Genetics Final Exam

Eukaryotic cells can be 2N or 1N, but never 4N

F - They are for all of G2 through Cytokinesis - also talk about polyploidy and e.g. polytene chromosomes

a tRNA anticodon is 5'UAA3'. What Amino Acid does it carry?

(A Leucine - Leucine codon is 5'UUA 3' - complementary to 3'AU5')

Place the following in order: 1.Add restriction endonuclease to genomic DNA 2.Perform ligation 3.Select clones on LB-AMP plates 4.Transform bacteria 5.Gel purify fragment

1 5 2 4 3

In poultry, the genotype-phenotype relationships for comb shape are: A/- B/- = walnut A/- b/b = rose a/a B/- = pea a/a b/b = single For the following crosses involving the comb character in poultry, determine the genotypes of the two parents:

1)A walnut crossed with a single produces offspring that are ¼ walnut, ¼ rose, ¼ pea and ¼ single. 1.Singles are aa bb, Singles are produced, so the walnut parent needs to be heterozygous at A and at B to give aa bb 2) A walnut crossed with a walnut produces one rose, two walnut, and one single offspring 2.Both need to have at least one of each

Match the terms below with the form of DNA that they describe

1. 10 bp per term B DNA 2. 12 bp per term Z DNA 3. Left hand helix Z DNA 4. Hydrogen bonds are relatively perpendicular to the central axis B DNA 5. The predominate form in living cells B DNA 6. Occurs in G/C rich sequences Z DNA

Choose true or false for the following statements.

1. All transcribed RNAs are translated = False 2. All RNAs undergo RNA editing = False 3. A 7-methylguanosine cap is necessary for an mRNA to leave the nucleus = True 4. Polyadenylation primarily occurs in the cytoplasm = False 5. A precursor tRNA molecule is cut with exonucleases and endonucleases to produce a mature tRNA = True 6. The length of the poly A tail affects the stability of the mRNA = True

Elements that are involved in the transcription of genes can be classified as Cis- and trans-acting elements. Look at the terms listed below and determine if they are cis-acting or trans-acting elements. (Worth 1.50 points)

1. Promoter = cis-acting 2. RNA polymerase = trans-acting 3. Transcription factors = trans-acting 4. Enhancer = cis-acting 5. Silencer = cis-acting 6. TFIID = trans-acting

Suppose that we are dealing with four genes, each gene consisting of a dominant allele (capital letter) and a recessive allele (small case letter). If the cross CcMmLlPP X CCmmLlpp is made, what is the probability of obtaining an individual who is CcmmLLPp?

1/16

If that was this case, what is the probability that a child of II-1 and III-4 will be an affected male?

1/4

Cystic fibrosis is an autosomal recessive disorder that affects lung function in humans. If a couple, who are both unaffected, have an affected child, what is the probability their next child will be an affected girl? (Worth 1 point)

1/8

Tail length among mice has a mean of 9.7 cm. The 10 mice with the longest tails (mean tail length of 14.3 cm) are interbred and the mean tail length of their progeny is 13 cm. What is the narrow sense heritability?

13-9.7/14.3-9.7 = 3.3/4.6 = .72 - lots of genetic influence over this trait!

Meselson and Stahl started their experiments by labeling bacterial DNA with _____

15N

If the Diploid (2N) Chromosome number of an organism is 16, then it has a total of ___ chromosomes

16 individual

If C + T/A+G = .5 in one DNA strand of ds DNA, what is the ratio of these bases in the complementary strand?

2 - draw out an example to show pyrimidine/purine is the inverse of purine/pyrimidine or know that it is the inverse

Place the following in order: 1.PolII binds promoter 2.Histone Acetyl transferase is activated 3.TFs bind promoter 4.PolyA polymerase functions 5.Elongation begins

2 3 1 5 4

Put the following in order: 1.DNA polymerase fills the Gap 2.Thymide dimer forms 3.UVR-C cleaves/removes damaged DNA 4.Ligase seals the nick 5.UVRA/UVRB find damaged DNA

2 5 3 1 4

How many different gametes can be produced from a diploid organism with four pairs of chromosomes? (Let's pretend C.elegans has 2N chromosome number of 4 chromosomes (in actuality its 12))

2 to the 4th power=16

In the above pedigree of a recessive autosomal trait, what is the probability that the offspring of II-4 and II-5 will be an affected male? (had image)

2/3 x 2/3 x1/4 x ½ = 4/72

Place the following in order: 1.chiasmata become visible 2.Synapsis occurs 3.Chromosomes condense 4.Homologous recombination occurs 5.Alleles segregate

3 2 4 1 5

How Many Complementation Groups/Genes are there Controlling the trait measured below: += Wild Type - = Affected (had chart)

3 genes/complementation groups

Choose true or false for the following statements

3. Heterochromatin is transcriptionally active False 4. Telomeres and centromeres are examples of constitutive heterochromatin True 5. Histones possess positively charged amino acids True 6. During the M phase, euchromatin of chromatids becomes heterochromatic True

According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain?

30%

What is the number of different genotypes expected from the following cross: AaBbCcDdEe x AaBbCcDdEe

3^5= 243

Two parents are heterozygous for cystic fibrosis (i.e., carriers). What is the chance that they will have 2 affected children in a family of 5 children?

5!/2!x3!x ¼^2 x ¾^3 = 270/1024

Which end of the DNA strand is indicated by the red arrow? (had image)

5'

Which strand is illustrated by the following prokaryotic DNA sequence?

5' CAACGGAGGCGCATTATAGGGAT 3' (Template - Reverse complement of 5' ATCCCTATAATGCGCCTCCGTTG 3' strand listed is the complement of the strand with the TATAAT -10 Pribnow box sequence)

What is the anticodon of the first amino acid of every ORF?

5' CAU 3'

The following DNA codes for a complete ORF. What is the frame of the ORF?

5'GTATGGGTGATGCATGCGAAGCCTGGCTGATCGGACATTC 3' 3'CATACCCACTACGTACGCTTCGGACCGACTAGCCTGTAAG 5' (+1) N- Met-His-Ala-Lys-Pro-Gly-C

What is the probability that an offspring will have an ssRR genotype from a cross of two SsRr individuals?

6.25%

If a Punnett square is used to visualize a three-factor cross (trihybrid cross) how many boxes would be inside of the square?

64

What is the probability that in a family with 7 children, 5 will be genotypically XY and 2 will be genotypically XX?

7!/5!X2! X ½^5 x ½^2 = 21/128

Using Mendel's flower color (purple is dominant, white is recessive), if two heterozygous plants are crossed, what is the probability that the first two offspring will have purple flowers? (Worth 1 point)

9/16

The simplest unit of chromatin (i.e., with respect to packaging) in eukaryotes is

A nucleosome

A catalytic RNA molecule is called _________

A ribozyme - peptidyl transferase, self-splicing introns

The nitrogenous base pictured here is _______ (had image)

Guanine

Which of the following refer to three posttranscriptional modifications often seen in the maturation of mRNA?

A. 5′-capping, 3′-poly(A) tail addition, splicing

Which kind(s) of DNA is(are) likely to be found in cells?

A. A-form DNA B. B-form DNA C. Z-form DNA D. DNA/RNA hybrids E. A and B F. B, C and D (answer is F)

All of the following are examples of Quantitative Traits except:

A. BMI B.Ear length in corn C. Asthma D. Ability of plants to grow towards light E. ABO Blood Types (answer- ABO blood types-monogenic - multiple alleles but one locus

Transcription factors are proteins that ___________. (Worth 1 point)

A. Can increase the rate of transcription B. Can decrease the rate of transcription C. Bind to DNA D. All of these choices are correct E. Can increase the rate of transcription and can bind to DNA. (answer is D)

The process of in situ hybridization is used for which of the following?

A. Cytogenic mapping

What observation(s) listed below are consistent with the conclusion that DNA serves as THE genetic material? There may be more than one answer; list all answers by letter.

A. DNA and RNA are found to be the only macromolecules in eukaryotes that consist of a set of subunits which can combine in unique sequences. B. 35S-labeled T2 bacteriophage infect E. coli and, afterwards, 35S can be detected in bacterial pellets. C. A GFP-containing plasmid, like pGLO, can be transformed into bacteria and make them glow green. D. DNA is shown to be present in mitochondria, chloroplasts and nucleus, where genetic function is performed. E. DNA is found to be the only macromolecule in eukaryotes that can undergo complementary base pairing. Points awarded for explanation of rationale for selecting a conclusion or not. (answer is C and D)

Which of the following were reasons that made scientists believe that protein was likely the heritable material? (Check all that apply)

A. Griffith's nuclein was proteinaceous B. Protein is highly abundant in all living forms C. Proteins are made of 4 subunits linked together as polymers D. Proteins contain high levels of Phosphorus E. Proteins are found in cells, which in turn serve as the building blocks of life F. Proteins have a small number of shapes and sizes that could easily give rise to a code. (answer is B and E)

In the transformation experiment we watched for class, which of the following were bacterial phenotypes associated with inheritance of the pGLO plasmid? (Check all that apply)

A. Growth on nutrient agar (LB) B. Ampicillin susceptibility C. Ampicillin resistance D. Arabinose resistance E. Increased Arabinose metabolism F. Inducible fluorescence, revealed with UV light (answer is C and F)

If you have type AB blood, all of the following are true except

A. H antigen is modified by a glycosyl transferase B. H antigen is modified by N acetyl galactosamine C.Transfusion of blood from an AB type donor will not cause an immune/agglutination response D.Is a Universal recipient E.Is a Universal donor (E. ) is the universal donor because there are no surface antigens to cause an immune/agglutination reaction)

Which of the following statements below about the Avery, McCarty and MacLeod experiments is/are true? (Check all that apply)

A. It benefitted from our understanding of radioactive atoms B. Showed that mice injected with a mixture of live IIIS bacteria and DNA purified from the transforming principle died. C. It included the use of proteases, DNases and RNases D. Included a biochemical approach E. Scored the presence of rough colonies as an indication of transformation F. It involved the use of an antibody step to clear the reaction tubes of untransformed bacteria (answer is C,D, and F)

The wild-type eye color of Drosophila is red. A single-base mutation can occur that produces a white eye color. Which statement is correct regarding this mutation? (Worth 1 point)

A. It is an example of a mutation that likely alters protein function B. Individuals with white eyes have a reversion mutation C. It is an example of a silent mutation D. It is an example of a neutral mutation (A is the answer)

All of the following are true regarding the Hershey and Chase experiment, EXCEPT? Circle all that apply

A. It utilized 32P to label protein and 35S to label DNA B. It depended on a predator/prey relationship between viruses and bacteria C. It showed the radioactively labeled sulfur was associated with bacterial pellets after bacteriophage infection D. It showed that bacteriophages were heavier than bacteria E. It was inspired by published papers describing the structure of DNA F. It showed that bacteriophage DNA was inherited during a single lytic cycle. (answer is A,C,D, and E)

All of the following terms describe the dominant alleles in Mendel's character pairs, except:

A. Monogenic B. Pleiotropic C. Fully Expressive D. Fully Penetrant E. Haplosufficient ( Pleiotropic means one gene controls many traits, not just one.)

Which of the following is not true about eukaryotic transcription:

A. Occurs in the cytoplasm B. Pol II has 12 subunits C. Pol III transcribes tRNA genes D. Its controlled by Cis-acting sequences E. Leads to specialization of cell function (Answer-A)

All of the following terms describe pigment production in snakes except:

A. Polygenic B. Gene Interaction C. Biosynthetic pathway D. Temperature-sensitive E. Gene modifier (D=answer)

The images below depict tumor cell chromosomes visualized using FISH. Panel a shows the chromosomes in the context of an intact nucleus. Panel b shows metaphase chromosomes from the same tumor at higher magnification. The blue signal (from the DNA-specific dye called DAPI) indicates the position of chromosomes in general. The red signal corresponds to the position of alpha tubulin gene on chromosomes and the green signal corresponds to the position of the c-myc gene on chromosomes.

A. State an experimental hypothesis/prediction that would support the data above (using an If...., then..... construction is a good way to start). Lots of possible answers, such as: colocalization of tubulin and myc genes, location of tubulin and myc genes on a chromosome (near telomere or centromere); or copy number in the cell.Choose either panel a or panel b and make a bulleted list of 4 observations you make from looking at the data (i.e., what do you see?). B. Choose either panel a or panel b and make a bulleted list of 4 observations you make from looking at the data (i.e., what do you see?). a 1. Two tubulin signals/copies 2. Three myc signals/copies 3. Upper right = slight colocalization of tubulin and myc genes 4. No overlap in other signals (middle left) 5. Large area stained (not condensed) 6. Etc. b 1. Two signals/copies of each gene 2. Tubulin localized near telomere 3. Myc located more centrally on chromosome 4. Tubulin and myc genes on same chromosome 5. Chromosomes condensed 6. Various sizes of chromosomes 7. Tubulin and myc on same sized chromosome 8. ETC. C. What do these observations tell you about the tubulin and myc genes? a. Tubulin is present in the normal 2N amount, Myc gene has an additional copy (3N)- not clear if tub and myc are on the same chromosome, but they are in same general region of the nucleus b. Localized on the same (small) chromosome 2 copies of each

In doodlewags (hypothetical creatures), the dominant allele S causes solid coat color; the recessive allele s results in white spots on a colored background. The black coat color allele B is dominant to the brown allele b, but these genes are expressed only in the genotype a/a. Individuals that are A/- are yellow regardless of B alleles. 6 pups are produced in a mating between a solid yellow male and a solid brown female. Their phenotypes are 2 solid black, 1 spotted yellow, 1 spotted black and 2 solid brown.

A. What are the genotypes of the male and female parents? A.male: Ss aa Bb female: Ss Aa bb B. What type of inheritance mode is illustrated by this example? A.B. recessive epistasis

eukaryotic chromosomes contain all of the following except

A. arms B. centromeres C. kinetochores D. nucleosomes E. histones (answer is B)

A researcher finds a mutation toward the 3' end of a mammalian gene. The original sequence, AAUAAA, has been changed. What aspect of transcription or mRNA function is most likely to be affected? (worth 1 point)

A. mRNA stability

Which of the following RNA sequences functions as a transcriptional termination sequence? Take your time - draw this out!! Think dsRNA....

A.5' CCCAGCCCGCCUAAUGAGCGGGCUUUUU 3' B.5' CGCGGGAUAUGGGCGUUAAGGACGAAUA 3' C.5' UACGGCUUGCAUAUUCCCGGUAUUUUUU 3' (A - look for runs of Gs and Cs to find hybridizing regions)

telomeres

A.Are replicated by a protein called TERC B.Are replicated in humans from a template that reads 5' CCCTAA 3' C.If not extended, will lead to replication that only happens on the leading/continuous strand D. Are found in single copies at the end of each dsDNA molecule E.Are made of RNA (answer is B)

Blending Inheritance in ornamental flowers can be explained by

A.Codominance B. Incomplete Dominance C. Hemi-sufficiency D. Sex-influence E. Temperature (B - Incomplete dominance where dominant alleles are haploinsufficient)

All of the following are required for chromosomal replication in vivo in Prokaryotes, except:

A.DNA Primers B.dNTPs C.37 ˚ C D.pH 7.3 E.DNA Polymerase I (Answer is A)

All of the following indicated that DNA replicates semi-conservatively, except:

A.DNA is double-stranded B.Base pairing is mediated by non-covalent bonding C.The composition of a second strand can be predicted knowing the first D.The two DNA strands in a molecule of dsDNA are antiparallel E.The bases are present in their keto forms (answer E)

All of the following are true about the Genetic Code Except:

A.Degenerate B.Unambiguous C.Continuous D.Has 64 AA-specifying codons E.Used in most living forms (answer is A)

All of the following occur during Homologous Recombination except:

A.Double strand breaks occur on both recombining chromatids B.Strand invasion by ssDNA element C.Creation of recombinant or non-recombinant chromosomes D.Formation of a Holliday Junction E.Formation of short heteroduplex regions at crossover site (A - Only one of the 2 chromatids undergoes a double strand break.)

All of the following happen in Prophase of mitosis, except

A.Heterochromatin formation B.Nuclear Envelope perforates C.Genetic exchange between sister chromatids D.Genetic exchange between homologous chromatids E.Centrioles duplicate (D - this only happens in meiosis - homologous chromosomes may never find each other - but sister chromatids do. Would crossover between sister chromatids matter? (there could be a good conversation about mutation during replication!)

Many of the components controlling Replication in Prokaryotes were identified using "conditional mutant" screens. All of the following are true about this approach, except:

A.It is useful when you are studying genes that are "essential" for life (e.g.,replication) B.It includes maintaining mutants on a master plate at "permissive" temperature C.It includes assaying mutants at a "non-permissive temperature" D.It is possible due to a mutation that leads to the complete loss of function of a gene and its products E.It involves a step of "replica plating" cells from a "master plate" to two test plates (answer is D)

All of the following apply to Luria and Delbruck's 1943 study of mutation rates in E. Coli and T1 phage except:

A.It served as an example of an inflexibility test B.It involved looking for T1-resistant bacteria as an end measure C.It showed that numbers of mutant organisms observed after T1 phage were added to the culture tended to vary from experiment to experiment D.It rejected the possibility of adaptive mutations E. It supported the concept of spontaneous mutation rates (the answer is A)

All of the following are true regarding the Hershey and Chase Experiment Except:

A.It was recognized by a Nobel Prize B.It involved the use of T2 Bacteriophage to infect S. pneumoniae C.It was published 10 years after the A/M/M expt D.It was a greatly simplified example of inheritance E.It used chemical markers to track the heritable material (answer is B)

All of the following are true about the Chromosomal Theory of Inheritance except:

A.It was self-evident from Mendel's 1865 paper B.Is supported by Germ Plasm Theory C.Helps us understand the concept of linkage D.Benefitted from improved techniques in microscopy E.Helps understand how the Law of Segregation is related to the events of Meiosis I (answer is A)

All of the following terms can be used to describe alkaptonuria, the "inborn error of metabolism" described by Garrod and Bateson in the early 20th C except:

A.Loss of function B.Recessive C.Germline D.Conditional E.Mutant (D is the answer)

During Anaphase, chromatids/chromosomes move towards the pole for all of the following reasons except:

A.Microtubules shrink at the kinteochore B.Chromosomes are moved on Microtubules by motors C.Tension is generated from spindle poles that are anchored to the cell membrane D.Kinetochores attach to centrosomes E.Glue attaching sister chromatids is dissolved (D - language - watch centrosomes vs centromeres)

All of the following aspects of replication are unique to Eukaryotic Replication, except:

A.Multiple ori's B.Shorter Okazaki fragments C.Tendency for chromosomes to shrink D.High quantities of each polymerase E.Positive supercoiling in front of each replication fork (answer is E)

All of the following are true about hemoglobin from individuals with Sickle Cell Anemia (HbSHbS--the poster child for mapping genotype onto phenotype) except:

A.Mutation is at the 6th codon of β globin B.Results from a missense loss-of-function mutation C.Migrates faster than HbAHbA Hemoglobin on agarose gels when blood samples are "run to red" D.Mutation causes β globins to self-associate into long fibers E.Persists in populations due to Heterozygote Advantage (C is the answer)

Sigma Factor ____

A.Provides the protein subunit that serves as the active site of RNA polymerase B.Binds the TSS C.Is a helicase D.Is not required for RNA elongation E.Binds to the +1 nucleotide of the TSS (answer is D)

All of the following are true about prokaryotic replication in vivo, except:

A.Requires that Primase functions before DNA polymerase III B.Requires helicase to function before topoisomerase II C.Requires ligase to function before DNA polymerase I D.Requires SSBP to function before DNA polymerase III E.Requires DNA polymerase III to function before DNA polymerase I (answer is C)

Which of the following elements exhibits quaternary structure?

A.Rho B.DNA pol I C.Enhanceosome D.DnaA E.RNaseP (D. - Multiple DNaA molecules function together in the opening of an ori (Rnase P = ribozyme/RNA nly))

Which of the following 5 terms does not belong grouped with the others?

A.Temperature B.Recombination C.Androgens D.Estrogens E.Pathogens (B - all the others are environmental influencers of phenotype - think epigenetics)

Radioactive Isotopes are useful in Biology because

A.The energy they emit breaks covalent bonds B.The energy they emit breaks ionic bonds C.The energy they emit is detected by UV light D.They allow for fluorescent emissions from the molecules that incorporate them E.Cells can't tell the difference between them and stable counterparts. (answer is E)

All of the following are true of replication in bacterial chromosomes, except:

A.The lagging strand is synthesized discontinuously B.DNA polymerase I catalyzes the majority of DNA synthesis C.One template strand is synthesized both continuously and discontinuously D.Terminates due to formation of a Ter/Tus complex E.Requires hydrolysis of ATP (answer is B)

Why did it take so long to understand DNA as THE Heritable material?

A.The novelty of the fields of biochemistry and genetics B.Technology that allowed for measurements (main answer)

All of the following are true about bacteriophages except:

A.They are E. coli predators B.Parental phages make their offspring in a host cell C.When lysed from host cells they are surrounded by plasma membranes D.They can be shaken off the surface of E. coli with a simple mechanical agitation (e.g. a blender pulse) E.They transduce DNA across membranes (answer is C)

All of the following are true about promoters in Prokaryotes, except:

A.They contain a 5' TATAAT 3' consensus B.They contain a 5' TTAGGG 3' consensus C.They contain a 5' TTGACA 3' consensus D.They function to orient the RNA polymerase active site at the +1 nucleotide of the TSS E.They exist upstream of the TSS (answer is B)

In the Kornbergs' biochemical assays used to purify prokaryotic polymerases,

A.They used materials in the supernatants of centrifuged lysates B.They added in 35S-dNTPs C.A positive replication reaction was scored by a reduction in levels of radioactive dsDNA products D.Replication enzymes were studied in vivo E.They knew that replication was catalyzed by a single enzyme (answer is A)

The Kornbergs fractionated E. coli lysates

A.To purify the protein(s) that synthesize(s) "daughter" DNA strands

Cellular RNA molecules are often referred to as ____

A.Transcripts B. Gene Products C. Amplicons D. Both A and B E. Both A and C (answers is D)

All of the following are examples of transcripts except:

A.miRNA B. siRNA C. rRNA D. snRNA E. epiRNA (E the point here being that there are lots of non-coding RNAs that we are becoming aware of that are functionally important >>> less than 2% of human genome is coding.)

In a polynucleotide, the individual nucleotides are linked by bonds between _____.

A.nitrogenous bases B.sugar and phosphate C.sugars D.phosphates E.nitrogenous base and sugar (answer is B)

All of the following proteins are associated with actively transcribed regions of a genome except:

Acetylated histone 3 TFIID Sigma factor DnaA Pol II (answer-DnaA)

During a PCR reaction, all of the following events occur except:

Addition of nucleotide monomers on the 3' end of the template DNA

In Semi conservative replication

After two rounds of replication of a single molecule of DNA, two resulting DNA molecules will contain both a parental strand and a new strand of DNA and the other two resulting DNA molecules will contain all new (or de novo) DNA

When TH Morgan crossed a white-eyed female with a red-eyed male:

All males were white-eyed

Name two bacterial phenotypes associated with inheritance of pGLO DNA.

Amp resistance Inducible expression of GFP >>>> green fluorescence by UV only with arabinose C

Individuals in a species have a diploid chromosomal number of 24 The term applied to an individual within a population of this species that has 25 chromosomes would be ______.

Aneuploid

The fact that the helixes of the DNA strand are arranged in opposite directions gives DNA its ________________ characteristics.

Antiparallel

Organisms that can grow on complete media but cannot grow on minimal media are called _________.

Auxotrophs - think neurospora crassa and Beadle and Tatum

What is the full name of the computer program used to perform pair-wise comparisons of DNA or protein sequences.

Basic Local Alignment Search Tool. BLAST

True or False Structural rearrangements in individual chromosomes are always bad.

B - it depends on what is deleted/duplicated. With translocations if the break point doesn't happen in a gene, you are probably OK

With respect to possible biological outcomes, Duplications are generally worse than Inversions:

B False - duplications can be bad but we often see the expansion of gene families or paralogs within an organism!, Duplications are not as bad as inversions - inversions lead to trouble during Meiosis I when crossing over happens between a normal chromosome and an inverted one! Half of the gametes will be inviable (infertility?)

If one DNA strand is 5' GATCATTCGTAAGG 3', what is the sequence of the complementary strand?

B. 5' CCTTACGAATGATC 3'

In nature, C. elegans males are ______ at Chromosome VI:

B. Aneuploid - can be more than diploid or less than diploid. Usually these things are not tolerated and lead to no development/ but in nature in nematodes the XO system at the sex chromosome works!

The first round of replication in the Meselson and Stahl experiment disproved which theory of replication?

B. Conservative

The cells used in the FISH technique are first arrested during _________________.

B. metaphase

What are 3 terms that describe the following mutation: WT: N-Met-Trp-Tyr-Arg-Gly-Ser-Pro-C WT: N-Met-Trp-His-Arg-Gly-Ser-Pro-C

Base pair substitution Point mutation Missense Transition UAU/c goes to CAU/c

What is the function of DnaA?

Binds DnaA boxes at oris in prokaryotes Causes buckling of DNA at A-T rich ori and separation of strands

A nucleosome is a combination of _____________ and _______________

C. DNA; histone proteins

What aspect of the sugar is unique to RNA?

C. It contains an OH group on the number 2' carbon of the pentose sugar

Which is a correct statement about Rho independent termination?

C. It requires a stem loop to form in the RNA.

What types of amino acids are most responsible for the binding of histones to DNA?

C. Positively charged amino acids

Prototrophs

Can grow on complete media and minimal media

What is the molecular nature of the mutation that causes sickle cell anemia (Be as specific as possible!)

Codon #6 in the beta globin gene is altered by a base pair substitution converting a GAG codon to a GUG codon. This results in a missense mutation where a glutamate is changed to a valine (negatively charged AA to hydrophobic AA leads to significant structural changes and formation of fibers by aberrant proteins that cause the RBCs to be sickle shaped at low oxygen levels - like when they are in veins)

Mutations that change the configuration of a protein at a specific temperature are called _____________ mutations. (Worth 1 point)

Conditional

When a mutant phenotype is observed at 42 degrees C but not at 30 degrees C, it is likely caused by a ______ mutation arising from a ______ missense point mutation

Conditional, neutral

Acetylation of histones causes _______

Conversion of heterochromatin to euchromatin Transcriptional activation Unwinding of DNA from histone cores

Which of the following is not consistent with Erwin Chargaff's findings? (hint: think mol %)

D. (C + G) = (A + T)

When DNA is turned in the right-handed direction

D. Positive supercoils are added

Which of the following molecules seals the "nicks" between Okazaki fragments?

DNA ligase

Avery, McCarty and McLeod showed that treatment of transforming principle with ______ resulted in no growth of colonies on nutrient agar plates

DNase

The conversion of cytosine to uracil in DNA is an example of ___________________. (Worth 1 Point)

Deamination

What type of mutational event is illustrated below? (be as specific as possible) (had Image)

Deamination - leading to basepair substitution - transition C > T

Spontaneous mutations include ____________________. (Worth 1 point)

Depurination, deamination, and errors in DNA replication

Which of the following causes dsDNA to "melt" in vivo?

DnaA

Which of the following molecules "unwinds" parental strands at the replication fork?

DnaB

Name a specific molecule that would contain the following structure: (had image)

Ex: Rho terminator, rho independent terminator, ribosomes/rRNA, tRNAs, etc.

The study of in vitro translation of mRNA homopolymers and co-polymers led to _____

Elucidation of the Genetic Code

All of the following names or terms are cited in Watson and Crick's 1953 Nature publications except

Erwin Chargaff Linus Pauling Crystallography Keto/enol base conversions Alfred Hershey (answer Alfred Hershey)

Kornberg's Biochemical approach, given enough time and repetitions, would have revealed all the components of the replication machinery.

False

X and Y chromosomes in humans are not homologous

False (have enough similarity to zip up in Meiosis prophase 1)

Punnett Squares are useful for analyzing quantitative traits.

False - no discrete phenotypic classes - phenotypes are on a spectrum and hard to classify. No hard edges between phenotypic class.

RNA polymerase requires a free 3' OH to do the work of RNA synthesis

False - no primase --- more insight into the validity of the RNA world theory

For quantitative traits, all genotypes have distinct non-overlapping phenotypes.

False - this statement would be true for Mendelian phenotypes and diseases like SCA, Cystic Fibrosis etc. - single genes

In cells in G1, chromosomes are X-shaped

False - too bad popular media finds them so attractive - a chromosome usual functions as a single dsDNA molecule

If the couple has fraternal twins, what is the probability that both children will be unaffected by both conditions?

Fraternal twins are each separate fertilization events:P = P( child 1 no SCA) X P(child 1 no albinism) X P Child 2 no SCA) x Pchild 2 no albinisim ¾ X 3/4 X ¾ X 3/4 = 81/256

Use 4 genetic terms to describe the "dominant" factors studied by Mendel

Haplosufficient 100% penetrant 100% expressive Autosomal "wild type" ok

Which of the following is not true with respect to the cell cycle

Histones are stockpiled in G2. All cells are actively engaged in the cell cycle. M stands for mitosis or meiosis. Replication machinery is produced in G1. Sister chromatids emerge from S (answer-All cells are actively engaged in the cell cycle.)

If this is an autosomal recessive disorder, what is the probability that child of II-3 and II-5 will be an affected female?

II-3 = A- with a 2/3 chance that he is Aa II-5 has to be Aa P=P (II-3 is Aa) x P(II-5) is Aa x P(aa offspring btw II-3 and II-5 is affected) x P(female) P = 2/3 x 1 x ¼ x ½ = 2/24 = 1/12

Spontaneous mutations

Include deamination of particular bases.

When two genes are unlinked, they are said to undergo_____ during Meiosis

Independent Assortment

List 3 steps that occur during mRNA processing in eukaryotes

Intron splicing 5' methyl cap 3'polyA adenylation

The Cell Cycle _____

Is a high stakes, resource expensive activity for cells

Independent Assortment

Is set up during meiosis I

Draw out a 3 generation pedigree illustrating Y-linked inheritance. Pedigree must have at least 2 matings per generation and at least two offspring per mating

Many answers possible - all males from affected males are affected - no affected females ever.

You are given a sample of chromosomal DNA. What experiment could you perform (based on specific properties that we have covered in class) to determine whether the DNA was of prokaryotic or eukaryotic origin? Why - give your rationale? (4-5 sentences) Be sure to include an experimental hypothesis (if...., then.... format will do!) and to describe what your expected results would be either in support or not in support of your hypothesis (4-5 sentences).

Many answers possible! A short description of differences between prokaryotic and eukaryotic DNA would have been a nice way to start. Should focus specifically on DNA (you are not given whole cells or any other macromolecules). Then think experiment: electron micrograph? Sequencing of consensus regions? Affinity for certain proteins? Etc. Looking for clearly stated experimental logic. (folks generally got more than half of the points).

At what stage in Meiosis are human oocytes arrested upon ovulation? (be as specific as possible)

Meiosis II Metaphase

Who coined the terms "dominant" And "recessive"?

Mendel

Strand discrimination(i.e., old vs new strand) during mismatch repair is based on _____

Methylation status (at GATC)

What are the 5 assumptions made with respect to the hardy-Weinberg equilibrium?

No mutation No migration No natural selection Random mating No genetic drift

Peptidyl Transferase transfers a growing AA chain from tRNA in the ___ site to a tRNA in the ___ site

P to A, Abecomes the P after ribosome ratches over by one codon

In so far as C. elegans functions as a genetic model organism, state 2 pros and 1 con (in a minimum of 10 words per statement) of using this model for the study of genetic mechanisms of biological function (2 pts total)

PROs 1. High number of offspring 2. C. elegans are cheap to purchase 3. C. elegans are easy to cross 4. C. elegans have a short reproductive cycle 5. C. elegans can be mutagenized 6. C. elegans have scorable phenotypes 7. C. elegans do not take up a lot of space in lab 8. It is easy to limit c. elegan population variability with inbred lines, etc. CON 1. C. elegans are simple organisms (distantly related to more complex forms like ourselves) 2. Doesn't address more complex issues of inheritance as seen in vertebrates

If the progeny of a mating of pea plants have the following ratios 1342 smooth seed/green pod, 447 wrinkled seed/yellow pod, 429 smooth seed/ yellow pod, 1361 wrinkled seed/green pod what are the genotypes of the parents?

Parent 1: Heterozygous for seed shape and pod color Parent 2: Homozygous seed shape and heterozygous for pod color

How would you describe the chromosomal rearrangement depicted above? (be as specific as possible) (had image)

Pericentric Inversion

The table below shows the genotypic frequencies in 3 different populations.Which population is/are in HWE? (had table)

Pop 1 only - only one where p+q=1 and p2 +2PA + 1q2 = 1 too!

During Replication, Topoisomerase II

Prevents DNA strand breakage

mRNA maturation includes all of the following except

Primase activity Endonuclease 5' 7'methylguanosine Polyadenylation snRNP function (answer-primase activity)

The mutation that causes sickle cell anemia

Provides support to the One-gene-one-polypeptide hypothesis.

The photo above illustrates a polytene chromosome squash. What structure is indicated by the red arrow?

Puff - euchromatin - high levels of transcription

UV light induces mutations by causing the production of ____________ in DNA strands

Pyrimidine dimers/Thymine Dimers - on a single strand. Causes a bulge that DNA polymerase is "confused" by - mismatch or polymerase totally falls off!

Cystic fibrosis occurs in ½,500 individuals Calculate the Frequency of CF carriers?

Q^2 = 1/2500 Q=.02 P= .98 2pq = .0392

Select the correct statement regarding rate of mutation. (Worth 1 point)

Rates of spontaneous mutation per cell generation typically range from 10-5 to 10-9

Chromosomes from a normal cell are on the left; chromosomes from a tumor cell are on the right. What genetic event is being illustrated here? (had image)

Reciprocal Translocation

In X-ray Crystallography

Requires that the matter being studied be comprised of regularly repeating "unit cells"

All of the following regarding ribosomes are true except

Ribosomes are comprised of protein and RNA. Ribosomes coordinate with elongation factors to regulate translation. Ribosomes bind transcripts in their promoters. Prokaryotic ribosomes are comprised of a large and a small subunit. Ribosomes in organisms like C. elegans can only bind to complete transcripts. (answer-Ribosomes bind transcripts in their promoters.)

A-DNA is a ____ handed helix B-DNA is a ____ handed helix Z-DNA is a ____ handed helix

Right, right, left

In the Avery, McCarty and McCleod experiment, DNA was identified as the heritable material because,

S bacteria were not precipitated out of the test tube by an anti-R bacteria antibody when S bacterial extracts were incubated with DNase

Use the Data above to put the intermediates (by letter) and genes (by number) in order (had data table)

S>2>A>3>T>1>B>4>R

What protein is indicated by the red arrow?

SSBP - single stranded binding protein

Agarose gel electrophoresis separates DNA molecules on the basis of _______

Size; # of bp with smallest fragments moving faster than larger fragments

"cock feathering" seen in chickens and other birds is an example of ________ inheritance.

Sex Limited

All of the following bind in the major groove of DNA except

Sigma factor H1 TERT SSBs U1 snRNP (answer-U1 snRNP)

The ratio of (A+T) to (G+C) in a particular DNA is 1.0. Is this sufficient data to determine whether the DNA is double- or single-stranded. Why or why not? Explain (4 sentences minimum). Chargaff's experiments showed that in double-stranded DNA, A+T are molar equivalents and C+G are molar equivalents. This is due to the obligate pairing of A with T and C with G in a double-stranded molecule of DNA. The relationship between A/T and C/G pairs in a double stranded DNA molecule is not fixed and can vary from genome to genome. In fact some species, C/G content is strikingly high, far surpassing the molar quantities of A+T.

Ss DNA: 5' ACTGACTGAC 3' = 5/5 = 1.0 ratio Ss DNA: 5' AACGTAACGTA 3' = 7/4 = 1.75 ratio Ds DNA: 5' ACGTACGTACGT 3' 3' TGCATGCATGCA 5' = 12/12 = 1.0 ratio Ds DNA: 5' AACGTAACGTA 3' 3' TTGCATTGCAT 5' = 14/8 = 1.75 ratio

B. Define structure and function in a genetic context. What is the significance of their relationship?

Structure and function are essentially linked. Structure is defined as a cell or organism's physical arrangement. Function is defined by a cell or organism's role within a reaction or within its environment. The structure of a cell can influence how effective or ineffective its functionality can be. For example, when comparing the cellular levels of biological organization, predetermined genetic instructions assign cells to grow a certain way and once formed, multiple cells have the capacity to function synchronously to eventually form tissues, as tissues function synchronously to develop organs, and so forth. The structure-function relationship serves as one of the pillars of genetics and showcase every living organism is a result of their overall structure and various functions taking place within the structure to keep the organism alive.

T/F: Non-disjunction can happen during Meiosis I or Meiosis II

T

What sequence in TERC is used as a template for making telomere repeats in humans (be as specific as possible)?

Telomeres 5'TTGGGG3' TERC '5CCCCAA3"

What genetic test is used to determine whether an individual is Homozygous dominant or heterozygous for a particular phenotype

Test cross - cross the query individual with an individual that is homozygous recessive

A. Explain the best analogy for DNA strands as they pertain to replication. Define the term you like the best and explain why this is an apt analogy for the relationship between the two strands and the way the structure indicates how DNA is replicated.

The best analogy for DNA strands as they pertain to replication are template(s). The DNA template strand pairing with a complementary strand is an important step in replication of the a genetic code. When the strand undergoes denaturation, each strand serves as a template for replication. A great analogy is when you want to prepare a recipe you've never created before, you can find a recipe book at a grocery store, take out a sheet of paper and copy the instructions on the paper, and once you return home and follow the instructions written on the sheet of paper, you can potentially create a nice snack or meal. However, if the instructions are not followed correctly, your recipe may not come out as you may have intended it to be. DNA like the recipe book comes with a set of instructions to make protein and the protein is the product that the DNA instructions code for. The meal or snack formed from the recipe instructions is comparable to protein.

The degeneracy of the Genetic code is due to

The fact that more that one codon specifying an amino acid

Okazaki fragments are used to elongate

The lagging strand away from the replication fork

When Griffith injected mice with a mixture of live R pneumococcus derived from a IIS strain and heat-killed IIIS bacteria,

The mice died, but he recovered live type IIIS cells

Geneticist credited with the first experiments that Mendel's factors are transmitted on Chromosomes.

Thomas Hunt Morgan - red/white gene are sex linked in D. melanogaster.

What protein is indicated by the red arrow? (had image)

Topoisomerase II

What is the function of the prokaryotic protein, Rho? (Be as specific as possible)

Transcriptional termination RNA helicase - unwinds RNA hairpin loops!

Cellular RNA molecules are often referred to as a. Transcripts

Transcripts and gene products

Cells are 4N during Anaphase in Mitosis

True

Quantitative Traits are Polygenic

True - Yup but not all polygenic traits are quantitative - some polygenic traits can be analyzed via classic Mendelian analysis or some polygenic traits involve gene interactions.

The amount of phenotypic variation due to genetic variation is referred to as heritability

True - here's some of the "quantitative" part of quantitative genetics

Translocations can happen without any phenotypic effect.

True - only a problem when break point happens in a gene.

Mapping of QTLs relies on the correlation of the inheritance of a specific phenotype with a unique piece of DNA.

True - trying to come up with the "recipe" for a trait - how many parts of Gene 1 plus how many parts of Gene 2 - want to know the # of genes involved and the extent of their involvement.

Sexual Dimorphism is often due to Sex Limited inheritance

True = Sex Limited is stuff like fancy male plumage and lactation in female mammals - everyone has the same genotype (usually aa) but only act on it in the right hormonal millieu

Quantitative traits are controlled by both the genes and the environment

True YUP - here's the complexity - nature/nurture - here's the science to mathematically dissect these contributions apart. Think back to temperature affected phenotypes of rabbit/cat fur etc.

True or False: Salivary gland cells of D. melanogaster larvae are Polyploid

True- thousands of chromosomes fused together - no M phase or Cytokinesis - to make lots and lots of digestive enzymes - pretty smart evolutionary strategy! (cells will never need to divide)

Q8: E. coli are grown in liquid medium containing radioactive labeled P32. A single bacterial cell is then moved to liquid medium without the radioactive P32 and allowed to divide, producing 64 bacterial cells. How many of the 64 bacterial cells will contain radioactive P32? Explain why this number of cells will contain P32.

Two of the 64 cells will contain radioactive P32. P32 is incorporated into the phosphate backbone of DNA, so the initial bacterial cell will have one strand of P32 labeled DNA. DNA replication is semi-conservative, so the original parental strand of DNA will remain intact, and one strand will be passed on to a daughter. This will happen in duplicateSince there is no more P32 in the liquid medium, all new strands of DNA will not be labeled. Thus, only 2 of the 64 will have a P32 DNA strand.

We find "Velcro" to be a handy fastener in our daily lives. Each Velcro patch, regardless of its size, is made of two opposing surfaces - one that is a comprised of repeating rows of hooks and the other surface is comprised of an array of looping nylon fibers. When pressed together, the hooks on one side grab onto the loops on the other to facilitate a stable association. Even though Velcro mediates a stable closure, it is easily opened with a quick tug. Why is Velcro a reasonable analogy for the forces that allow a DNA molecule to be double stranded and to function as an information storage molecule? Explain by citing 2 specific and distinct structural/functional features of DNA that parallel the Velcro analogy. (3 sentences minimum, 3 pts).

Velcro is a reasonable analogy for illustrating DNA structure, because of its two opposing surfaces, one strip having repeated rows of hooks, and the other strip with looping nylon fibers, which mirror the helical structure present in DNA. The repeated hooks and nylon loop model displayed by the Velcro is synonymous with parent and daughter strands held together by nitrogenous base pairs (Adenine and Thymine, Guanine and Cytosine) also bound to one another by non-covalent hydrogen bonds. It is important to note one hydrogen bond present on a surface is insufficient to exhibit a stable DNA double strand, which means several non-covalent interactions must be present on the surface to maintain the stability of the DNA structure. It is important to note DNA must be accessible and ready to split, similar to Velcro, when the hook strip is paired with the looping nylon fiber loop strip, the Velcro can be held together and can be easily pulled apart with a slight tug when separated.

DNA structure found in C-G rich promoter sequences in Eukaryotes

Z-DNA

The following table shows Quantitative data from Arthur Kornberg's Nobel Prize-winning work on replication:

Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? Chose one and explain the rationale behind your answer in a minimum of 4 sentences. A. Products of replication are DNA polymers B. DNA Pol I-mediated replication is a high fidelity process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G Kornberg was taking from Chargaff who had perfected the assay to determine molar percentages of constituent nucleotides of a purified molecule of DNA. He knew from Chargaff's work that every DNA molecule has a signature profile of A, C, G, T concentrations [ie %GC can vary with %AT]. Therefore he reasoned that if he performed a quantitative analysis on the DNA products made from known templates in his in vitro replication reactions, then he should be able to show that mole % ACTG are the same in both the template and the products. This type of finding would show that not only was he getting a replicated copy but that the copy was identical (HIGH FIDELITY) to the template. This is particularly evident in looking at the similarities of ACGT in calf thymus. DNA replications [A] 28.9 = 28.7; [T] 26.7 = 27.7.

The genes for zeste eyes and forked bristles are located on the X chromosome in Drosophila melanogaster. Both genes are recessive. A parental cross is made between a zeste-eyed female and a forked-bristled male.. What phenotypes will be expected in the F2 offspring ? Assume no crossing over in either generational cross:

Wt females, zeste-eyed females, zeste-eyed males and forked bristle males

What other mode of inheritance could be at play here?

X-linked recessive: II-1 is X+X- = 1 III-4 X+ Y P= (P of offspring male) x P(male getting the affected allele from egg) P= ½ x ½ = ¼ Or make a Punnett square and see that of the four possible outcomes only one is affected male

The sigma factor

a. Is not required for RNA elongation b. Functions to orient the RNA polymerase active site at the +1 nucleotide of the TSS (both are correct)

A woman with type AB blood gave birth to a baby with type B blood. Two different men claim to be the father. One has type A blood, the other type B blood. Which man is most likely to be the dad?

a.The man with A blood if his father was type O b.The man with A blood if his parents were both homozygous for A c.The man with B blood if his father was type O d.The man with B blood if his parents were both homozygous B e.A or B are equally likely f.C or D are equally likely (C and D are equally likely)

Which analogy, coined by Watson and Crick works best to explain the mechanisms of Semi-Conservative Replication?

a template

Which of the following conformations of DNA is most stable in vitro under "low humidity" conditions:

a. A-DNA and Z-DNA

Telomerase:

a. Contains its own RNA template b. Is a reverse transcriptase c. Extends one strand of the telomere d. Is responsible for helping maintain chromosome size e. All of the above

If seen on a karyotype, the chromosome below would be described as ___________ (with respect placement of the centromere) (had image)

acrocentric

Which structure is being indicated by the block arrow below:

all A.Centromere B.Constitutive heterochromatin C.kinetochore

heterochromatin is present

around genes that are "not read"

nucleosomes associate with DNA

because of basic amino acids in their histone core

The name of a molecule produced when Mature mRNAs are incubated with reverse transcriptase (in happy buffer plus extra nucleotide building blocks)

cDNA or copy DNA

The name of the structure on chromosomes where you find constitutive heterochromatin

centromere

Bacterial chromosomes:

coalesce in a cell in a structure called a nucleoid body

Which model of DNA replication was eliminated in the Meselson/Stahl experiment by analyzing DNA after exactly one round of replication after switching from 15N to 14N medium?

conservative

_____ are enzymes that cleave in the middle of nucleic acid polymers

endonuclease

The complete loss of either a guanine or adenine from DNA is an example of ____________. (Worth 1 point)

depurination

A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring have green pods. From this information, it can be stated that the green color is _____ to the yellow color. (Worth 1 point)

dominant

Coat color in Labrador Retreivers is a classic example of ______ inheritance.

epistasis

Genomes are made of 50 % C+G

false

all mutations are induced

false

FISH stands for ___________.

fluorescent in situ hybridization

What genotype(s) can donor(s) be to match an O blood recipient?

ii (o)

Heterochromatin

is protein rich

A cross between two heterzygote parents yields a 2:1 ratio of dominant:recessive phenotypes. This is most likely due to:

lethality

The Law of Independent Assortment does not always apply to genes that are __________.

linked

The basic functional unit of chromatin is called ____________

nucleosome

In which cellular compartment(s) does(do) the maturation of mRNA in eukaryotes occur?

nucleus

The term peptidyl transferase relates to ________

peptide bond formation during protein synthesis

What level of protein folding is illustrated by a molecule of Hemoglobin?

quaternary

A translocation that moves a gene from an area of euchromatin to heterochromatin would typically cause a/an _________________ in the expression of the gene. (Worth 1 point)

reduction

When an organism is described as 2N, this means:

sperm and egg have fused (When an organism is described as 2N, this means:)

In general the more genes that are involved in the development of a trait the greater the number of phenotypic classes that can occur.

true

RNA can be double stranded

true

The existence of alleles is due to mutation

true

the existence of alleles is due to mutation

true

X-ray diffraction

yields black spots on a detector when similarly diffracted x-rays converge at a common site

What is the probability of getting AaBBCc zygotes from a cross of parents that are both AaBbCc?

½ x ¼ x ½ = 1/16