are mated. What fraction of the female offspring is expected to exhibit cock feathering?

0

What is the probability of obtaining an individual that is homozygous recessive for all genes from the cross AaBbDd x aaBbDd? Enter your answer as a decimal.

0.0313

Imagine that two unlinked autosomal genes with simple dominance code in goats for size, where L is large and l is small, and for color, where B is brown and b is white. If a small, white male goat mates with a large, brown female goat of an unknown genotype, what is the probability that they would produce small, white offspring? Enter your answer in decimal form.

0.0625

Genes A and B are 20 mu apart. What proportion of aaB_ offspring is expected from an AB/ab x Ab/aB cross?

0.21

In some sheep, the presence of horns is produced by an autosomal allele (H+) that is dominant in males and recessive in females. A horned female is crossed with a hornless male. What proportion of the male and female progeny from this cross will have horns?

1 male horned: 1 female hornless

Suppose a man is heterozygous for heterochromia, an autosomal dominant disorder which causes two different-colored eyes in an individual, produced 25 offspring with his normal-eyed wife. Of their children, 16 were heterochromatic and 9 were normal. Calculate the Chi-square value for this observation.

1.96

A male with a rare autosomal dominant trait marries a phenotypically normal woman. What proportion of their children should show the trait?

1/2

Phenylketonuria (PKU) is a disease that results from a recessive gene. Two normal parents produce a child with PKU. What is the probability that a sperm from the father will contain the PKU allele?

1/2

Phenylketonuria (PKU) is a disease that results from a recessive gene. Two normal parents produce a child with PKU. What is the probability that an egg from the mother will contain the PKU allele?

1/2

Phenylketonuria (PKU) is a disease that results from a recessive gene. Two normal parents produce a child with PKU. What is the probability that their next child will be heterozygous for the PKU gene?

1/2

In marsupials, all paternal X chromosomes are permanently inactivated. If a female kangaroo that is a carrier for X-linked colorblindness mated with a male with normal vision, which of the joeys would be colorblind?

1/2 males 1/2 females

In domestic chickens, some males display a plumage pattern called cock feathering. Other males and all females display a pattern called hen feathering. Cock feathering is an autosomal recessive trait that is exhibited in males only. Two heterozygous birds are mated. What fraction of the male offspring is expected to exhibit cock feathering?

1/4

Phenylketonuria (PKU) is a disease that results from a recessive gene. Two normal parents produce a child with PKU. What is the probability that their next child will have PKU?

1/4

In cats, curled ears result from an allele, Cu, that is dominant over an allele, cu, for normal ears. Black color results from an independently assorting allele, G, that is dominant over an allele for gray, g. A gray cat homozygous for curled ears is mated with a homozygous black cat with normal ears. All the F1 cats are black and have curled ears. What phenotypes and proportions are expected from the cross of an F1 cat with a stray cat that is gray and possesses normal ears.

1/4 black cats, curled ears; 1/4 black cats, normal ears; 1/4 gray cats, curled ears; 1/4 gray cats, normal ears

Marie and her brother Donnie are both healthy adults. Marie and her healthy boyfriend Dweezil have a healthy baby girl and Marie is pregnant again. They learn that Marie's and Donnie's mother has just had a baby by a second marriage (to a healthy male), and the baby has Hemophelia B. (Hemophelia is a rare X-linked recessive disorder that results in a failure of blood to clot properly). What is the probability Marie\'s new baby will have Hemophelia B?

1/8

Polydactyly (extra digits) is a dominant trait caused by gene P, as opposed to the normal allele p. Cystic fibrosis, f, is a recessive disease, as opposed to the normal condition, F. A polydactylous woman, otherwise normal in phenotype, has kids with a healthy normal man. Their 4 children have the following phenotypes:Child 1 is phenotypically normal in all respectsChild 2 is polydactylous, otherwise phenotypically normalChild 3 has cystic fibrosis, otherwise phenotypically normalChild 4 has cystic fibrosis and is polydactylousWhat is the probability that their 5th child will have cystic fibrosis and be polydactylous?

1/8

Suppose two independently assorting genes are involved in the pathway that determines fruit color in squash. These genes interact with each other to produce the squash colors seen in the grocery store. At the first locus, the W allele codes for a dominant white phenotype, whereas the w allele codes for a colored squash. At the second locus, the allele Y codes for a dominant yellow phenotype, and the allele y codes for a recessive green phenotype. The phenotypes from the first locus will always mask the phenotype produced by the second locus if the dominant allele (W) is present at the first locus. This masking pattern is known as dominant epistasis. A dihybrid squash, WwYy, is selfed and produces 160 offspring. How many offspring are expected to be white?

120

Species A has 2n = 8 chromosomes, and species B has 2n = 14 chromosomes. Calculate all possible chromosome numbers for an autotetraploid offspring of A. (Select all that apply).

16

Assume that the diploid or 2n number of chromosomes is 18 for a certain species of animal. How many DNA molecules will be found in metaphase II for this species?

18

If an Aa individual is crossed to an aa individual, what will be the phenotypic ratio in the offspring?

1:1

Two genes are determined to be linked when offspring phenotypic ratios following a testcross to a dihybrid heterozygote deviate from a:

1:1:1:1 ratio

What will be the genotypic ratio in the offspring of two Aa parents that are crossed with each other?

1:2:1

A geneticist is conducting an experiment by making a testcross. She expects the offspring of the testcross to result in a 1:2:1 ratio. She wants to see if her data for the three phenotypic classes could be reasonably assumed to have deviated from the expected values by chance. How many degree(s) of freedom should she use when evaluating the chi-square goodness-of-fit test?

2

A human male with the chromosome constitution of XXXYY would contain how many Barr bodies in his somatic cells?

2

In a hypothetical eukaryotic gene of an average length, how many introns would be found if the gene is known to contain three exons?

2

The principle of independent assortment involves at least how many different gene pairs?

2

In chickens the dominant allele Cr produces the creeper phenotype (having extremely short legs). However, the creeper allele is lethal in the homozygous condition. The homozygous recessive genotype results in a normal individual. If two creepers are mated, what will be the phenotypic ratio among the living offspring?

2 creepers: 1 normal

Suppose a particular species of tulip plant has three alleles for the gene that codes for flower color. The CR allele produces red tulips, the Cp allele produces purple tulips, and the Cw allele produces white tulips. CR is dominant over Cp and Cw, and Cp is dominant over Cw. What is the expected ratio of offspring for the cross CRCW x CPCW?

2 red: 1 purple: 1 white

In a homozygous dominant individual, an unequal crossover occurs in a region surrounding this gene resulting in a duplication/deletion. If the products of this meiosis unite with those from a homozygous recessive individual, what are the chances of the offspring displaying the recessive trait (assume the deletions are viable)? Hint: think carefully about which gametes will be produced from a single crossover event within a tetrad, and which of these would carry the dominant allele.

25%

In pea plants, the allele for round seed shape is completely dominant to the allele for wrinkled seed shape. In a cross between two heterozygous pea plants, what are the chances that an offspring with wrinkled seeds will be produced?

25%

Coyotes are diploid organisms, and their gametes contain 39 chromosomes. When the somatic (body) cells of a coyote are in interphase, the ploidy level is denoted as _____ and each cell has ____ chromosomes.

2n,78

The number of hydrogen bonds between complementary G-C pairs is _______.

3

White Leghorn chickens are homozygous for the dominant allele C, which produces colorful feathers. However, they are also homozygous for the dominant allele I of an independently assorting gene that inhibits feather coloration. Consequently, Leghorns are white. The white Wyandotte chicken has a genotype of ccii, with neither the allele for color nor the inhibitor allele. What offspring would you get from a testcross of a chicken heterozygous at these 2 loci?

3 white: 1 colorful chickens

Precocious puberty is a dominant, sex-limited trait represented by the allele D. If a precocious Dd male mates with a normal (non-precocious) Dd female, what proportion of their children will exhibit precocious puberty?

3/8

Plant species P has 2n = 18 and species U has 2n = 14. A fertile hybrid is found. How many chromosomes does it most likely have?

32

If the adenine content of a DNA molecule is 16%, what is the percentages of guanine?

34

In pea plants, plant height is controlled by a single autosomal dominant gene. Tall plants (H) are dominant to short plants (h). In a cross of two tall heterozygous plants, which phenotypic ratio is expected from the resulting offspring?

3:1

Suppose Jonathan breeds flowers and wants to optimize production of offspring with both short stems and white flowers, which are coded for by two genes with the recessive alleles t and p, respectively. In flowers, T codes for tall stems and P codes for purple flowers. Jonathan crosses two heterozygotes that produce 656 offspring. How many of these 656 offspring are predicted to have both short stems and white flowers?

41

Choose the DNA sequence of the strand that is complementary to 5' CAGCTAAATC 3'.

5' GATTTAGCTG 3'

Which RNA sequence would be transcribed from the DNA template 5'-ACGTCAATGGA-3'?

5'-UCCAUUGACGU-3'

In humans, alkaptonuria is a metabolic disorder in which affected persons produce black urine. Alkaptonuria results from an allele (a) that is recessive to the allele for normal metabolism (A). Sally has normal metabolism, but her brother has alkaptonuria. Sally's father has alkaptonuria, and her mother has normal metabolism. If Sally marries a man with alkaptonuria, what is the probability that their first child will have alkaptonuria?

50%

A gene has three alleles. How many different genotypes are possible at this locus in a diploid organism?

6

A parent cell has 4n=12 chromosomes. How many chromosomes will each daughter cell have following meiosis?

6

A parent cell is 6N=12 chromosomes. How many chromosomes will each daughter cell have following meiosis?

6

Epistasis refers to the interaction of genes, wherein the expression of one gene is dependent on another gene. For example, suppose there are two genes that code for flower color in a plant, where red, WW or Ww, is typically dominant over expression of white, ww, and yellow, YY or Yy, is tyically dominant over green, yy. One type of epistasis expresses a pattern where a dominant allele in either gene produces a red phenotype. Which F1 flower color ratio would be produced from the dihybrid cross for a phenotype that results from duplicate recessive epistasis?

81 red: 63 green

In a hypothetical mouse species, brown fur (B) is completely dominant to white fur (b), and long fur (L) is completely dominant to short fur (l). If two mice heterozygous for both traits mate and produce a litter of pups, what is the probability that an individual pup will have brown, long fur?

9/16

Suppose in a species of petunia, both locus A and locus B can independently determine petal color. At locus A, pink (A) is dominant over white (a). At locus B, pink (B) is also dominant over white (b). If there are dominant alleles at both loci, magenta petals are produced. If an AA BB plant is crossed to an aa bb plant, what is the ratio of magenta- to pink- to white-flowered petunias expected in the F2 progeny?

9:6:1

Which of the following statements about DNA is true?

A strand that reads 5'-ATCTAG-3' would have a complementary strand that reads 5'-CTAGAT-3'.

Griffith\'s experiment injecting a mixture of dead and live bacteia into mice demonstrated that

A substance was capable of transforming one bacterial cell type into another.

Which of the events occur during eukaryotic translation elongation?

A tRNA binds a codon and the ribosome adds amino acids from each tRNA to the polypeptide chain.

In humans, blood types A and B are codominant to each other and each is dominant to O. What blood types are possible among the offspring of a couple of blood types AB and A?

A,B and AB

Which of the following sequences would form a hairpin structure in RNA?

AACGUUUAUAAACGUU

Which mRNA codon functions as the start codon, directing the ribosome to begin translating the mRNA from the correct end?

AUG

Epistasis often results in modified dihybrid phenotypic ratios. Assume that you obtain one such modified ratio, 9:7, with the gene pairs A and B involved. What would be a possible genotype for a phenotype that would be included with the 9 portion of the modified ratio?

AaBB

When population size is small, what are the consequences?

Allele frequencies change rapidly and randomly, and one can eventually become fixed in the population.

A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. What would be a possible explanation for how the same gene can encode both of these proteins?

Alternative splicing or multiple 3 cleavage sites can generate multiple versions of mature mRNA transcripts from a single gene.

A geneticist uses a cloning plasmid that contains the lacZ gene and a gene that confers resistance to penicillin. She inserts a piece of foreign DNA into a restriction site located within the lacZ gene and uses the plasmid to transform bacteria. She then grows the bacteria on selective media containing penicillin and X‑gal. Explain how the geneticist can identify bacteria that contain a plasmid with the foreign DNA.

Bacteria with the desired plasmid produce white colonies.

Suppose that a species of beetle has several different possible body colors. This color is controlled by two pigment genes, B and R. The en dash in the following genotypes signifies that either allele of the gene could be present. Beetles that are B- R- have brown shells; beetles that are B- rr have blue shells; beetles that are bb R- have red shells; and beetles that are bb rr have white shells. A blue beetle is crossed to a red beetle. The F1 progeny from the cross is comprised of 12 brown, 11 blue, 13 red, and 10 white beetles. What are the genotypes of the parents? Blue parent Bbrr Red parent bbRr

Bbrr bbRr

How are transcription and replication similar?

Both processes require the separation of the DNA double helix and the synthesis of a new strand of nucleic acid from a DNA template.

All of the following are true statements about both prokaryotic and eukaryotic transcription EXCEPT one. Which is the false statement?

Both prokaryotes and eukaryotes have remote enhancer sequences that increase transcription rates.

Meiosis generates genetic diversity by:

Both random segragation of homologous chromosomes and crossing over within tetrads during meiosis 1.

How did Mendel use self-pollination and cross-pollination techniques in his experiments with flower color to observe the basic patterns of inheritance?

By cross-pollinating a parental generation of plants with different colored flowers and allowing the F1 generation to self-pollinate, Mendel observed the basic patterns of inheritance in the F2 generation.

Plasmids are small circular DNA molecules found in bacteria that replicate separately from chromosomes. Why are plasmids essential for recombinant DNA technology?

DNA from a gene of interest can be inserted into a plasmid, then the modified plasmid can be inserted into a bacterial cell to make many copies of a gene of interest.

Which of the following components required for prokaryotic DNA replication is not involved in "unwinding" the DNA template?

DNA ligase

Using X-ray crystallography, Rosalind Franklin was able to produce X-ray diffraction images of DNA that were clearer than any previously produced images. What did the images show regarding the structure of DNA?

DNA molecules are in the shape of a double helix.

Which one of the statements accurately describes gel electrophoresis?

DNA moves through the gel toward the positive electrode.

Given that how tightly packed a region of DNA is helps control access of enzymes to this region, which of the following would you expect to be most tightly coiled?

DNA regions that do not code for proteins (not transcribed)

What value represents the number of ways in which the expected classes are free to vary in the chi-square goodness-of-fit test?

DOF

In fruit flies, black body type is a variant of the wild-type brown body. You cross 2 true-breeding black-bodied flies, and the resulting offspring are all brown-bodied wild-types. Which of the following best explains this result?

Each black fly had a mutation in a different gene.

Which of the following is a true statement regarding DNA structure?

Each strand of the DNA molecule has directionality.

Which of the statements describes what happens during mismatch repair of DNA?

Enzymes identify the newly synthesized DNA strand, remove a segment surrounding the mismatched nucleotides, and resynthesize the DNA segment correctly.

What is the difference between euchromatin and heterochromatin?

Euchromatin is decondensed during early in the cell cycle, whereas heterochromatin remains highly condensed.

Which of the following differs between eukaryotic and prokaryotic replication?

Eukaryotes have multiple replicons per chromosome.

In the XX-XO mechanism of sex determination, which of the following statements is true?

Females have two X chromosomes (XX) and males have one X (XO).

Which products would be inducibly expressed?lacI+ lacOc lacZ- lacY+ / lacI- lacO+ lacZ+ lacY-

Functional B-gal & nonfunctional permease

Which statement explains why the recombination frequency between two genes is always less than 50%?

Genes with a recombination frequency near 50% are unlinked and have an equal likelihood of being inherited together or separately.

Which statement about mutations is incorrect?

Germ-line and somatic mutations are both passed on to offspring.

The eukaryotic protein critical for organizing chromatin structure is histone. Which of the following histone proteins is not included in the histone "core" that is often described as the "beads"?

H1

What are hairpins and how do they form?

Hairpins are secondary structures that form when sequences of nucleotides on the same strand are inverted complements.

An X-linked recessive gene causes red-green color blindness in humans. Suppose John and Cathy have normal color vision. After 10 years of marriage to John, Cathy has given birth to a color-blind daughter and a color-blind son. John filed for divorce, claiming that he is not the father of at least one of the children. Which of the following statements describes John's paternity claim?

He cannot be the father of Cathy's daughter.

What happens during metaphase I of meiosis?

Homologous chromosomes are paired in the middle of the cell.

How is meiosis 1 different from meiosis 2?

Homologous chromosomes separate during meiosis 1.

Which of the following statements describes the function of the sigma factor in prokaryotic transcription?

It facilitates the binding of RNA polymerase to the promoter to initiate transcription.

What is the function of the lac operator?

It is bound by the lac repressor protein.

Which of the following is a true statement?

It is slightly more difficult to separate cytosine and guanine base pairs than it is to separate adenine and thymine.

Which of the following statements describes the semiconservative model of DNA replication correctly?

It proposes that the two nucleotide strands unwind and each serves as a template for a new DNA molecule.

Choose the correct explanation of how the polymerase chain reaction is used to amplify a specific DNA sequence by placing the following steps in the CORRECT order. 1Primers are extended by a heat stable DNA polymerase. II Double‑stranded template DNA is denatured at a high temperature. III Primers corresponding to the ends of the DNA sequence are annealed to the template. IV Cycle is repeated 30 times or more.

II, III, I, IV

Why are linked genes often inherited together?

Linked genes are close together on the same chromosome.

Which statement about cellular DNA in incorrect?

Most cellular DNA is positively supercoiled.

Which best describes Mendel's principle of independent assortment?

Non-homologous chromosomes move independently of each other at meiosis I.

Why does replication occur 5' to 3' only?

Only the 3' carbon has a free hydroxyl group

A powerful genetic engineering technique used for the amplification of sequences of DNA is _____.

PCR

In flowers, purple color (R) is dominant over white (r), and straight petals (L) are dominant over curly (l). What gametes can an individual that is RrLL make?

RL rL

Which statement about RNA is NOT true?

RNA is a more stable molecule than DNA.

Describe what happens at the elongation stage of transcription.

RNA polymerase moves along the DNA template strand in a 3' to 5' direction, unwinding the DNA and synthesizing RNA in a 5' to 3' direction.

What would be the effect on DNA replication of a mutation that destroyed the 5' to 3' exonuclease activity in DNA polymerase I?

RNA primers could not be removed from the DNA during replication.

The evidence that led Hershey and Chase to determine that DNA was the genetic material included:

Radioactively-labeled P was found in the pellet, indicating that DNA had entered the cells.

In the Hershey-Chase experiment, if protein had been the genetic material, you would expect:

Radioactively-labeled sulfur would show up in the pellet.

What is semiconservative replication?

Replication resulting in products that consist of one strand of template DNA and one strand that has been newly synthesized

Which of the following is a true statement?

SRY gene does not directly produce testosterone

With the genic sex-determination mechanism, which of the following statements is true?

Sex is determined by genes on undifferentiated chromosomes.

Describe what happens at the termination stage of transcription.

Synthesis of RNA is terminated, and the RNA polymerase separates from the DNA template and releases the transcript.

What is the purpose of the dideoxynucleoside triphosphate (ddNTP) in the dideoxy sequencing reaction?

The ddNTP terminates synthesis on a strand after it is incorporated by DNA polymerase.

Which of the following provides the necessary control that indicates that the IIR strain did not simply mutate into IIIS?

The experiment where live IIR was injected into mice.

Which of the following is a correct statement about replication?

The leading strand is synthesized continuously, because it is synthesized in the same direction that the replication fork is moving.

The first cloned cat, CarbonCopy (CC), was tabby, while the cat she was cloned from, Rainbow, was calico. The surrogate mother was a tabby. Select the explanation that best explains why CC would never have been identical in pattern to Rainbow.

The pattern of X-chromosome inactivation is established randomly in a cell lineage.

What are chromosomal puffs?

The puffs are sites of intense transcriptional activity.

How are dideoxy nucleoside triphosphates (ddNTPs) used to determine the sequence of a DNA molecule?

The stop the DNA replication reaction at a particular nucleotide.

For this question, let's say that DNA actually replicates in a conservative fashion (NOT what we know to be the case in reality). You raise E. coli in a medium of heavy N-15, and then transfer it to a medium with N-14 and let it replicate once. Where would you expect it to appear in a density-gradient test tube?

There would be 2 bands: one near the bottom and one near the top of the test tube.

How is a true breeding yellow-seeded pea plant different from a hybrid yellow-seeded pea plant?

They have the same phenotype but different genotypes.

What contribution did James Watson and Francis Crick make to our understanding of DNA?

They modeled the structure of DNA based on the limited data available.

Describe what happens at the initiation stage of transcription.

Transcription proteins assemble at the promoter to form the basal transcription apparatus and begin synthesis of RNA.

In fruit flies, long wings (W) are dominant over short wings (w), and brown pigments (N) are dominant over yellow pigments (n). Each individual possesses two alleles for each trait. If a fly that is homozygous dominant for both traits is crossed with a fly that is homozygous recessive for both traits, what is the predicted genotype of the offspring?

WwNn

Coat color in cats is determined by genes at several different loci. At one locus on the X chromosome, one allele (X ) encodes black fur and another allele (Xo) encodes orange fur. Females can be black (X X ), orange (XoXo), or a mixture of orange and black called tortoiseshell (X Xo). Males are either black (X Y) or orange (XoY). Bill has a female tortoiseshell cat named Patches. One night, Patches escapes from Bill\'s house, spends the night out, and mates with a stray male. Patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. What is the genotypes of Patches and of the stray male?

X+Xo; XoY

Miniature wings, Xm, in Drosophila melanogaster result from an X-linked allele that is recessive to the allele for long wings, X . A miniature-winged male is crossed with a long-winged female. The resulting male offspring are 410 long and 417 miniature. The resulting female offspring are 412 long and 415 miniature. What are the genotypes of the parent flies?

XmY; X+Xm

Coat color in cats is determined by genes at several different loci. At one locus on the X chromosome, one allele (X ) encodes black fur and another allele (Xo) encodes orange fur. Females can be black (X X ), orange (XoXo), or a mixture of orange and black called tortoiseshell (X Xo). Males are either black (X Y) or orange (XoY). Bill has a female tortoiseshell cat named Patches. One night, Patches escapes from Bill\'s house, spends the night out, and mates with a stray male. Patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. What is the genotype of the orange female kitten?

XoXo

Which of these is the first step of translation elongation?

a charged tRNA binds to the a site

What is complementary DNA (cDNA)?

a double‑stranded DNA molecule that is a copy of an mRNA

Both Ms. White and Ms. Schrader had babies the same day in the same hospital. Ms. White took home a baby girl named Holly. Ms. Schrader took home a baby girl named Emma. Ms. Schrader began to suspect, however, that her child had been accidentally switched with the White's baby in the nursery. Blood tests showed that Mr. White was type B, Ms. White type A, and Holly type O, while Mr. Schrader was type O, Ms. Schrader type AB, and Emma type B. Which of the following is true?

a mix-up definitely did not occur

Penile hypospadias, a birth defect in male humans in which the urethra opens on the shaft instead of at the tip of the penis, results from an autosomal dominant gene in some families. Females who carry the gene show no effects. What type of trait is this birth defect an example of?

a sex-limited trait because the defect occurs only in males and the gene involved is autosomal

Match each cellular component to a role in transcription or translation in eukaryotic cells. a. adds RNA nucleotides to growing RNA using a DNA template b.contains DNA in the cell c. region of DNA that recruits transcriptional machinery d. carries an amino acid to ribosomes and binds to mRNA e. site of protein synthesis

a. RNA polymerase b. nucleus c. promoter d. tRNA e. ribosomes

The given DNA non-template sequence (coding sequence) is transcribed from 5' to 3' Use the sequence to determine the type of mutation and the type of base substitutions that apply to each scenario. 5' A T G A A G C G C T C A G T A 3' a. an adenine substituted for nucleotide 5 b. a guanine substituted for nucleotide 12 c. an adenine substituted for nucleotide 15

a. nonsense and transversion b. silent and transition c. missense and transversion

A true-breeding white-floweredplant and a true-breeding orange-flowered plant were crossed. The F1 offspring from the cross were all red flowered. When the F1 offspring were crossed, the F2 generation yielded 460 red, 160 orange, and 210 white-flowered plants. What was the genotype of the orange-flowered parent plant?

aaBB

A true-breeding spiny-tailed lizard mates with a true-breeding smooth-tailed lizard. All of the offspring are club-tailed. When two of these club-tailed lizards mate, the offspring include: 9 club-tailed, 3 spiny-tailed, 3 smooth-tailed, and 1 warty-tailed lizards. Which of the following is the most likely genotype of a smooth-tailed lizard?

aaB_

Which of the following has 2 rings?

adenine

which is an example of a transversion mutation

adenine is replaced by thymine

During one cycle of replication, when does DNA polymerase I play a role?

after DNA polymerase III

If a man exhibits a Y-linked trait, what proportion of his sons should also be affected?

all

At the end of your biology class, your professor asks you to develop a project to determine the genotype of a plant with red flowers. Red petal color (R) is dominant to pink flower color (r). To accomplish this task, you cross the plant with the unknown genotype with heterozygous red-flowered plants. Which of the following are valid predictions of the ratio of flower colors in the offspring? (Select all that apply.)

all red flowers 3 red: 1 pink

The white-eyed mutation in Drosophila studied by Thomas Hunt Morgan was the first clear case of sex-linked inheritance. When Morgan crossed a white-eyed female with a red-eyed male, what phenotypes were present in the offspring?

all the males had white eyes and all the females had red eyes

A cross between an AABB individual and an aabb individual will produce what type of offspring?

all will be AaBb

Genes come in different versions called:

alleles

________ is a type of polyploidy that arises from the hybridization between two different species.

allopolyploidy

Gene X encodes 2 different proteins: Protein A contains exons 2 and 3, while Protein B contains exons 1 and 3. Which of the following is most likely responsible?

alternative splicing

in flies the determination of male vs female genotype is the result of

alternative splicing

Polymerase Chain Reaction (PCR) is used to:

amplify a particular segment of DNA

The major contribution of Franklin and Wilkins to the study of DNA was ______.

an X-ray diffraction pattern

Which of the following cannot occur with X-linked dominant inheritance for a rare trait?

an affected man can pass on the trait to his son

amino acids are linked to their corresponding tRNA via

an aminoacyl-tRNA synthetase

The reading frame of a nucleotide sequence is established by

an initiator codon

In which stage of meiosis does the separation of homologous chromosomes occur?

anaphase I

As DNA is replicated, both continuous and discontinuous replication occur. Discontinuous replication is the result of which specific feature of DNA?

antiparallel strands

A trait appears in both men and women with equal frequency, and offspring can inherit the trait from the mother or the father. All affected individuals have at least one affected parent. This trait is ____________.

autosomal dominant

which mutation incorporate into DNA and frequently pair with the wrong base

base analogs

In bearded dragons sex is determined by which of the following?

both sex chromosomes and temperature

in the lac operon when lactose is present, to what is the repressor protein bound?

bound to allolactose

In German cockroaches, bulging eyes, bu, are recessive to normal eyes, bu , and curved wings, cv, are recessive to straight wings, cv . Both traits are encoded by autosomal genes that are linked. A cockroach has genotype bu+bu cv+cv, and the genes are in repulsion. Which of the following sets of genes will be found in the most common gametes produced by this cockroach?

bu cv+

How is the transcription start site determined in bacteria?

by the binding of RNA polymerase to the consensus sequences of the promoter

In the process of creating a genetically modified organism using recombinant DNA (rDNA), why would you create complementary DNA (cDNA)?

cDNA allows expression of a eukaryotic gene in a bacterium.

Restriction endonucleases:

can be used to create pieces of DNA with cohesive ends.

Which of the following events occur in the process of meiosis II? (Select all that apply).

cellular division

Which of the following events occur in the process of mitosis? (Select all that apply).

cellular division

Which of the following events occur in the process of meiosis I? (Select all that apply).

cellular division random distribution of chromosomes generates genetic variation crossing over reduces number of chromosomes

Suppose that an X-shaped structure containing DNA has just been separated into two equal parts during anaphase of mitosis. After the separation, what is each molecule called? Select all answers that apply.

chromosome and chromatid

A boy has blood-type MN with a genotype of LMLN. His red blood cells possess both the M antigen and the N antigen. What is the relationship between his two alleles for this gene?

codominance

What is the key feature of DNA that allows it to be copied?

complementary base pairing

A man and a woman are both deaf due to being homozygous for a recessive autosomal mutant allele. However, they are homozygous recessive at different gene loci. If all their children have normal hearing, which of the following has occurred within each child?

complementation

You carry out a testcross to a DdNn plant and obtain the following: 14 Ddnn, 90 DdNn, 86 ddnn, 10 ddNn. Are these alleles in coupling or repulsion linkage formation?

coupling linkage

The process of splitting the cytoplasm, which separates one cell into two, is termed:

cytokinesis

In humans, mitochondrial genetic disorders are inherited from only the mother. The severity of such diseases can vary greatly, even within a single family. What form of inheritance does this represent?

cytoplasmic inheritance

Which is the most commonly methylated nucleotide?

cytosine

scientist attempts to synthesize a small DNA fragment. He has a template strand, pol III, and a heat source. This will be leading strand synthesis only. What else does he need? (Select all that apply)

dNTPs DNA primers

When a solution containing double-stranded DNA is heated, the hydrogen bonds that hold the two strands can be weakened and eventually broken, separating the strands completely. This process is called ______.

denaturation

Which enzyme is responsible for converting double-stranded into siRNAs and miRNAs?

dicer

What is a cross that occurs between two individuals that differ in two characteristics?

dihybrid cross

Three-point testcrosses are often used to map genes. The two least frequent classes from such crosses usually represent which of the following types of progeny?

double-crossover progeny

what is the function of microRNA

downregulate gene expression

A student has two dominant traits dependent on single genes, cataract (an eye abnormality), which he inherited from his mother, and polydactyly (extra fingers and/or toes), which he inherited from his father. If the loci for these two traits are very closely linked, would the student's child be more likely to have:

either cataract or polydactyly

What is a restriction enzyme?

enzymes that can cut DNA molecules at or near a specific nucleotide sequence

What type of gene action occurs when one gene masks the effect of another gene at a different locus?

epistasis

Which statement is most consistent with the one gene, one enzyme hypothesis originally proposed by Beadle and Tatum?

every gene encodes a separate enzyme

In sheep, lustrous fleece results from an allele (L) that is dominant over an allele (l) for normal fleece. A ewe (adult female) with lustrous fleece is mated with a ram (adult male) with normal fleece. The ewe then gives birth to a single lamb with normal fleece. What are the likely genotypes of the two parents?

ewe(Ll) ram (ll)

If a mutation occurred to an enhancer sequence, what would be the most likely result?

fewer transcripts would be made

Suppose that a mother seeks genetic counseling because she is concerned that her child may have velocardiofacial syndrome, a syndrome that can result in symptoms such as a cleft palate and heart defects. The genetic counselor is aware that this disease is caused only by a small deletion in chromosome 22q11.2, that traditional karyotyping often overlooks. Consequently, the genetic counselor informs the mother that a cost-effective test will be conducted to visually detect the presence or absence of the specific chromosomal change by using velocardiofacial syndrome-specific probes and a sample of the child's DNA. To which of the following techniques is the genetic counselor referring?

fluorescence in situ hybridization

A normal polypeptide reads: Met-Trp-Asp-Gln. After exposure to a mutagenic chemical, the polypeptide produced is Met-Trp-Ile-Ser-Glu... What type of mutation occurred?

frameshift

What is the purpose of the polymerase chain reaction (PCR)?

generate copies of a piece of DNA

A gene whose expression is affected by the sex of the transmitting parent demonstrates which of the following?

genomic imprinting

The phenomenon in which a gene's expression is determined by its parental origin is called:

genomic imprinting

Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed that the plants have white, green, or patchy white and green (variegated) leaves. Melissa would like to have only four o'clock plants with variegated leaves, so she crosses a few of her plants to see which crosses produce offspring with varigated leaves. She knows that leaf color is determined by the color of the chloroplasts. For each cross, determine the offspring phenotypes that could be observed. Each cross may produce plants with one or more different phenotypes. What phenotypes of the offspring would result from the following cross (select all that apply): green female x variegated male

green

Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed that the plants have white, green, or patchy white and green (variegated) leaves. Melissa would like to have only four o'clock plants with variegated leaves, so she crosses a few of her plants to see which crosses produce offspring with varigated leaves. She knows that leaf color is determined by the color of the chloroplasts. For each cross, determine the offspring phenotypes that could be observed. Each cross may produce plants with one or more different phenotypes. What phenotypes of the offspring would result from the following cross (select all that apply): variegated female x white male

green, variegated, white

Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed that the plants have white, green, or patchy white and green (variegated) leaves. Melissa would like to have only four o'clock plants with variegated leaves, so she crosses a few of her plants to see which crosses produce offspring with varigated leaves. She knows that leaf color is determined by the color of the chloroplasts. For each cross, determine the offspring phenotypes that could be observed. Each cross may produce plants with one or more different phenotypes. What phenotypes of the offspring would result from the following cross (select all that apply): variegated female x green male

green,white, variegated

Which of the following terms describes the situation, for X-linked genes, in human and Drosophila males who have only one X chromosome?

hemizygous

What term describes an individual possessing two of the same alleles at a gene locus?

homozygous

What information can the chi-square goodness-of-fit test provide?

how well the observed results of a genetic cross fit the expected values

Fur color in a species of mouse is controlled by a single gene pair. BB animals are black and bb animals are white. Bb animals have gray fur and each hair is gray. What type of interaction is being shown by the two alleles in heterozygous animals?

incomplete dominance

Acetylation of histone proteins is associated with which of the processes?

increased transcription

All of the following are typical components of most prokaryotic mRNAs EXCEPT:

introns

Which of the following is/are transcribed? (Select all that apply).

introns

Why is Taq polymerase used as the DNA polymerase in the polymerase chain reaction (PCR)?

it is thermodynamically stable at the temperature used to separate the DNA strands

What characteristic is not necessary for a molecule that is the genetic material?

it must perform the action associated with the phenotype

Spindle fibers attach to a _________________ on a chromosome.

kinetochore

Which allele is dominant, lacI+ or lacIS? lacI+

lacIS

A mutation in the lac promoter region that causes this region to no longer function would lead to

lack of expression of the lac structural genes in the presence of lactose

What would you use to seal gaps in the sugar-phosphate backbone?

ligase

A fruit fly, Drosophila melanogaster, that has only one sex chromosome (XO) and two sets of autosomes would have which of the following sexual phenotypes?

male

What is epigenetics?

mechanisms by which changes in phenotype are maintained in a cell or are passed to other cells or future generations without a change in the base sequence of DNA

How do mismatch‑repair enzymes in E. coli differentiate between the old and new strands of DNA?

methylation of the adenine in the GATC sequence of the old strand

What is the mechanism by which base analogs cause mutations?

mispairing with normal bases

Leber hereditary optic neuropathy (LHON) is a human disease that exhibits cytoplasmic inheritance. It is characterized by rapid loss of vision in both eyes, resulting from the death of cells in the optic nerve. A teenager loses vision in both eyes and is later diagnosed with LHON. How did this individual MOST likely inherit the mutant DNA responsible for this condition?

mitochondrial gene from the mother

migration does not result in

more genetic variation between populations

What is an environmental agent that significantly increases the rate of mutation above the spontaneous rate called?

mutagen

the Trp operon is of which type

negative repressible

When a circular DNA gets underrotated by the action of cellular enzymes, the DNA is said to exhibit _____.

negative supercoiling

If protein was the genetic material...what would happen if you exposed the dead IIIS filtrate to protease before mixing with IIR?

no transformation would occur

Failure to separate for homologous chromosomes or sister chromatids is referred to as _______.

nondisjunction

A man who is blood type O and a woman who is blood type AB have a child that has blood type AB. What is the most likely explanation?

nondisjunction in female meiosis I

A trait shows X-linked dominant inheritance. A normal daughter of an affected mother marries a normal man. What proportion of their children will be affected?

none

Which happens last in bacterial mRNA processing?

none

Which of the following are likely to be found on a bacterial mRNA?

none

In humans, oculocutaneous (OCA) albinism is a collection of autosomal recessive disorders characterized by an absence of the pigment melanin in skin, hair, and eyes. That is, normal pigmentation (A) is dominant over albinism (a). For this question, assume it is a single gene with two alleles. If two people have normal pigmentation, what possible phenotypes may be observed in their offspring?

normal pigmentation or albinism

Select the definition of a paramutation.

one allele that induces a heritable change in another allele at the same locus

The gene for petal color in daisies has 2 forms: P is dominant and codes for purple coloration, while p codes for white coloration. The gene for petal length also has 2 forms: L codes for long petals, while l codes for short petals. The genes P and L are closely linked. You cross a true-breeding purple short daisy with a true-breeding white long daisy to get a heterozygous F1 generation. If these 2 genes are completely linked so that no crossing over occurs, what gametes will the F1 produce?

pL and Pl

Which of the following occurs first in the E. coli translation process?

peptidyl transferase action

What is the physical appearance or manifestation of a characteristic called in genetics?

phenotype

A strong covalent bond between adjacent nucleotides is a/an ______.

phosphodiester bond

Eukaryotic cells that contain more than two sets of genetic information are referred to as ____________________.

polyploid

Which of the following statements about polyploidy is not true?

polyploidy is possible only between the members of the same species

When mRNAs are being translated simultaneously by multiple ribosomes, the structure is known as a(n)

polyribosome

Consider the chemical charge of DNA. What kind of charge would histone proteins have in order to bind DNA?

positive

The type of transcriptional control in operons in which a regulatory protein is an activator and stimulates transcription is called:

positive control

When a molecule binds to the regulator protein, the regulator protein binds to the operator, causing an increase in gene product. This operon is:

positive inducible

Which of the following is NOT a difference between eukaryotic and bacterial expression regulation?

presence of regulator proteins

An individual possesses two alleles at a locus and these two alleles separate when gametes are formed, one allele going into each gamete. This genetic concept is known as which of the following?

principle of segregation

Which of the following is NOT transcribed?

promoter

What parts of DNA make up a typical bacterial transcription unit in the correct order that they occur (5'-3' on the non-template/coding strand)?

promoter, transcriptional start site, RNA‑coding region, terminator

Suppose a scientist measures the amount of DNA per cell of a particular diploid species at various stages of meiosis. She finds that the meiotic cells contain 3.7 pg, 7.3 pg, or 14.6 pg of DNA. Which stage of the cell cycle could contain 14.6 pg of DNA? (Select all that apply).

prophase 1 telophase I before cytokinesis G2

In nature, the purpose of the CRISPR‑Cas system is to

protect bacteria and archaea from invading DNA elements

Bacteria are found on Mars, and scientists are curious about their genetic material. In a transformation experiment, bacterial strains exposed to both RNase and DNase were able to successfully transform other strains. Which could be the Martian genetic molecule?

protein

What is a shorthand method for predicting outcomes of genetic crosses?

punnett square

what changes does UV light produce in DNA molecules

pyrimidine dimers

Suppose a group of researchers analyzed a new species of flowering plant. In this species, flower color is determined by two genes. They crossed a truebreeding red-flowered stock with a truebreeding white-flowered stock. They then crossed the F1 offspring together and analyzed the next generation. Upon examining the flower color, they found that the F2 generation contained 89 purple, 31 red, and 39 white flowers. What genetic term best describes the inheritance pattern of flower color for this species?

recessive epistasis

Snapdragons occur in nature as either green or yellow plants. A green snapdragon is homozygous and has the genotype CC. A yellow snapdragon is heterozygous and has the genotype Cc. Suppose that a gardener crosses two yellow snapdragons, and one-third of the offspring are green and two-thirds of the offspring are yellow. What type of allele could be responsible for the 2:1 offspring ratio seen when two yellow snapdragons are crossed?

recessive lethal allele

An individual unit of replication is referred to as _____.

replicon

An operon in which transcription is normally ON and something must happens to turn transcription OFF is called:

repressible

How does the structure of DNA encode genetic information?

sequences of bases

In domestic chickens, some males display a plumage pattern called cock feathering. Other males and all females display a pattern called hen feathering. Cock feathering is an autosomal recessive trait that is exhibited in males only. What type of inheritance is exhibited by this trait?

sex-limited

A recessive mutant allele of an autosome gene in a species of mouse results in a shorted tail in males when homozygous. However, when homozygous in females, this genotype has no effect, and the mice have normal tails. What is this genetic phenomenon called?

sex-limited characteristics

Suppose the ear length of two populations of jerboas is controlled by one gene. To determine the mode of inheritance, a homozygous short-eared female is crossed with a homozygous long-eared male. The resulting F1s are all short eared. Then siblings from the F1 are crossed, and the resulting offspring (the F2s) are counted. The F2 males are 1 long eared : 1 short eared; the F2 females all have short ears. (Note: The F2 females were originally listed incorrectly as having long ears). What is the most likely mode of inheritance for this gene?

sex-linked dominant

Most bacterial RNA polymerases are made up of five subunits that have distinct functions for transcription. Which of the subunits does not permanently associate with the enzyme core?

sigma

What happens during metaphase II of meiosis?

sister chromatids are distributed in a single layer across the center of the cell

Which of the following is NOT a difference between mitosis and meiosis?

sister chromatids separate during mitosis but not during meiosis

Which of the following is a physical-mapping technique that can be used to determine the human chromosome that contains a gene of interest?

somatic-cell hybridization

Which of the following terms describes the tertiary structural organization of chromosomal DNA that allows the long strand to be packed and fit into the cytoplasm of the cell?

supercoiling

DNA replication involves multiple steps that require different enzymes. Which process does primase catalyze in DNA replication?

synthesis of a short RNA sequence that initiates DNA synthesis

Which of these is NOT involved in the initiation of translation in bacteria?

tRNA carrying the next amino acid that will occupy the A site

What is the first stage of protein synthesis?

tRNA charging in which the tRNAs bind to amino acids

Which enzyme is responsible for the replication of chromosome ends in germ cells and certain proliferating somatic cells?

telomerase

Recombinant DNA technology is a set of molecular methods used to isolate, manipulate, and study DNA. What does recombinant mean, in this case?

that the DNA used is often derived from two or more sources and combined

If a plant has a genotype of Aa, we would assume which of the following?

the A allele is dominant to the a allele

In eukaryotic gene regulation, RNA interference occurs through

the action of small interfering RNAs that mediate the degradation of complementary mRNA molecules.

When Mendel crossed a plant homozygous for round seeds to another plant homozygous for wrinkled seeds, he found that all the progeny had round seeds. How is this explained?

the allele for round seeds is dominant to the allele for wrinkled seeds

In the Hershey-Chase experiment, DNA was demonstrated to be the genetic material because the 32P label for DNA localized to ________.

the bacterial pellet

Which of the following was not shown by Watson and Crick's model of DNA?

the bases face outside for easy access

Why is the cultivated banana infertile?

the chromosome will not segregate in a balanced way at meiosis I

what is genomic imprinting

the differential expression of an allele depending on whether it is inherited from the male or female parent

A yellow female Labrador retriever was mated with a brown male. Half of the puppies were brown, and half were yellow. Explain how the same female, when mated with a different brown male, could produce only brown offspring.

the first male was bbEe and the second male was bbEE

A black female cat is mated with an orange male cat. They produce two tortoiseshell females, two black males, one orange female, and one tortoiseshell male, for a total of six kittens. Orange (Xo)and black (X+) fur color are encoded by different alleles of the same X-linked fur color gene. Based on the phenotypes of the parents, what is the most likely explanation for the orange female kitten?

the kitten is X^o O she recieved an X chromosome from her father, but none from her mother

With genetic maternal effect, the phenotype of an individual is determined by which of the following?

the nuclear genotype of the maternal parent

What is penetrance?

the percentage of individuals having a particular genotype that express the expected phenotype

In humans, what normally results in the male sexual phenotype?

the presence of the SRY gene on the Y chromosome

What is wobble?

the same tRNA can match different mRNA codons

What is the role of the eukaryotic promoter in transcription?

the site where transcription factors bind and function

What did Griffith discover with his experiments?

the transforming principle in bacteria

What feature allows cells to recognize, and destroy, viral mRNAs?

they are double stranded

Which of the following is not a physical mapping technique?

three-point testcross

what is true of a negative inducible system

transcription increases when the inducer binds to the repressor

What would be the result of deleting the Shine-Dalgarno sequence in a bacterial mRNA?

translation would not occur

A short, wild‑type polypeptide consists of the amino acids met‑trp‑tyr‑arg‑gly‑ser‑pro‑thr. A single point mutation occurs, resulting in the polypeptide met‑trp. Which of the following best describes the type of mutation and the phenotypic effect?

transversion, nonsense

In Avery, MacLeod, and McCarty's experiments, homogenates from heat-killed bacteria were treated with different enzymes, and then the ability of those homogenates to transform bacteria was assayed. Under which condition would transformation not occur?

treatment with DNase

Dizygotic twins, on average, have 50% of their genes in common, whereas monozygotic twins have 100% of their genes in common.

true

Cell division by mitosis is a mechanism of asexual cell replication. Some single-cell organisms reproduce by cell division, and cell division enable multicellular organisms to grow and to repair damaged cells. Which are of the following are products of cell division by mitosis?

two cells genetically identical to the original cell

A homozygous variety of opium poppy (Papaver somniferum Laciniatum) with lacerate leaves was crossed with another homozygous variety with normal leaves. All the F1 had lacerate leaves (jagged-edged leaves). Two F1 plants were crossed to produce the F2. Of the F2, 249 had lacerate leaves and 16 had normal leaves. How are lacerate leaves determined in the opium poppy?

two genes with a dominant allele at either or both loci

Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed that the plants have white, green, or patchy white and green (variegated) leaves. Melissa would like to have only four o'clock plants with variegated leaves, so she crosses a few of her plants to see which crosses produce offspring with varigated leaves. She knows that leaf color is determined by the color of the chloroplasts. For each cross, determine the offspring phenotypes that could be observed. Each cross may produce plants with one or more different phenotypes. What phenotypes of the offspring would result from the following cross (select all that apply): white female x white male

white

Suppose there is a vial containing a single generation of flies from a cross. There is an interesting phenotype where many individuals have abnormally long hairlike bristles, sensory organs extending from the dorsal thorax, as opposed to the short wirelike wild-type bristles among the other siblings. References state that this mutant has a dominant mutation called Suave (Su) and that the phenotype of flies that are heterozygous or homozygous for Su appear phenotypically identical. Which fly should be crossed to a Suave male from this vial in order to generate progeny that help determine the male's genotype?

wildtype female sibling

You are screening the results of a transformation experiment using the plasmid below. A bacterium that had been transformed with a non‑recombinant version (does not contain the transgene insert) of this plasmid was put onto a plate with medium containing both ampicillin and X‑gal.The colony that formed (if any):

would appear blue

Color blindness is a sex-linked recessive trait. Is it possible for a male to have different color-blindness phenotypes in each eye?

yes, in an XXY male where each eye has alternate X inactivation

When a population is in Hardy-Weinberg equilibrium, this means:

the population is large and randomly mating

Plate A contains ampicillin (antibiotic)- Plate B is ampicillin-freeYou expose some bacteria to a plasmid with an ampicillin-resistance gene, resulting in a mixture of transformed and non-transformed bacteria. What bacteria will grow on Plate A?

the transformed

Hemoglobin is a complex protein that contains four polypeptide chains. The normal hemoglobin found in adults, called adult hemoglobin, consists of two alpha and two beta polypeptide chains, which are encoded by different loci. Sickle‑cell hemoglobin, which causes sickle‑cell anemia, arises from a single mutation in the beta chain of adult hemoglobin. Adult hemoglobin and sickle‑cell hemoglobin differ in a single amino acid. The sixth amino acid from one end in adult hemoglobin is glutamic acid, whereas sickle‑cell hemoglobin has valine at this position. Indicate the mutant codons that could give rise to sickle‑cell anemia. (Select all that apply).

-GUG -GUA

Which of these is a definition or example of a gametic (germ-line) mutation? (Select all that apply).

-The mutation arises in the gametes of the individual and is transmitted to the progeny. -Mutations can be caused by an alteration in the DNA sequence. -A man receives a pelvic X-ray. Nine months later, his child is born with a chromosomal abnormality.

Suppose a point mutation, such as a change from an adenine to a guanine, occurs in the genome of a human sperm cell. The mutation could occur in any region of a gene. The effect of the mutation on the phenotype of the offspring will be determined by where the mutation occurs and its effect on the final gene product. In which scenarios could the mutation alter the phenotype of the offspring? (Select all that apply).

-The mutation occurs in a codon and alters the function of the final protein. -The mutation results in a new, dominant allele. -The mutation occurs in the stop codon, resulting in a codon that specifies an amino acid. -The mutation occurs in a gene that controls development and alters differentiation of a cell type during development.

What strategies do cells use to ensure that newly replicated DNA does not contain errors? (Select all that apply).

-as DNA polymerase synthesizes new DNA, the DNA polymerase finds and corrects misplaced nucleotides. -enzymes remove and resynthesize any misshapen sequences in the DNA prior to replication -enzymes proofread the DNA after the DNA has been replicated and replace any mismatched nucleotides

genotype and allele frequencies

-describes the gene pool of the population -describes the genetic structure of the population

Which of the following is a reason why a human gene might not be expressed properly in E. coli? (Select all that apply).

-different regulatory sequences -different ribosomal binding mechanism -presence of introns -different promoter sequences

Cloning a gene after isolating it requires which actions? (Select all that apply.)

-ligation into a vector -transformation of the recipient with the vector with the gene of interest -identification of the transformants that have the gene of interest

Which of the following statements are true for eukaryotic translation? (Select all that apply).

-mature mRNA has a cap on one end and a poly(A) tain on the other end -ribosomes may be attached to the endoplasmic reticulum or free in the cell cytoplasm -introns are removed from pre-mRNA before ribosomes can use the mRNA

Select the causes for potential errors in DNA replication. (Select all that apply).

-replication slippage due to looping out of bases during replication of repetitive DNA -mismatching due to wobble pairing of bases

Which of the following is true of translation? (Select all that apply).

-requires tRNA -take place in ribosomes -builds a protein

Using the codon table, what conclusions can be drawn about the genetic code? (Select all that apply).

-several amino acids are encoded by multiple codons -three codons do not code for amino acids

In mice, homozygous Kit+ Kit+ animals have solid coloring, whereas animals with one Kitt allele have white-tipped extremities. The Kitt allele is paramutagenic. In a cross between a Kit+ Kit+ mouse and a Kit+ Kitt mouse, determine all possible color phenotypes of the offspring genotypes listed. Kit+ Kit+ 1 solid : 1 white tipped Kit+ Kitt 100% white tipped

1 solid: 1 white tipped 100% white tipped

How does an epigenetic change differ from a mutation?

A mutation alters the nucleotide sequence in DNA. An epigenetic change does not alter the DNA sequence, but can be inherited by daughter cells.

What would the following genotype produce?lacI+ lacOc lacZ- lacY+

Constitutively: nonfunctional B-gal, functional permease

Which description is the best definition of recombinant DNA?

DNA that is composed of a combination of DNA sequences from two or more organisms.

DNA damage can occur as a result of exposure to chemicals or ultraviolet radiation. What happens during nucleotide excision repair of damaged DNA?

Enzymes unwind the DNA, cut out a section on one stand that contains the DNA damage, and resynthesize the section with the correct DNA sequence.

A tRNA that has an anticodon of 3'‑GUA‑5' will bring in what amino acid?

His

A double-stranded DNA molecule: 3' AATACGAGCTTAGTATGGCGCGTATC 5' 5' TTATGCTCGAATCATACCGCGCATAG 3' If the bottom strand is the template, what polypeptide would be made? (leave a space between each amino acid).

Met Arg Gly Met LLe Arg Ala Stop

In the laboratory, how is cDNA generated from a eukaryotic messenger RNA (mRNA)?

Reverse transcriptase generates a single‑stranded cDNA and then DNA polymerase synthesizes the complementary strand.

What causes the phenotypic differences between queen and worker bees?

Royal jelly suppresses a gene that normally methylates DNA, leading to expression of genes that encode characteristics of the queen.

A gene encodes a protein with the following amino acid sequence: Met‑Lys‑Ser‑Pro‑Ala‑Thr‑Pro. A nonsense mutation from a single base pair substitution occurs in this gene, resulting in a protein with the amino acid sequence Met‑Lys. An intergenic suppressor mutation allows the gene to produce the full length protein. The new protein produced is Met‑Lys‑Cys‑Pro‑Ala‑Thr‑Pro. The location for the original mutation is most likely in the ______________ codon.

Ser

There are 64 codons, 20 different amino acids, and approximately 30-50 tRNAs. which statement does not help explain these numbers?

The 3' base of the anticodon on the tRNA can pair weakly with the 5' codon base.

Which event occurs during eukaryotic translation termination?

The ribosome dissociates from the mRNA after the stop codon is recognized by a protein.

Which of theses events occurs during eukaryotic translation initiation?

The small ribosomal subunit binds with a specific tRNA to the mRNA and scans for a start codon.

How could scientists use RNAi for medical therapies?

They insert double‑stranded mRNA complementary to the target mRNA so that it will be recognized by dicer and incorporated into a RISC.

A DNA template contains the sequence 5'-TAT-3' that specifies the codon 5'-AUA-3'. If deamination occurred to this DNA sequence, after several rounds of replication, what amino acid would be brought in instead of isoleucine (Ile)?

Threonine

how does transposition cause mutations

Transposable elements can insert themselves into other genes and disrupt their function.

What generally causes thymine dimers to form in a strand of DNA, and why are thymine dimers a problem?

Ultraviolet light can cause thymine dimers, potentially creating a mutation that could lead to cancer.

How are restriction enzymes used to insert foreign DNA into plasmids?

Use the same restriction enzyme to cut the insert and the vector, then ligate them together with DNA ligase.

What is a conditional mutation?

a mutation that affects the phenotype only under certain conditions

What is a missense mutation?

a mutation that results in a different amino acid in a protein

Which statement does NOT describe a Mendelian population?

a population that cannot evolve

A codon that specifies the amino acid Gly undergoes a single‑base substitution to become a nonsense mutation. This mutation is:

a transversion at the first position

Using the information from the previous question, indicate the type of mutation that gave rise to sickle‑cell anemia.

a transversion that leads to a missense mutation

If a mutation occurred in the trpR gene that made it so that the regulator protein could never bind the operator, when would the trp structural genes would be expressed?

constitutively

Genetic code degeneracy: The same AA is more likely to be brought if...

the last nucleotide is the same type of base

In regulation of the lac operon, gene I codes for the regulator protein, O indicates the operator sequence, and genes Z and Y code for B-gal and permease, respectively. Predict the expression of the haploid genotype lacI- lacO+ lacZ+ lacY- in the presence of lactose?

functional B-gal and nonfunctional permease will constitutively expressed

A mutation to an operator would result in which of the following?

gene expression could not be controlled at the transcriptional level

Which is more likely to affect phenotype, a base substitution or an insertion?

insertion

Which is NOT a characteristic of transposable elements?

only found in plants

Transcription is down-regulated when a molecule binds to the regulatory protein, causing it to leave the operator. What type of operon is this?

positive repressible


Set pelajaran terkait

ET 1100 Midterm exam (Ch. 1 - Ch. 7)

View Set

Lesson 15. At least, Instead, It might not be the best but... / -(이)라도

View Set

HS 4300 Exam 2 practice questions

View Set

Pregnancy at Risk NCLEX Questions

View Set

Thermoregulation and Newborn Complications (2.4)

View Set