Genetics Final MCQs

Which region of DNA contains the coding information for a protein in a eukaryote? Exons Introns Enhancers Promoters

Exons

Which of the following is an example of epigenetic inheritance? Expression of the Igf-2 gene based on methylation of the ICR and DMR regions Inheritance of flower color as studied by Mendel Leaf coloration based on mitochondrial inheritance Snail shell twist patterns

Expression of the Igf-2 gene based on methylation of the ICR and DMR regions

The term endopolyploidy refers to the phenomenon of having Too many chromosomes Extra chromosomes inside the cell nucleus Extra sets of chromosomes in certain cells of the body Extra sets of chromosomes in gametes

Extra sets of chromosomes in certain cells of the body

True/False A population in genetics always includes all members of a particular species

False

True/False Chromosomes that are heterozygous for an allele are not homologous

False

True/False DNA replication occurs in mitosis

False

True/False DNA that contains instructions for two or more structural genes produces monocistronic mRNA.

False

True/False Dominant alleles are always the result of gain of function mutations

False

True/False Genetic drift affects small and large populations equally

False

True/False Genetic drift increases the allele variation in a population

False

True/False Haploid organisms can have homologous chromosomes

False

True/False If two genes assort independently from each other, that is sufficient to conclude that they must be members of different linkage groups.

False

True/False In the Hershey-Chase experiments, the protein coat of the bacteriophage was labeled with the 32P radioisotope.

False

True/False In the lac operon, the operator is an example of a trans-effect genetic regulation.

False

True/False In the lac operon, the operator site is recognized by an activator protein.

False

True/False Once a population is established, its genetic composition does not change over time

False

True/False Operons that code for catabolic enzyme systems are typically regulated by repressors.

False

True/False Recessive alleles usually cause an increase in functional protein expression

False

True/False The CAP protein is an activator that binds to the operator

False

True/False The physical location of a gene on the chromosome is called its allele

False

True/False The structural proteins encoded by the lac operon are involved in lactose synthesis

False

A cross is made between a white-eyed female fruit fly and a red-eyed male. What would be the reciprocal cross? Female is X(W)X(W) and male is X(W)Y Female is X(W+)X(W+) and male is X(W+)Y Female is X(W+)X(W+) and male is X(W)Y Female is X(W)X(W) and male is X(W+)Y

Female is X(W+)X(W+) and male is X(W)Y

Migration of a random few individuals from one population to a new area to establish a new population is an example of ________ Bottleneck effect Mutation Founder effect Selection

Founder effect

The researcher(s) who initially used X-ray diffraction to gather information on the DNA molecule was __________. Franklin Watson and Crick Hershey and Chase Pauling Chargaff

Franklin

Which of the following is the correct order of phases of the eukaryotic cell cycle? G1, G2, S, M G1, S, G2, M G1, G2, M, S G1, S, M, G2

G1, S, G2, M

The marking process for genomic imprinting initially occurs during Gametogenesis Fertilization Embryonic development Adulthood

Gametogenesis

The diploid garden pea plant has 14 chromosomes. The haploid fungus Neurospora crassa has 7 chromosomes. Neither organism has separate male and female individuals. Which of the following correctly identifies the number of linkage groups in each organism? Garden pea has 14 linkage groups, and Neurospora has 7. Garden pea has 7 linkage groups, and Neurospora has 7. Garden pea has 8 linkage groups, and Neurospora has 8. Gardent pea has 15 linkage groups, and Neurospora has 8.

Garden pea has 7 linkage groups, and Neurospora has 7.

Mendel's Law of Independent Assortment states that two different ____________ will be randomly assorted into the gametes

Genes

In a person with trisomy 21 (Down syndrome), a genetic imbalance occurs because Genes on chromosome 21 are overexpressed Genes on chromosome 21 are underexpressed Genes on the other chromosomes are overexpressed Genes on on the other chromosomes are underexpressed

Genes on chromosome 21 are overexpressed

Genetic linkage occurs because Genes that are on the same chromosome may affect the same character Genes that are close together on the same chromosome tend to be transmitted together to offspring Genes that are on different chromosomes are independently assorted None of the above explains why linkage occurs

Genes that are close together on the same chromosome tend to be transmitted together to offspring

Which of the following is not one of the principles of linkage that Morgan obtained from his experiments? Genes that are on the same chromosome may be inherited together. Crossing over exchanges pieces of chromosomes and creates new allele combinations. The likelihood of crossing over occurring between two genes is dependent on the distance of the genes from one another. Genes that are on the same chromosome are always transmitted together as a unit.

Genes that are on the same chromosome are always transmitted together as a unit.

Which of the following are moderately repetitive sequences? Genes that encode rRNA Most protein-encoding genes Both a and b None of the above

Genes that encode rRNA

Extranuclear inheritance occurs due to Chromosomes that have become detached from the spindle apparatus during meiosis Genetic material that is found on chloroplasts and mitochondria Mutations that disrupt the integrity of the nuclear membrane None of the above

Genetic material that is found on chloroplasts and mitochondria

Monoallelic expression is associated with which of the following? Genomic imprinting Maternal inheritance Extranuclear inheritance X-inactivation

Genomic imprinting

Monoallelic expression is associated with which of the following? X-inactivation Genomic imprinting Maternal inheritance Extranuclear inheritance

Genomic imprinting

If a bacteria is placed in an environment that contains both glucose and lactose, the regulation of the lac operon will allow which nutrient to be processed first? Glucose Lactose Both will be processed equally Neither will be processed in this environment

Glucose

Used Pneumococcus strains and mice to demonstrate a "transforming factor" that could change R bacteria into S bacteria

Griffith

The enzyme known as _____ uses _____ and separates the DNA strands at the replication fork Helicase, ATP Helicase, GTP Topoisomerase, ATP Topoisomerase, GTP

Helicase, ATP

A female born with Angelman syndrome carries a deletion in the AS gene (i.e. the UBE3A gene). Which parent transmitted the deletion to her? Her father Her mother Either her mother or father

Her mother

Used bacteriophage and E. coli to demonstrate DNA was the genetic material injected by the bacteriophage into E. coli and used to code for new phages

Hershey and Chase

The role of cohesin is to Make chromosomes more compact Allow for the replication of chromosomes Hold sister chromatids together Promote the separation of sister chromatids

Hold sister chromatids together

The transfer of an antibiotic resistance gene from one bacterial species to a different species is an example of Exon shuffling Horizontal gene transfer Genetic drift Migration

Horizontal gene transfer

Which of the following statements is correct? If a deletion and duplication are the same size, the deletion is more likely to be harmful If a deletion and duplication are the same size, the duplication is more likely to be harmful If a deletion and duplication are the same size, the likelihood of causing harm is about the same A deletion is always harmful, whereas a duplication is always beneficial

If a deletion and duplication are the same size, the deletion is more likely to be harmful

A chromosome territory is a region Along a chromosome where many genes are clustered Along a chromosome where the nucleosomes are close together In a cell nucleus where a single chromosome is located In a cell nucleus where a multiples chromosomes are located

In a cell nucleus where a single chromosome is located

Where does transcription of the genome take place in the eukaryotes? In the nucleus Both the nucleus and the cytoplasm None of the above In the cytoplasm

In the nucleus

Polydactyly is condition in which a person has extra fingers and/or toes. It is caused by a dominant allele. If a person carries this allele but does not have any extra fingers or toes, this is an example of Haploinsufficiency A dominant negative mechanism Incomplete penetrance A gain-of-function mutation

Incomplete penetrance

Sigma factor is needed during which stage(s) of transcription? Initiation Elongation Termination All of the above

Initiation

The three stages of transcription are Initiation, ribosome binding, and termination Elongation, ribosome binding, and termination Initiation, elongation, and termination Initiation, regulation, and termination

Initiation, elongation, and termination

Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. (The * indicates the centromere.) before A B C D * E F G H after A C D * E F G H Terminal deletion Interstitial deletion Inversion Gene duplication

Interstitial deletion

In mice, the copy of the Igf2 gene that is inherited from the mother is never expressed in her offspring. This happens because the Igf2 gene from the mother Always undergoes a mutation that inactivates its functions Is deleted during oogenesis Is deleted during embryonic development Is not transcribed in the somatic cells of the offspring

Is not transcribed in the somatic cells of the offspring

What aspect of the sugar is unique to RNA? It contains a double ring base It can form a 3' phosphodiester linkage It contains a pentose sugar It contains an OH group on the 2' carbon of the pentose sugar

It contains an OH group on the 2' carbon of the pentose sugar

DNA polymerase III is a processive enzyme, which means that It does not dissociate from the template strand after it has attached a nucleotide to the 3' end It makes a new strand very quickly It proceeds toward the opening of the replication fork It copies DNA with relatively few errors

It does not dissociate from the template strand after it has attached a nucleotide to the 3' end

Which of the following statements are true about the Shine-Dalgarno (SD) sequence in bacteria? It facilitates the binding of mRNA and large subunit and defines the reading frame. It identifies the correct AUG located upstream of the SD and defines the reading frame. It occupies the P site during initiation of translation and defines the reading frame. It facilitates the binding of mRNA and small subunit and defines the reading frame.

It facilitates the binding of mRNA and small subunit and defines the reading frame.

What is one of the criteria that all genetic material must meet? It does not contain the information necessary to construct the entire organism. It must be passed from offspring to parent. It must be able to be copied. It must have a limited amount of variation.

It must be able to be copied.

When does crossing over usually occur, and what is the end result? It occurs during prophase of meiosis I, and the end result is the exchange of pieces between homologous chromosomes It occurs during prometaphase of meiosis I, and the end result is the exchange of pieces between homologous chromosomes It occurs during prophase of meiosis I, and the end result is the separation of sister chromatids It occurs during prometaphase of meiosis I, and the end result is the separation of sister chromatids

It occurs during prophase of meiosis I, and the end result is the exchange of pieces between homologous chromosomes

Which statement best describes synthesis of the lagging strand? It proceeds 5'-3' away from the replication fork It proceeds 3'-5' toward the replication fork It proceeds 5'-3' toward the replication fork It proceeds 3'-5' away from the replication fork

It proceeds 5'-3' away from the replication fork

Which of the following is correct regarding sigma factor? It is involved in the termination of replication It recognizes the promoter region It forms an open complex It forms mRNA

It recognizes the promoter region

To synthesize DNA, what does telomerase use as a template? It uses the DNA in the 3' overhang region It uses RNA that is a component of telomerase No template is used Both a and b are correct

It uses RNA that is a component of telomerase

A pea plant is Tt. Which of the following statements is correct? Its genotype is Tt, and its phenotype is dwarf Its phenotype is Tt, and its genotype is dwarf Its genotype is Tt, and its phenotype is tall Its phenotype is Tt, and its genotype is tall

Its genotype is Tt, and its phenotype is tall

Inducible lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

Lac operon

Which of the following encode polycistronic mRNA? Lac operon Operator site Trp operon CAP site

Lac operon Trp operon

Which of the following encode polycistronic mRNA? (Check all that apply.) Lac operon Operator site Trp operon CAP site

Lac operon Trp operon

Mendel's work with two-factor (dihybrid) crosses led directly to which of the following? Chromosomal theory of inheritance Particulate theory of inheritance Law of independent assortment Law of segregation Theory of biological evolution

Law of independent assortment

Mendel's work with two-factor (dihybrid) crosses led directly to which of the following? Law of segregation Theory of biological evolution Chromosomal theory of inheritance Law of independent assortment Particulate theory of inheritance

Law of independent assortment

In the biological sciences, the null hypothesis is usually rejected if the P value is _____. greater than 1 less than 0.30 less than 0.95 less than 0.05 less than 1

Less than 0.05

A down promotor mutation causes the promoter of a gene to be _____ like the consensus sequence and _____ transcription Less, stimulates More, stimulates Less, inhibits More, inhibits

Less, inhibits

If a tRNA has an anticodon with the sequence 3'-GAC-5', which amino acid does it carry? Aspartic acid Valine Leucine Glutamine

Leucine

Within a promoter, a transcriptional start site is Located at the -35 sequence and is recognized by a sigma factor Located at the -35 sequence and is where the first base is used as a template for transcription Located at the +1 site and is recognized by a sigma factor Located at the +1 site and is where the first base is used as a template for transcription

Located at the +1 site and is where the first base is used as a template for transcription

What is a mechanism of condensation shared by both prokaryotes and eukaryotes? Nucleosomes Loop domains 30 nm fiber None of these choices are correct.

Loop domains

The anticodon of a tRNA is located in the 3' single-stranded region of the acceptor stem Loop of the 1st stem-loop Loop of the 2nd stem-loop Loop of the 3rd stem-loop

Loop of the 2nd stem-loop

What type of inheritance is observed with extranuclear DNA? Mendelian inheritance Sex-linked inheritance Paternal inheritance Maternal inheritance Maternal effect

Maternal inheritance

Which of the following statements regarding plants is false? Meiosis within anthers produces spores that develop into pollen Meiosis within ovules produces spores that develop into an embryo sac The male gametophyte is a pollen grain, and the female gametophyte is an embryo sac Meiosis directly produces sperm and egg cells in plants

Meiosis directly produces sperm and egg cells in plants

A pea plant has the genotype TtRr. The independent assortment of these 2 genes occurs at _____ because chromosomes carrying the _____ alleles line up independently of the chromosomes carrying the _____ alleles Metaphase of meiosis I, T and t, R and r Metaphase of meiosis I, T and R, t and r Metaphase of meiosis II, T and t, R and r Metaphase of meiosis II, T and R, r and r

Metaphase of meiosis I, T and t, R and r

Which nucleotide modification occurs in imprinting a gene? Methylation Phosphorylation Nitration Acetylation

Methylation

A nucleotide change within a coding region that changes one amino acid to another in the protein

Missense mutation

Where is extranuclear DNA located in mammalian cells? Ribosome Mitochondria Plasma membrane Endoplasmic reticulum

Mitochondria

Hemophilia is a blood-clotting disorder in humans that follows an X-linked recessive pattern of inheritance. A man with hemophilia and a woman without hemophilia have a daughter with hemophilia. If you let H represent the common (non-disease-causing) allele and h the hemophilia allele, what are the genotypes of the parents? Mother is X(H)X(h) and father is X(h)Y Mother is X(h)X(h) and father is X(h)Y Mother is X(h)X(h) and father is X(H)Y Mother is X(H)X(h) and father is X(H)Y

Mother is X(H)X(h) and father is X(h)Y

In snail shell coiling, which of the following is responsible for the phenotype of the offspring? Father's phenotype Father's genotype Mother's phenotype Mother's genotype

Mother's genotype

In snail shell coiling, which of the following is responsible for the phenotype of the offspring? Mother's phenotype Father's phenotype Mother's genotype Father's genotype

Mother's genotype

A chromosome that is metacentric has its centromere At the very tip Near one end, but not at the very tip Near the middle At two distinct locations

Near the middle

On its chromosome, an E coli cell has the genotype Lacl-, LacZ+, LacY+, LacA+. It has a F' factor with the genotype Lacl+, LacZ+, LacY+, LacA+. What is the expected level of expression of the lac operon genes (LacZ+, LacY+, LacA+) in the absence of lactose? Both lac operons will be expressed Neither lac operon will be expressed Only the chromosomal lac operon will be expressed Only the lac operon on the F' factor will be expressed

Neither lac operon will be expressed

Is the promoter sequence part of the DNA that is transcribed? Yes, both the -35 and -10 sequences are present on the new transcript Only the -10 sequence is present on the new transcript Neither the -35 nor the -10 sequences are present on the new transcript

Neither the -35 nor the -10 sequences are present on the new transcript

Which of the following is a factor that, by itself, does not promote widespread changes in allele or genotype frequencies? New mutation Natural selection Genetic drift Migration Nonrandom Mating

New mutation

A mutation in the lacI gene prevents the gene product from binding allolactose. What will the expression level of the operon be in the absence of lactose? No transcription Positive regulation Constitutively active Transcription will occur only in the presence of glucose

No transcription

A mutation in the lacI gene prevents the gene product from binding allolactose. What will the expression level of the operon be in the absence of lactose? Positive regulation Constitutively active No transcription Transcription will occur only in the presence of glucose

No transcription

A mutation changes a codon that specifies tyrosine into a stop codon. This type of mutation is a Missense mutation Nonsense mutation Frameshift mutation Neutral mutation

Nonsense mutation

A nucleotide change within a coding region that changes a sense codon to a stop codon

Nonsense mutation

Which of the following represents the lowest level of chromosome condensation? Radial loop domain 30 nm fibers Heterochromatin Nucleosome Euchromatin

Nucleosome

Going from simple to complex, which of the following is the proper order for the structure of DNA? Nucleotide, double helix, DNA strand, chromosome Nucleotide, chromosome, double helix, DNA strand Nucleotide, DNA strand, double helix, chromosome Chromosome, nucleotide, DNA strand, double helix

Nucleotide, DNA strand, double helix, chromosome

Humans with aneuploidy who survive usually have incorrect numbers of chromosome 13, 18, or 21 or the sex chromosomes. A possible explanation why these abnormalities permit survival is because The chromosome have clusters of genes that aid in embryonic growth The chromosomes are small and carry relatively few genes Of X-chromosome inactivation Of both b and c

Of both b and c

In agriculture, an advantage of triploidy in plants is that the plants are More fertile Often seedless Always disease-resistant All of the above

Often seedless

If a geneticist describes a trait as being 70% penetrant, what would they mean? Individuals with the trait show variation in expression. It is lethal in 30% of the individuals who have the trait. Only 70% of the individuals who carry the allele(s) for a trait express the trait. The trait is present in 70% of the population.

Only 70% of the individuals who carry the allele(s) for a trait express the trait.

Cis-acting element lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

Operator

An advantage of translesion-replicating polymerases is that they can replicate _____, but a disadvantage is that they _____ Very quickly, have low fidelity Over damaged DNA, have low fidelity When resources are limited, are very slow Over damaged DNA, are very slow

Over damaged DNA, have low fidelity

What site does the initiator tRNA bind to on the ribosome? A E P

P

During the peptidyl transfer reaction, the polypeptide, which is attached to a tRNA in the _____, becomes bound via _____ to an amino acid attached to a tRNA in the _____. A site, several hydrogen bonds, P site A site, a peptide bond, P site P site, a peptide bond, A site P site, several hydrogen bonds, A site

P site, a peptide bond, A site

Which of the following is NOT a mechanism used by bacteria to condense their DNA? Looping of the DNA Packaging the DNA with histone proteins Super coiling Anchoring the DNA loops with DNA-binding proteins

Packaging the DNA with histone proteins

Inbreeding in sexual reproduction between individuals that are Homozygous Heterozygous Part of the same genetic lineage Both a and c

Part of the same genetic lineage

Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. (The * indicates the centromere.) before A B C D * E F G H after A B G F E * D C H Reciprocal translocation Pericentric inversion Paracentric inversion Gene duplication None of these choices are correct.

Pericentric inversion

Which of the following is an example of post translational regulation in prokaryotes? Sterically blocking the ribosome Phosphorylation of an enzyme Incorporation of antisense RNA Altering the structure of the mRNA

Phosphorylation of an enzyme

The general name for a change in a single base pair

Point mutation

In natural populations, most genes are Polymorphic Monomorphic Recessive Both a and c

Polymorphic

Regulation of gene expression may occur at which of the following levels? (Check all that apply.) Post translation Constitutive expression Translation Transcription

Post translation Translation Transcription

Which enzyme synthesizes a 10-12 base segment of RNA that is used by DNA pol III? DNA ligase Primase Topoisomerase DNA polymerase I DNA polymerase III

Primase

The Law of Segregation allows for the prediction of alleleic combinations in the progeny based on ____________

Probability

The chance that an outcome will occur in the future is called the outcome's ____________

Probability

Due to the Law of Independent Assortment the probability of different alleleic combinations being present in a gamete is calculated by the ____________ of the frequencies of those alleles

Product

A cross is made between AA Bb Cc Dd and Aa Bb cc dd individuals. Rather than making a very large Punnett square, which statistical operation could you use to solve this problem, and what would be the probability that the cross produces an offspring that is AA bb Cc dd? Product rule, 1/32 Product rule, 1/4 Binomial expansion, 1/32 Binomial expansion, 1/4

Product rule, 1/32

Prokaryotic chromosomes do not have telomeres because __________. Prokaryotic chromosomes do not have repetitive sequences Prokaryotic chromosomes are circular Prokaryotic chromosomes only have one origin of replication Prokaryotic cells have another mechanism to replicate the ends of their chromosomes

Prokaryotic chromosomes are circular

Where does the process of transcription initiate? Promoter Terminator Regulation sequences Transcription factors

Promoter

Negative supercoiling can enhance transcription and DNA replication because it Allows the binding of proteins in the major groove Promotes DNA strand separation Makes the DNA more compact Causes all of the above

Promotes DNA strand separation

Which of the following base sequences is used during transcription? Promotor and terminator Start and stop codons Ribosome-binding site Both a and b

Promotor and terminator

The enzyme that accomplishes transcription is termed __________. DNA polymerase RNA polymerase DNA ligase RNA ligase RNA replicase

RNA Polymerase

Which RNA polymerase in eukaryotes is responsible for the transcription of genes that encode proteins? RNA Polymerase I RNA Polymerase II RNA Polymerase III All of the above transcribe protein-encoding genes

RNA Polymerase II

DNA Polymerase I removes ________ and adds nucleotides to which end (as indicated by the arrow and letter, A or B) of the Okazaki fragments? (Top strand is the template and bottom strand is the newly synthesized strand. Dark regions on bottom strand indicate the primer.) RNA primers, A RNA primers, B single-strand binding proteins, A single-strand binding proteins, B

RNA primers, A

How does DNA differ from RNA? RNA uses only purines. RNA uses a different five-carbon sugar. RNA contains different sized phosphate groups. RNA has multiple bases attached to the sugar.

RNA uses a different five-carbon sugar.

The results of the replica plating experiments by the Lederbergs supported which theory? Random mutation theory Physical adaptation theory Both theories Neither theory

Random mutation theory

A coin is flipped 100 times, with a result of 53 heads and 47 tails. The deviation between the observed numbers and the expected 50-50 results is called _________. Probability Degrees of freedom Goodness of fit Random sampling error Standard error

Random sampling error

According to the Law of Segregation different alleles will ____________ segregate into different gametes

Randomly

A repressor is a _____ that _____ transcription Small effector molecule, inhibits Small effector molecule, enhances Regulatory protein, inhibits Regulatory protein, enhances

Regulatory protein, inhibits

What is the correct order of elements that comprise a functional protein encoding gene in a prokaryote? Promoter, regulatory region, transcribed region, terminator Regulatory region, promoter, transcribed region, terminator Regulatory region, promoter, terminator, transcribed region Promoter, transcribed region, regulatory region, terminator

Regulatory region, Promoter, transcribed region, terminator

DNA fingerprinting analyzes the DNA from individuals on the basis of the occurrence of _____ in their genomes Repetitive sequences Abnormalities in chromosome structure Specific genes Viral insertions

Repetitive sequences

Darwinian fitness is a measure of Survival Reproductive success Heterozygosity of the gene pool Polymorphism in a population

Reproductive success

During this phase of the cell cycle, the sister chromatids are formed: S phase G2 phase Prophase G1 phase

S phase

Sister chromatids are formed during which phase of the cell cycle? Prophase S phase Cytokinesis G2 phase G1 phase

S phase

α-helices and β-sheets are examples of what level of protein structure? Primary structure Quaternary structure Secondary structure Tertiary structure

Secondary structure

Which of the following is not true concerning a population in equilibrium according to the Hardy-Weinberg rule? There is no migration into or out of the population. Individuals of the population mate randomly. The population size is very large. Selection is favoring the dominant allele. There is no mutation in the population.

Selection is favoring the dominant allele.

What is the name for the mechanism of DNA replication in which one parental strand and one daughter strand are combined following replication? Dispersive Semiconservative Conservative All of these choices are correct.

Semiconservative

In an Ames test, a _____ number of colonies is observed if a substance _____ a mutagen, compared with the number of colonies for a control sample that is not exposed to the suspected mutagen Significantly higher, is Significantly higher, is not Significantly lower, is Significantly lower, is not

Significantly higher, is

A nucleotide change within a coding region that produces no change to the amino acid sequence

Silent mutation

Which of the following would contain genetic material that is 100% identical? Homologous chromosomes Sister chromatids X and Y chromosomes All of these choices are correct - all answers are identical.

Sister chromatids

In which cells do erasure and re-establishment of nucleotide imprinting modifications typically not occur? Sperm cells Oocytes Nurse cells Somatic cells

Somatic cells

In animals, a key difference between spermatogenesis and oogenesis is that Only oogenesis involves meiosis Only spermatogenesis involves meiosis Spermatogenesis produced 4 sperm, whereas oogenesis produced only 1 egg cell None of the above describes a difference between the 2 processes

Spermatogenesis produced 4 sperm, whereas oogenesis produced only 1 egg cell

The reading frame begins with a _____ and is read _____ Promoter, one base at a time Promoter, in groups of three bases Start codon, one base at a time Start codon, in groups of three bases

Start codon, in groups of three bases

What typically terminates the process of translation? Introns Stop codons Aminoacyl tRNA synthase rRNA Rho proteins

Stop codons

If the piece of partially double stranded DNA below was added to a reaction mixture that contained DNA pol III and all the reaction components necessary to synthesize DNA what would be the next base added? 5' AGCATGACGATCCAT 3' 3' ACTGCTAG 5' A G C T

T

What basal transcription factor is a helicase? TFIID TFIIH TFIIF TFIIB

TFIIH

What basal transcription factor is a helicase? TFIIH TFIIF TFIID TFIIB

TFIIH

A tall (T) tomato plant with mottled (m) leaves is crossed with a short (t) plant with normal (M) leaves. You get all tall, normal leafed F1 plants.You cross the F1 plants with a short, mottled leafed plant. You observe the following progeny phenotypes: Propose a null hypothesis. What would be the expected values from this hypothesis? Tall mottled 250, Short normal leaves 250, Tall normal leaves 250, Short mottled leaves 250 Tall mottled 563, Short normal leaves 187, Tall normal leaves 187, Short mottled leaves 63 Tall mottled 400, Short normal leaves 400, Tall normal leaves 100, Short mottled leaves 100

Tall mottled 250, Short normal leaves 250, Tall normal leaves 250, Short mottled leaves 250

Which of the following is found at the end of a eukaryotic chromosome? Telomeres Centromeres Kinetochores Origins of replication

Telomeres

The proofreading of newly synthesized DNA by DNA Pol III occurs in __________. The 5' to 3' direction The 3' to 5' direction Both directions

The 3' to 5' direction

The 4th codon in an mRNA is GGG, which specifies glycine. Assuming that no amino acids are removed from the polypeptide, which of the following statements is correct? The 3rd amino acid from the N-terminus is glycine The 4th amino acid from the N-terminus is glycine The 3rd amino acid from the C-terminus is glycine The 4th amino acid from the C-terminus is glycine

The 4th amino acid from the N-terminus is glycine

The complementarity of DNA strands is based on The chemical properties of a phosphodiester linkage The binding of proteins to the DNA The AT/GC rule None of the above

The AT/GC rule

Which of the following is NOT a reason for the high fidelity of DNA synthesis of DNA Pol III? The hydrogen bonding between purines and pyrimidines is stable. The DNA polymerase is unlikely to form bonds between nucleotides if they are mismatched. The DNA polymerase has exonuclease functions. The DNA polymerase has the ability to change the structure of the base in order to form the correct bond.

The DNA polymerase has the ability to change the structure of the base in order to form the correct bond.

In mammals, sex is determined by The SRY gene on the Y chromosome Having 2 copies of the X chromosome Having 1 copy of the X chromosome Both a and c

The SRY gene on the Y chromosome

You are working in a lab and isolate a mammalian cohesin mutant that is unable to be cleaved by separase. What will be the result of this mutation? The cells will be stuck in anaphase, unable to separate sister chromatids. The cells will be stuck in metaphase, unable to properly align chromosomes. The cells will be stuck in S phase, unable to form sister chromatids. The cells will proceed through the cell cycle normally.

The cells will be stuck in anaphase, unable to separate sister chromatids.

Kozak rules determine The choice of the start codon in complex eukaryotes The choice of the start codon in bacteria The site in the mRNA where the translation ends How fast the mRNA is translated

The choice of the start codon in complex eukaryotes

Which of the following influences on genetic drift involve(s) the migration of a population from one location to another? The bottleneck effect The founder effect Both a and b None of the above

The founder effect

Morgan observed a higher number of recombinant offspring involving eye color and wing length (401 + 318) than those involving body color and eye color (17 + 12). These results occurred because The genes affecting eye color and wing length are farther apart on the X chromosome than are the genes affecting body color and eye color The genes affecting eye color and wing length are closer together on the X chromosome than are the genes affecting body color and eye color The gene affecting wing length is not on the X chromosome The gene affecting body color is not on the X chromosome

The genes affecting eye color and wing length are farther apart on the X chromosome than are the genes affecting body color and eye color

In a chi-square test to determine if two genes are linked or assorting independently, what is the default (null) hypothesis that is tested? The genes are linked to one another. The genes are assorting independently. The genes are located on the sex chromosomes. No crossing over occurs. The distance between the genes is very small.

The genes are assorting independently.

In a chi-square test to determine if two genes are linked or assorting independently, what is the default (null) hypothesis that is tested? The genes are linked to one another. The genes are located on the sex chromosomes. The distance between the genes is very small. The genes are assorting independently. No crossing over occurs.

The genes are assorting independently.

In this equation p2 + 2pq + q2 = 1, what does the term 2pq represent? The genotype frequency of homozygous recessive individuals The genotype frequency of homozygous dominant individuals The genotype frequency of heterozygous individuals The sum of the phenotype frequencies in the population

The genotype frequency of heterozygous individuals

What was the conclusion of Franklin's work regarding the structure of DNA? It did not have a helical structure. The helix had more than one strand. The helix contained about 1 bases per turn. The helix had only one strand.

The helix had more than one strand.

A groove in a DNA double helix refers to The indentations where the bases are in contact with the surrounding water The interactions between bases in the DNA' The spiral structure of the DNA All of the above

The indentations where the bases are in contact with the surrounding water

In the replica-plating experiments of the Lederbergs, bacterial colonies appeared at the same locations on each of the 2 secondary plates because T1 phage caused the mutations to happen The mutations occurred on the master plates prior to T1 exposure and prior to replica plating Both a and b are true Neither a nor b is true

The mutations occurred on the master plates prior to T1 exposure and prior to replica plating

If an individual is afflicted with Prader-Willi syndrome (PWS), which of the following is true? The AS gene was silenced in the mother's egg. The maternal chromosome 15 carries a deletion. The paternal chromosome 15 carries a deletion. The PWS gene was silenced in the father's sperm.

The paternal chromosome 15 carries a deletion

What is a characteristic of T2 bacteriophage? It does not require a host cell for replication. The phage attaches to the cell wall of a target eukaryotic cell. The phages injects its DNA into the host cell. The new phages are formed outside the host cell.

The phages injects its DNA into the host cell.

What is true according to the adaptor hypothesis? The anticodon and amino acid have no relationship. A given tRNA can carry any of the twenty amino acids. The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid. An amino acid recognizes the codon in mRNA.

The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.

What is true according to the adaptor hypothesis? A given tRNA can carry any of the twenty amino acids. An amino acid recognizes the codon in mRNA. The anticodon and amino acid have no relationship. The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.

The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.

Operons involved with the biosynthesis of molecules such as amino acids are most likely to be regulated in which of the following ways? The product of the biosynthetic pathway represses transcription The product of the biosynthetic pathway activates transcription A precursor of the biosynthetic pathway represses transcription A precursor of the biosynthetic pathway activates transcription

The product of the biosynthetic pathway represses transcription

What is the genetic code? The relationship between a 3-base codon sequence and an amino acid or the end of translation The entire base sequence of an mRNA molecule The entire sequence from the promoter to the terminator of a gene The binding of tRNA to mRNA

The relationship between a 3-base codon sequence and an amino acid or the end of translation

The model that correctly describes the process of DNA replication is The conservative model The semiconservative model The dispersive model All of the above models describe the process correctly

The semiconservative model

Some human diseases are caused by mutations in mitochondrial genes. Which of the following statements if false? Human mitochondria diseases follow a maternal inheritance pattern Mutations associated with mitochondrial diseases often affect cells with a high demand for ATP The symptoms associated with mitochondrial diseases tend to improve with age Heteroplasmy plays a key role in the severity of mitochondrial disease symptoms

The symptoms associated with mitochondrial diseases tend to improve with age

In a population of wild squirrels, most of them have gray fur, but an occasional squirrel is completely white. If we let P and p represent dominant and recessive alleles, respectively, of a gene that encodes an enzyme necessary for pigment formation, which of the following statements do you think is most likely to be correct? The white squirrels are pp, and the p allele is a loss-of-function allele The gray squirrels are pp, and the p allele is a loss-of-function allele The white squirrels are PP, and the P allele is a loss-of-function allele The gray squirrels are PP, and the P allele is a loss-of-function allele

The white squirrels are pp, and the p allele is a loss-of-function allele

What was the conclusion of the Hershey-Chase experiments? Their results suggested the presence of a transforming principle. Their results suggested that DNA is a double helix. Their results suggested that A+G=T+C. Their results suggested that the DNA is the genetic material.

Their results suggested that the DNA is the genetic material.

A transition mutation occurs within the transcribed region of a mRNA. What is the impact on the protein translated from this mRNA? The protein will be shorter than it should be and likely not function. There is not enough information to determine what the impact will be. The protein will be longer than it should be and likely not function. This will result in a frameshift mutation that causes a new stop codon downstream of the transition mutation.

There is not enough information to determine what the impact will be.

Select the statements that are true regarding the experiments by Beadle and Tatum. (Check all that apply.) They used the mold Neurospora as a model organism. They isolated strains that could not grow on minimal media. They established the link between a gene and an enzyme or protein. They were able to create loss-of-function mutations in any enzyme they chose.

They used the mold Neurospora as a model organism. They isolated strains that could not grow on minimal media. They established the link between a gene and an enzyme or protein.

In a strand of RNA, which base is not found covalently linked to a ribose sugar? Adenine Cytosine Guanine Thymine

Thymine

The function of photolyase is to repair Double-strand breaks Apurinic sites Thymine dimers All of the above

Thymine dimers

A main function of TFIID is __________. To recognize the TATA box To act as a helicase To terminate RNA polymerase II binding To phosphorylate the CTD of RNA polymerase II

To recognize the TATA box

Which of the following removes supercoiling ahead of the replication fork? DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

Topoisomerase

With regard to transcriptional termination in eukaryotes, which model(s) suggest(s) that RNA polymerase is physically removed from the DNA? Allosteric model Torpedo model Both models Neither model

Torpedo model

What would be a set of anticipated results from a "Lederberg" experiment? Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 15 Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 1500 Total number of colonies on a plate: 500 Total number of resistant colonies on replica plate with T1: 1500 Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 0

Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 15

Probability is the number of times a particular outcome occurs divided by the ____________

Total number of possible outcomes

Cis or trans acting? RNA Polymerase

Trans

Cis or trans acting? TFIID

Trans

Cis or trans acting? Transcription factors

Trans

A prokaryotic promoter is shown. Where does transcription start? Transcription starts at the -35 site. Transcription starts at the +1 site. Transcription starts at the -10 site. Transcription starts downstream of the +1 site.

Transcription starts at the +1 site.

If CAP could not bind to its CAP site, then what would be the result? Assume lactose is present in each scenario. Transcription would be difficult to activate in the presence of glucose Transcription would be difficult to activate in the absence of glucose Transcription would be difficult to repress in the presence of glucose

Transcription would be difficult to activate in the absence of glucose

Frederick Griffith is responsible for discovering what process? Replication Transmission Transformation Transduction

Transformation

Purine to purine or pyrimidine to pyrimidine change

Transition

A male cat and a female cat produce a litter of kittens. Which criteria of genetic material is represented? Transmission Information Replication Variation

Transmission

In the following sequence of DNA, the italicized base has been mutated. What type of mutation is this? 5' - G A T C T C C G A A T T - 3' original strand 5' - G A T C T C C C A A T T - 3' mutated strand Transition Transversion Neither

Transversion

Purine to pyrimidine or pyrimidine to purine change

Transversion

Repressible lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

Trp operon

True/False A purine on one strand of the DNA is always paired with a pyrimidine on the other strand.

True

True/False A single copy of an allele showing complete dominance typically masks the effects of a recessive allele

True

True/False Alleles of every gene in a population make up the population's gene pool

True

True/False Because of alternative splicing, a pre-mRNA could generate a dozen different mRNAs.

True

True/False CAP binding causes the DNA to bend facilitating RNA polymerase binding

True

True/False Constitutive genes are those that have constant levels of expression.

True

True/False Crossing-over occurs during prophase I of meiosis

True

True/False During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

True

True/False Genetic drift can result in allele fixation

True

True/False Homologous chromosomes are 99% identical

True

True/False Homologous chromosomes carry the same types of genes

True

True/False Homologous chromosomes may contain different alleles of a gene

True

True/False Horizontal gene transfer between individuals in a population, while not a mutation, is a source of genetic variation.

True

True/False If a person is heterozygous for a recessive disease allele, they normally possess 50% of the normal amount of protein

True

True/False If two loci are extremely linked, then no recombination is expected.

True

True/False In sex influenced traits, both sexes can express the trait, depending on their genotype, but in sex limited inheritance a particular sex can only have one phenotype for the trait in question.

True

True/False In the absence of glucose and presence of lactose, allolactose combines with the repressor and allows RNA polymerase to proceed with transcription.

True

True/False It is possible to get more than one protein product from a eukaryotic pre-mRNA.

True

True/False Migration is a key evolutionary mechanism by which microevolution occurs.

True

True/False Mitosis and cytoplasmic division result in the formation of two genetically identical cells

True

True/False New genetic variation in a population is a critical aspect of microevolution.

True

True/False One would expect heterochromatic regions of DNA to be more compacted than euchromatic regions.

True

True/False Polycistronic mRNA is transcribed from the lac operon when lactose is present in the cell.

True

True/False Population bottlenecks and founder effect are examples of genetic drift

True

True/False Population genetics looks at changes in genetic variation that occur over time

True

True/False Repressor proteins are responsible for negative transcriptional regulation.

True

True/False The Old Order Amish of Lancaster County, PA are an example of a population that has experienced genetic drift

True

True/False The RNA transcript being produced by the RNA polymerase is complementary to the template strand of the DNA.

True

True/False The form of regulation that involves a physical change in the shape of an enzyme is called allosteric regulation.

True

True/False The genetic code is nearly universal in nuclear DNA from bacteria to mammals.

True

True/False The lac repressor protein is active in the absence of lactose within the cell.

True

True/False The lacI gene makes a repressor protein

True

True/False The most prevalent alleles in a population are called wild type alleles

True

True/False The process of replica plating was designed to test if mutations occurred in response to a selective agent or if mutations were naturally present in the population before selection.

True

True/False The product of lacI is an allosteric protein that can undergo a conformational change when allolactose binds to it

True

True/False Variable expressivity means that the phenotype of a trait can vary between individuals

True

True/False Constitutive genes are those that have constant levels of expression.

True

True/False In sex influenced traits, both sexes can express the trait, depending on their genotype, but in sex limited inheritance a particular sex can only have one phenotype for the trait in question.

True

Co-repressor lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

Tryptophan

Which of the following would not be observed in a pedigree if a genetic disorder was inherited in a recessive manner? Two unaffected parents have an affected offspring Two affected parents have an unaffected offspring One affected and one unaffected parent have an unaffected offspring All of the above are possible for a recessive disorder

Two affected parents have an unaffected offspring

The Law of Independent Assortment is based on Mendel's experiments with ____________

Two factors

How many hydrogen bonds are between the G:C base pairs and the A:T base pairs? Two hydrogen bonds between the G:C base pairs and three between the A:T base pairs. Two hydrogen bonds between both G:C and A:T base pairs. Two hydrogen bonds between the A:T base pairs and three between the G:C base pairs. One hydrogen bond between both G:C and A:T base pairs.

Two hydrogen bonds between the A:T base pairs and three between the G:C base pairs.

Which of the following defines the principle of linkage? Check all that apply. Two or more genes that are physically connected on a chromosome. Genes that are transmitted to the next generation as a group. The process by which genetic information is exchanged between homologous chromosomes.

Two or more genes that are physically connected on a chromosome. Genes that are transmitted to the next generation as a group.

Which of Avery, MacLeod and McCarty's following experimental conditions produced no transformation of Type R bacteria and, therefore, no growth on the plates? Type R + Type S DNA extract + DNase None of these choices. Type R + Type S DNA extract + RNase Type R + Type S DNA extract + protease

Type R + Type S DNA extract + DNase

Select the example of an induced mutational mechanism. DNA replication errors Tautomeric shifts of nucleic acid bases Aberrant recombination UV light Transposable elements

UV light

The binomial equation can be used to determine the probability of the ____________ combination of events occurring

Unordered

Which base is not found in DNA? Cytosine Guanine Thymidine Adenine Uracil

Uracil

You are performing a biochemical purification of enzymes involved in DNA replication. You have purified the replisome. You wish to purify the primosome. You perform further separation techniques on your purified replisome. How will you test to determine that you have purified the primosome? You should confirm that your sample has helicase and primase activity, but not the ability to synthesize DNA. You should confirm that your sample has the ability to synthesize DNA and has primase activity, but no helicase activity. You should confirm that your sample has helicase and primase activity. This is the only test that is needed. You should confirm that your sample has primase activity and can synthesize DNA. This is the only test that is needed.

You should confirm that your sample has helicase and primase activity, but not the ability to synthesize DNA.

The C-terminus of a polypeptide always contains __________. a stop codon a carboxyl group an amino group carbon dioxide None of these choices are correct.

a carboxyl group

A tRNA that has an amino acid attached is called __________. an rRNA a degenerate tRNA a coding tRNA a charged tRNA

a charged tRNA

The 5' and 3' ends of a DNA strand are defined by identifying the identity of the final nucleotide. the presence or absence of a phosphate. a particular carbon atom in the sugar. a particular carbon atom in the nitrogenous base.

a particular carbon atom in the sugar.

A chromosome territory is defined as __________. a region in the nucleus that is occupied by a single chromosome a region on a chromosome that is devoid of nucleosomes a region on a chromosome that has no protein encoding genes a region in the nucleus that may have several chromosomes

a region in the nucleus that is occupied by a single chromosome

If this pedigree shows a dominant disorder caused by the dominant A allele, what are the genotypes of the parents in this pedigree? aa and AA aa and Aa aa and aa Aa and Aa

aa and Aa

The fact that the helixes of the DNA strand are arranged in opposite directions gives DNA its __________ characteristics. antiparallel complementary redundant water-soluble

antiparallel

Mendel carried out his research on garden peas. You should remember that he used seven pairs of traits. Modern geneticists have mapped the genes for Mendel's pairs of traits. Two of them are on chromosome 1, yet when Mendel carried out a dihybrid cross using these genes, his results led him to the conclusion that they assorted independently. This makes sense if the two genes on chromosome 1 __________. are at least 20 mu apart are more than 50 mu apart are very close together never recombine

are more than 50 mu apart

Synthesis of the lagging strand proceeds __________ the replication fork and synthesis of the leading strand proceeds ____________ the replication fork. away from; towards towards; away from adjacent to; across from across from; adjacent to

away from; towards

Arrange the following proteins in the proper order in which they participate in DNA replication. a. Primase b. Helicase c. Single-stranded binding proteins d. DNA polymerase

b, c, a, d

If an individual that phenotypically has dominant traits is mated to another individual that also has dominant traits and the progeny have both dominant and recessive traits it indicates that __________. one parent is heterozygotic and one is homozygotic both parents are homozygotic no conclusions can be made about the genotypes of the parents both parents are heterozygotic

both parents are heterozygotic

How does exposing an E coli cell to glucose effect the regulation of the lac operon via CAP? cAMP binds to CAP and transcription is increased cAMP binds to CAP and transcription is decreased cAMP does not bind to CAP and transcription is increased cAMP does not bind to CAP and transcription is decreased

cAMP does not bind to CAP and transcription is decreased

The function of condensin is to __________. cause the chromosomes to decondense following mitosis coat the chromosomes and condense them into heterochromatin through the compaction of radial loops hold the DNA to the histone proteins in the nucleosome core particle trigger DNA to be compacted in a nucleosome core particle None of these choices are correct.

coat the chromosomes and condense them into heterochromatin through the compaction of radial loops

In human blood groups, the fact that an individual can have an AB blood type is an example of ___________. codominance incomplete penetrance sex-influenced trait temperature-sensitive conditional allele incomplete dominance

codominance

The production of wild-type offspring from a cross between parents that both display the same recessive phenotype illustrates the genetic phenomenon of _______. gene dosage incomplete penetrance complementation a spontaneous mutation simple recessive alleles

complementation

In eukaryotes, many proteins interact with the DNA double helix and some play a specific role in the compaction of the chromosome during the cell cycle. The protein _____________ is responsible for pulling the radial loops of the DNA in tighter and further condensing the chromosome, while ___________ is responsible for keeping the sister chromatids together cohesin, condensin condensin, cohesin condensin, centromere

condensin, cohesin

Areas of the chromosome that remain highly condensed are called __________. euchromatin facultative heterochromatin constitutive heterochromatin chromosome territories

constitutive heterochromatin

The significance of mutations in microevolution is to __________. remove deleterious alleles create new alleles allow for selection allow for genetic drift

create new alleles

The pyrimidine bases are _______. cytosine, thymine, and uracil adenine and guanine adenine and thymine cytosine and guanine

cytosine, thymine, and uracil

The complete loss of either a guanine or adenine from DNA is an example of __________. depurination tautomeric shifts deamination demethylation

depurination

In animals, somatic cells are ________ and germ cells are __________. diploid ; haploid haploid ; diploid diploid ; diploid haploid ; haploid

diploid ; haploid

A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring have green pods. From this information, it can be stated that the green color is _____ to the yellow color. recessive dominant subservient blended None of these choices are correct

dominant

The study of gene modifications that alter gene expression, but are not permanent over the course of many generations is called __________ epigenetics proteomics extranuclear inheritance Mendelian inheritance

epigenetics

Crossing over is more likely to occur between genes that are __________ on a chromosome. close together far apart

far apart

The end result of meiosis in animals is ______. two diploid cells two haploid cells four diploid cells four haploid cells None of the answers are correct.

four haploid cells

The production of gene families, such as the globin genes is the result of ________. inversions deficiencies gene duplications simple translocations None of these choices are correct.

gene duplications

The genetic composition of an individual is called its _____________ phenotype genotype hybrid dominance None of these choices are correct

genotype

The genetic composition of an individual is called its _____________. phenotype genotype hybrid dominance None of these choices are correct

genotype

In a Punnett square diagram, the outside of the box represents the _________. diploid offspring haploid offspring diploid gametes haploid gametes

haploid gametes

Humans homozygous for the sickle cell allele have sickle cell anemia. A human that is heterozygous for the sickle cell allele is an example of _____________. codominance incomplete penetrance heterozygous advantage multiple allele systems

heterozygous advantage

During sexual reproduction, each parent contributes one set of chromosomes. Members of a pair of chromosomes (one from each parent) are called _____. karyotypes sister chromatids homologs sex chromosomes

homologs

A heterozygote possesses a phenotype that is intermediate between the homozygous dominant and homozygous recessive phenotypes. This is most likely an example of ________. gene dosage lethal alleles sex-influenced inheritance incomplete dominance

incomplete dominance

A heterozygote possesses a phenotype that is intermediate between the homozygous dominant and homozygous recessive phenotypes. This is most likely an example of ________. lethal alleles incomplete dominance gene dosage sex-influenced inheritance

incomplete dominance

An individual carries the allele for polydactyly, a dominant trait, but is phenotypically normal. This is an example of __________. incomplete dominance simple Mendelian inheritance incomplete penetrance gene dosage codominance

incomplete penetrance

A number of different mutations can alter structure, including __________. (Check all that apply.) inversions deletions translocations transductions duplications

inversions deletions translocations duplications

Horizontal gene transfer __________. is the transfer of DNA by mutation is the transfer of DNA by crossing over is the transfer of DNA between different genomes is the transfer of DNA during normal cell division is the transfer of DNA between tumor cells

is the transfer of DNA between different genomes

Which of the following is not part of the lac operon? lacO lacZ lacA lacI lacP

lacI

Trans-acting element lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

lacI gene product

The lac repressor binds to what site within the lac operon? lacZ lacO lacA lacl lacP

lacO

The allele that causes Huntington disease in humans is an example of a(n) _______ that exerts its effects later in life. epistatic allele recessive allele environmental effect semilethal allele lethal allele

lethal allele

What is a mechanism of condensation shared by both prokaryotes and eukaryotes? 30 nm fiber nucleosomes loop domains nuclear matrix

loop domains

Which RNA encodes the sequence of amino acids for a functional protein? rRNA snRNA mRNA tRNA scRNA

mRNA

Which RNA encodes the sequence of amino acids for a functional protein? tRNA mRNA rRNA snRNA

mRNA

Which RNA encodes the sequence of amino acids for a functional protein? tRNA snRNA mRNA rRNA scRNA

mRNA

Oogenesis is a gametogenic process involving ________ that produces _______. meiosis ; egg cells binary fission ; sperm cells mitosis ; egg cells mitosis ; sperm cells meiosis ; sperm cells

meiosis ; egg cells

A cross in which a researcher investigates the patterns of inheritance of a single trait is called a __________ monohybrid cross dihybrid cross two-factor cross cross-fertilization self-fertilization

monohybrid cross

Proteins that are functionally more important for the survival of an organism generally evolve ________ less important proteins. more slowly than more quickly than at the same rate as none of these answers are correct

more slowly than

The correct order of compaction from least compacted to most compacted would be __________. naked DNA, 30-nm fiber, nucleosome, loop domain, metaphase chromosome naked DNA, loop domain, 30-nm fiber, nucleosome, metaphase chromosome naked DNA, nucleosome, 30-nm fiber, loop domain, metaphase chromosome naked DNA, metaphase chromosome, loop domain, 30-nm fiber, nucleosome

naked DNA, nucleosome, 30-nm fiber, loop domain, metaphase chromosome

A crossover in meiosis is an exchange of genetic material between __________. sister chromatids of the same chromosome sister chromatids of homologous chromosomes sister chromatids of non-homologous chromosomes non-sister chromatids of homologous chromosomes non-sister chromatids of non-homologous chromosomes

non-sister chromatids of homologous chromosomes

DNA and RNA are known as __________ nucleic acids amino acids proteins lipids

nucleic acids

DNA and RNA are types of __________. proteins nucleic acids nucleotides nucleosides

nucleic acids

The backbone of the DNA molecule is formed by ________. peptide bonds ribose sugars nitrogenous bases phosphodiester bonds

phosphodiester bonds

In humans, the gene for eye color is an example of a ________ trait. monomorphic polymorphic

polymorphic

An activator is present and results in the increase in transcription of the target gene. This is an example of _______________. termination positive control negative control feedback inhibition

positive control

The regulation of protein function is called __________. posttranscriptional regulation translational regulation posttranslational regulation transcriptional regulation

posttranslational regulation

To initiate transcription in the Eukaryotes, five General Transcription factors must assemble at the core promoter to get RNA polymerase transcribing. What are the requirements for initiation of transcription in the bacteria? promoter (-70 & -30) and the core enzyme only promoter (-35 & -10) and sigma factor & the core enzyme promoter (-35 & -10) and the core enzyme only promoter (-70 & -30) and sigma factor & the core enzyme

promoter (-35 & -10) and sigma factor & the core enzyme

In the lac operon, the CAP site is located next to the __________. When both lactose and glucose are present, this leads to a rate of transcription that is __________. terminator; low promoter; high terminator; high promoter; low

promoter; low

Avery, MacLeod and McCarty used the enzyme __________ to remove the proteins from the cell extracts protease DNase RNase All of these choices are correct.

protease

Avery, MacLeod and McCarty used the enzyme __________ to remove the proteins from the cell extracts. protease DNase RNase All of these choices are correct.

protease

P generation: True-breeding fruit flies with red eyes and long wings were crossed to flies with white eyes and miniature wings. All F1 offspring had red eyes and long wings. The F1 female flies were then crossed to males with white eyes and miniature wings. The following results were obtained for the F2 generation: 129 red eyes, long wings 133 white eyes, miniature wings 71 red eyes, miniature wings 67 white eyes, long wings What is/are the expected phenotype(s) of the recombinant offspring of the F2 generation? red eyes, long wings white eyes, miniature wings red eyes, long wings and white eyes, miniature wings red eyes, miniature wings and white eyes, long wings

red eyes, miniature wings and white eyes, long wings

A translocation that moves a gene from an area of euchromatin to heterochromatin would typically cause a/an __________ in the expression of the gene. reduction increase Gene expression would remain the same.

reduction

DNA replication is said to be __________. dispersive semiconservative conservative liberal inconclusive

semiconservative

What is the name for the mechanism of DNA replication in which one parental strand and one daughter strand are combined following replication? dispersive semiconservative conservative

semiconservative

The haploid number of garden peas is seven. They therefore have ___________ linkage groups when they are diploid. forty-two seven fourteen twenty-one

seven

Dosage compensation offsets the problems associated with differences in the number of __________ chromosomes in many species. cytoplasmic autosome sex extranuclear mitochondrial

sex

During __________, two __________ fuse with each other in the process of fertilization to begin the life of a new organism. gametogenesis; somatic cells gametogenesis; gametes sexual reproduction; gametes sexual reproduction; somatic cells

sexual reproduction; gametes

An enormous variety of genomic structures can be seen among viruses, with a given virus having either a DNA or an RNA genome. The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Based on this information equine influenza is a __________ virus. single-stranded RNA double-stranded RNA single-stranded DNA double-stranded DNA

single-stranded RNA

An anticodon is located on __________. rRNA tRNA mRNA DNA snRNA

tRNA

The peptidyl transferase is a component of __________. DNA tRNA the ribosome the protein being translated mRNA

the ribosome

The peptidyl transferase is a component of __________. the protein being translated tRNA DNA mRNA the ribosome

the ribosome

The RNA transcript is complementary to __________. regulatory sequences termination sequences the coding strand of DNA the template strand of DNA

the template strand of DNA

In a double-helix DNA strand, the adenine on one strand forms hydrogen bonds with a/an __________ on the other strand. adenine guanine thymine cytosine

thymine

A main function of TFIID is __________. to recognize the TATA box to phosphorylate the CTD of RNA polymerase II to terminate RNA polymerase II binding to act as a helicase

to recognize the TATA box

A prokaryotic mRNA transcript is capable of being transcribed completely before being translated. translated as it is being transcribed. transported from the nucleus before it is translated. further processed before it is transcribed.

translated as it is being transcribed.

The purpose of DNA replication is to produce __________. two daughter strands two parental strands two template strands None of these choices are correct.

two daughter strands

Splicing joins together __________. two introns two exons an intron and an exon any two RNA molecules a DNA and an RNA molecule

two exons

A tetrad in Prophase I is made up of __________. four non-homologous chromosomes four non-homologous chromatids four homologous pairs of chromosomes two homologous pairs of chromosomes two homologous chromosomes, each consisting of two chromatids

two homologous chromosomes, each consisting of two chromatids

Epistasis is _______________. another term for overdominance when one gene can mask the expression of a second gene a trait that is only expressed in one sex of the species when two dominant alleles can be expressed in the same individual None of the answers are correct

when one gene can mask the expression of a second gene

In four-o'clock plants, red flower color is dominant to white flower color. However, heterozygous plants have a pink color. If a pink-flowered plant is crossed with a white-flowered plant, what will be the phenotypic ratios of their offspring? ½ red, ½ pink ¼ red, ½ pink, ¼ white All pink All white ½ pink, ½ white

½ pink, ½ white

What is Chargaff's rule? %A = %T, %C = %G %A = %C, %G = %T %A = %G, %C = %T %A = %C = %T = %G

%A = %T, %C = %G

Which site in a gene signals the beginning of transcription for the core enzyme of RNA polymerase? +35 +1 -35 -10 +10

+1

In dogs, brown fur color (B) is dominant to white (b). A cross is made between 2 heterozygotes for fur color. If the litter consists of 6 puppies, what is the probability that half of them will be white? 0.066 of 6.6% 0.13 or 13% 0.25 or 25% 0.26 or 26%

0.13 or 13%

A gene exists in two alleles designated D and d. If 48 copies of this gene are the D allele and 152 are the d allele, what is the allele frequency of D? 0.24 0.32 0.38 0.76

0.24

The allele frequency if C is 0.4 and that of c is 0.6. If the population is in Hardy-Weinberg equilibrium, what is the frequency of the heterozygotes? 0.16 0.24 0.26 0.48

0.48

How many Barr bodies would an individual with a XXY genotype possess? 0 1 2 None of these choices are correct.

1

How many origins of replication are there on a bacterial chromosome? 0 1 2 More than two

1

How many promoters are in an operon? 0 1 2 None of the above answers are correct.

1

A female mouse that is Igf2 Igf2- is crossed to a male that is also Igf2 Igf2-. The expected outcome for the phenotypes of the offspring for this cross is All normal size All dwarf 1 normal size : 1 dwarf 3 normal size : 1 dwarf

1 normal size : 1 dwarf

According to the Lyon hypothesis 1 of the X chromosomes is converted to a Barr body in somatic cells of female mammals 1 of the X chromosomes is converted to a Barr body in all cells of female mammals Both of the X chromosomes is converted to a Barr body in somatic cells of female mammals Both of the X chromosomes is converted to a Barr body in all cells of female mammals

1 of the X chromosomes is converted to a Barr body in somatic cells of female mammals

A pea plant has a genotype rrYy. How many different types of gametes can it make and in what proportions? 1 rr: 1 Yy 1 rY: 1 ry 3 rY: 1 ry 1 RY: 1 rY : 1 Ry: 1 ry

1 rY: 1 ry

A pink-flowered four-o' clock is crossed to a red-flowered plant. What is the expected outcome for the offspring's phenotype? All pink All red 1 red : 2 pink : 1 white 1 red : 1 pink

1 red : 1 pink

A Tt pea plant is crossed to a tt plant. What is the expected ratio of phenotypes for offspring from this cross? 3 tall : 1 dwarf 1 tall : 1 dwarf 1 tall : 3 dwarf 2 tall : 1 dwarf

1 tall : 1 dwarf

How many Barr bodies would you expect to find in a cell from a person with the following genotype? 1. XXY 2.. XY 3.. XX 4. XYY 5. XXX 6. XO (only one X)

1. 1 2. 0 3. 1 4. 0 5. 2 6. 0

Match the mode of inheritance with an example 1. Codominance 2. Overdominance 3. Epistasis 4. Pleiotropy 5. Incomplete Dominance

1. AB blood 2. Sickle cell anemia 3. 9:7 phenotypic dihybrid ratio 4. Cystic fibrosis 5. Four O'clock flower color

Suppose that we are dealing with four genes, each gene consisting of a dominant allele (capital letter) and a recessive allele (small case letter). If the cross CcMmLlPP X CCmmLlpp is made, what is the probability of obtaining an individual who is CcmmLLPp? 1/4 1/32 1/2 1/16 1/8

1/16

In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele? 3/4 1/16 1/4 1/2

1/2

A protein called actin consists of 376 amino acids. Excluding 5' and 3' UTRs, the mRNA for actin must be 1131 nucleotides. 377 nucleotides. 125 nucleotides. 376 nucleotides.

1131 nucleotides.

You are studying an organism that has a diploid number of 30. How many chromosomes will the gametes from this organism have? 60 15 30 7.5

15

While mapping two genes in Drosophila, you observe 30 recombinants among 200 total offspring. What is the distance between these genes? 200 map units 30 map units 15 map units 6.67 map units

15 map units

While mapping two genes in Drosophila, you observe 30 recombinants among 200 total offspring. What is the distance between these genes? 30 map units 6.67 map units 200 map units 15 map units

15 map units

The following sequence forms a stem-loop in the poliovirus (PV) RNA that is bound by PCBP, an RNA-binding protein that functions in both the translation and replication of the PV genomic RNA: 5'-UGGGGUUGUACCCACCCCA-3'. Once formed, how many hydrogen bonds stabilize the stem in this structure? 6 12 14 16 20

16

When Mendel crossed two plants that were heterozygous for a single trait, what was the genotypic ratio of their offspring? 1:2:1 9:3:3:1 3:1 1:1 Varied depending on the trait

1:2:1

How many replication forks are present in a replication bubble? 1 2 3 4

2

How many sets of chromosome are found in a human somatic cell, and how many chromosomes are within one set? 2 sets, with 23 in each set 23 sets, with 2 in each set 1 sets, with 23 in each set 23 sets, with 1 in each set

2 sets, with 23 in each set

In humans, there are __________ autosomal linkage groups, plus a linkage group for each sex chromosome. 22 23 92 46

22

A map distance of 23.6 between two genes indicates which of the following? The genes are 23.6 millimeters apart. There are 23.6 other genes between the two genes of interest. 23.6% of the offspring exhibit recombination between the two genes. 23.6% of the offspring do not survive.

23.6% of the offspring exhibit recombination between the two genes.

A map distance of 23.6 between two genes indicates which of the following? There are 23.6 other genes between the two genes of interest. 23.6% of the offspring exhibit recombination between the two genes. The genes are 23.6 millimeters apart. 23.6% of the offspring do not survive.

23.6% of the offspring exhibit recombination between the two genes.

If 100 different ova from an SsRr individual are genotyped the number of ova that would have the SR allelic combination would be predicted to be ____________

25

Cystic fibrosis is caused by mutations in the CF gene, and there are several different mutations that are known to result in CF disease. The CF mutations behave as recessive alleles to the WT CF allele. If two carriers that have different mutations in their CF genes have children what is the probability that one of their children will have CF disease? 25% 50% 100% 75%

25%

Adenine and thymine form __________ hydrogen bonds between them, while cytosine and guanine form __________ hydrogen bonds. 2; 3 3; 4 3; 2 4; 3

2; 3

Which algebraic expression would be used to denote a trisomic organism? 3n 2n − 1 2n + 1 2n + 2

2n + 1

A cross is made between a pea plant that is RrYy and one that is rrYy. What is the predicted outcome of the seed phenotypes? 9 round, yellow : 3 round, green : 3 wrinkled, yellow : 1 wrinkled, green 3 round, yellow : 3 round, green : 1 wrinkled, yellow : 1 wrinkled, green 3 round, yellow : 1 round, green : 3 wrinkled, yellow : 1 wrinkled, green 1 round, yellow : 1 round, green : 1 wrinkled, yellow : 1 wrinkled, green

3 round, yellow : 1 round, green : 3 wrinkled, yellow : 1 wrinkled, green

DNA polymerases are unable to replicate what areas of the chromosome? Centromeres 3' end of telomeres Origins of replication

3' end of telomeres

One strand of DNA is 5'-AGGCCTTA-3'. What is the sequence of the opposite strand? 5'-AGGCCTTA-3' 5'-TCCGGAAT-3' 3'-AGGCCTTA-5' 3'-TCCGGAAT-5'

3'-TCCGGAAT-5'

According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain? 20% 30% 50% 75%

30%

DNA is isolated from the nucleus of an organism and the base composition is determined. Which answer would best represent an organism that has double stranded DNA for its genome? 20% A 20% G 30% C 30% T 20% A 20% G 20% C 40% T 30% A 15% G 15% C 30% T 15% A 25% G 15% C 35% T

30% A 15% G 15% C 30% T

In a given population of Drosophila, curly wings (c) is recessive to the wild-type condition of straight wings (c+). You isolate a population of 35 curly winged flies, 70 flies that are heterozygous for straight wings and 45 that are homozygous for straight wings. What is the total number of alleles in the gene pool? 2 150 230 300 140

300

P generation: True-breeding fruit flies with red eyes and long wings were crossed to flies with white eyes and miniature wings. All F1 offspring had red eyes and long wings. The F1 female flies were then crossed to males with white eyes and miniature wings. The following results were obtained for the F2 generation: 129 red eyes, long wings 133 white eyes, miniature wings 71 red eyes, miniature wings 67 white eyes, long wings What is the map distance between the two genes for eye color and wing length? 32.3 mu 34.5 mu 16.2 mu 17.3 mu

34.5 mu

A diploid organism that you are studying has 17 pairs of chromosomes. How many total chromosomes are found in a somatic cell from this organism? A sperm cell? An egg cell? 17; 17; 17 17; 16; 16 34; 17; 17 34; 17; 34

34; 17; 17

When Mendel crossed two plants that were heterozygous for a single trait, what was the phenotypic ratio of their offspring? 9:3:3:1 Varied depending on the trait 1:2:1 3:1 7:4

3:1

A bivalent contains how many chromatids? 8 2 4 Depends on the cell

4

The reason why Beadle and Tatum observed 4 different categories of mutants that could not grow on media without methionine is because The enzymes in methionine biosynthesis is composed of 4 different subunits The enzymes in methionine biosynthesis is present in 4 copies in the Neurospora genome 4 different enzymes are involved in a pathway for methionine biosynthesis A lack of methionine biosynthesis can inhibit Neurospora growth in 4 different ways

4 different enzymes are involved in a pathway for methionine biosynthesis

Unique sequences make up approximately what percent of the human genome? 5% 25% 41% 81%

41%

The common goldfish Carassius auratus has 100 chromosomes and is tetraploid. The goldfish therefore has __________ sets of chromosomes containing __________ chromosomes each. 4; 25 2; 50 4; 100 1; 100

4; 25

In Drosophila, the genes reduced (rd) bristles and withered (whd) wing are both found on chromosome 2, with their respective positions indicated on the chromosome map depicted below. A female with reduced bristles and normal wings was mated to a male with normal bristles and withered wings. All of the F1 offspring were phenotypically wild-type. What proportion of the progeny resulting from a testcross of an F1 female is expected to be phenotypically wild-type? 0% 5% 100% 45% 10%

5%

For the following 5 sequences, what is the consensus sequence? 5' - GGGAGCG - 3' 5' - GAGAGCG - 3' 5' - GAGTGCG - 3' 5' - GAGAACG - 3' 5' - GAGAGCA - 3' 5' - GGGAGCG - 3' 5' - GAGAGCG - 3' 5' - GAGTGCG - 3' 5' - GAGAACG - 3'

5' - GAGAGCG - 3'

Which of the following DNA sequences is complementary to 5' TAGAC 3'? 5' TAGAC 3' 5' ATCTG 3' 5' GTCTA 3' 5' CAGAT 3' None of these choices are correct.

5' GTCTA 3'

The consensus sequences at a bacterial promoter are 5' TTGACA 3' and 5' TATAAT 3' at -35 and -10 respectively. Which of the following sequences would be most easily recognized by σ factor? 5' TAAATT 3' 5' TATATA 3' 5' TTCAGA 3' 5' TTGAAA 3'

5' TTGAAA 3'

DNA polymerase III does not have which of the following activities? 5' to 3' DNA polymerase activity 5' to 3' exonuclease activity 3' to 5' exonuclease activity

5' to 3' exonuclease activity

During transcription, the synthesis of the mRNA strand proceeds in which direction? None of the above 5' to 3' only Either 5' to 3' or 3' to 5' First 5' to 3', and then 3' to 5' Both 5' to 3' and 3' to 5'

5' to 3' only

A mutagen that is a base analog is Ethyl methanesulfonate (EMS) 5-bromouracil UV light Proflavin

5-bromouracil

A mating of an Ss individual to an individual that is SS has a probability of producing an SS offspring of ____________

50%

Segregation of the alleles means that a gamete has a ____________ chance of getting a particular allele

50%

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' 7 10 8 13

8

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' 7 8 10 13

8

If the F1 offspring are allowed to self-fertilize, what is the expected outcome for the F2 offspring? All white All purple 3 purple : 1 white 9 purple : 7 white

9 purple : 7 white

Using Mendel's flower color (purple is dominant, white is recessive), if two heterozygous plants are crossed, what is the probability that the first two offspring will have purple flowers? 6/4 1/16 1/2 1/4 9/16

9/16

Which of the following does NOT conform to Chargaff's rules of the base composition of DNA? %age of A = %age of T %age of G = %age of C A + T = G + C A + G = T + C

A + T = G + C

In a DNA strand, a phosphate connects a 3' carbon atom in one deoxyribose to A 5' carbon in an adjacent deoxyribose A 3' carbon in an adjacent deoxyribose A base in an adjacent nucleotide None of the above

A 5' carbon in an adjacent deoxyribose

Chargaff's analysis of the base composition of DNA is consistent with base pairing between A and G, and T and C A and A, and G and G, T and T, and C and C A and T, and G and C A and C, and T and G

A and T, and G and C

An abnormal fruit fly has two sets of autosomes and is XXY. Such a fly is A male A female A hermaphrodite None of the above

A female

A cow with scurs and a bull with no scurs have an offspring. This offspring could be A female with scurs or a male with scurs A female with no scurs or a male with scurs A female with scurs or a male with no scurs A female with no scurs or a male with no scurs

A female with no scurs or a male with scurs

What is an operon? A site in the DNA where a regulatory protein binds A group of genes under the control of a single promoter An mRNA that encodes severals genes All of the above are true of an operon

A group of genes under the control of a single promoter

One way that TNRE may occur involved the formation of _____ that disrupts _____ A double-strand break, chromosome segregation An apurinic site, DNA replication A hairpin, DNA replication A free radical, DNA structure

A hairpin, DNA replication

Which of the following is not an example of a spontaneous mutation? A mutation caused by an error in DNA replication A mutation caused by a tautomeric shift A mutation caused by UV light All of the above are spontaneous mutations

A mutation caused by UV light

An inborn error of metabolism is caused by A mutation in a gene that causes an enzyme to be inactive A mutation in a gene that occurs in somatic cells The consumption of foods that disrupt metabolic processes Any of the above

A mutation in a gene that causes an enzyme to be inactive

A person with type AB blood has a child with a person with type O blood. What are the possible blood types of the child? A or B A, B, or O A, B, AB, or O O only

A or B

For a protein encoding gene, what marks the start and end of the DNA region that will be transcribed? A promoter and a repressor An operator and a repressor A promoter and a terminator A sigma factor and an operator An rho factor and a sigma factor

A promoter and a terminator

A chromosome territory is defined as __________. A region in the nucleus that is occupied by a single chromosome A region on a chromosome that is devoid of nucleosomes A region on a chromosome that has no protein encoding genes A region in the nucleus that may have several chromosomes

A region in the nucleus that is occupied by a single chromosome

Which of the following combinations will cause the rate of transcription to increase? A repressor plus an inducer A repressor plus a corepressor An activator plus an inhibitor None of the above will increase the rate of transcription

A repressor plus an inducer

At what site on the ribosome does a tRNA with one amino acid enter during elongation? None of the answers A site E site P site

A site

Which of the following statements about a spliceosome is false? A spliceosome splices pre-mRNA molecules A spliceosome removes exons from RNA molecules A spliceosome is composed of snRNPs A spliceosome recognizes the exon-intron boundaries and the branch site

A spliceosome removes exons from RNA molecules

A release factor is referred to as a "molecular mimic" because its structure is similar to that of A ribosome An mRNA A tRNA An elongation factor

A tRNA

An individual has the genotype GgDd for the genes G and D. Both genes are on separate chromosomes. Which of the following diagrams represents a possible meiotic metaphase I arrangement in the germ line cell of this individual? B) is the correct diagram D) is the correct diagram A) is the correct diagram C) is the correct diagram

A) is the correct diagram

What are the components of a single nucleosome? About 146 bp of DNA and 4 core histone proteins About 146 bp of DNA and 8 core histone proteins About 200 bp of DNA and 4 core histone proteins About 200 bp of DNA and 8 core histone proteins

About 146 bp of DNA and 8 core histone proteins

Which modification is not required for eukaryotic mRNA to exit the nucleus? RNA Splicing Polyadenylation Acetylation 5' capping

Acetylation

Cells are treated with a drug that blocks purine synthesis. Which bases would not be made in those treated cells? Cytosine, thymine, and uracil Adenine and guanine Adenine and thymine Cytosine and guanine

Adenine and guanine

The bases __________ and __________ are purines, while __________, __________, and __________ are pyrimidines. Uracil; guanine; cytosine; adenine; thymine Guanine; thymine; adenine; cytosine; uracil Cytosine; uracil; adenine; thymine; guanine Adenine; guanine; thymine; uracil; cytosine

Adenine; guanine; thymine; uracil; cytosine

An individual with type A blood and an individual with type B blood mate and have offspring. What blood type is not possible in their offspring? Type O blood Type A blood Type B blood Type AB blood All blood types are possible

All blood types are possible

A bacterial chromosome typically contains A few thousand genes One origin of replication Some repetitive sequences All of the above

All of the above

Evidence that led to the discovery of the DNA double helix included The determination of structures using ball-and-stick models The X-ray diffraction data of Franklin The base composition of Chargaff All of the above

All of the above

Genetic drift is A change in allele frequencies due to random fluctuations Likely to result in allele loss or fixation over the long run More pronounced in smaller populations All of the above

All of the above

The basal transcription apparatus is composed of 5 general transcription factors RNA polymerase II A DNA sequence containing a TATA box and transcriptional start site All of the above

All of the above

The chromosomes of eukaryotes typically contain A few hundred to several thousand different genes Multiple origins of replication A centromere Telomeres at the end All of the above

All of the above

The compaction leading to a metaphase chromosome involves which of the following The formation of nucleosomes The formation of the 30-nm fiber The further compaction of the loop domains All of the above

All of the above

The origin of replication in E coli contains An AT-rich region DnaA boxes GATC methylation sites All of the above

All of the above

The site(s) on a ribosome where tRNA molecules may be located include The A site The P site The E site All of the above

All of the above

Which of the following DNA repair systems may involve the removal of a segment of a DNA strand? Base excision repair Nucleotide excision repair Mismatch repair All of the above

All of the above

Which of the following are examples of RNA modifications? Splicing Capping with 7-methylguanosine Adding of a polyA tail All of the above are examples of RNA modifications

All of the above are examples of RNA modifications

Which of the following is not a feature of the DNA double helix? It obeys the AT/GC rule The DNA strands are antiparallel The structure is stabilized by base stacking All of the above are features of the DNA double helix

All of the above are features of the DNA double helix

Which of the following is a function of the 7-methylguanosine cap? Exit of mRNA from the nucleus Efficient splicing of pre-mRNA Initiation of translation All of the above are functions of the cap

All of the above are functions of the cap

Which of the following statements is true? Not all inheritance patterns follow a strict dominant/recessive relationship Geneticists want to understand both inheritance patterns and the underlying molecular mechanisms that cause them to happen Different inheritance patterns are explained by a variety of different molecular mechanisms All of the above are true

All of the above are true

Binary fission Is a form of asexual reproduction Is a way for bacteria to reproduce Begins with a single mother cell and produced two genetically identical daughter cells All of the above are true of binary fission

All of the above are true of binary fission

The mutation rate is The likelihood that a new mutation will occur in a given gene Too low to substantially change allele frequencies in a population Lower for mutations that create beneficial alleles All of the above are true of the mutation rate

All of the above are true of the mutation rate

With regard to gene duplications, which of the following statement(s) is/are correct? Gene duplications may be caused by nonallelic homologous recombination Large gene duplications are more likely to be harmful than smaller ones Gene duplications are responsible for creating gene families that encode proteins with similar and specialized functions All of the above statements are correct

All of the above statements are correct

When a karyotype is prepared, which of the following steps is carried out? Treat the cells with a chemical that causes them to begin cell division Treat the cells with a hypotonic solution that causes them to swell Expose the cells to chemical dyes that bind to the chromosomes and stain them All of the above steps are carried out

All of the above steps are carried out

A gene pool is All of the alleles of the genes in a single individual All of the genes in the gametes produced by a single individual All of the alleles of all the genes in a population of individuals The random mixing of alleles during sexual reproduction

All of the alleles of all the genes in a population of individuals

Which of the following are limitations of DNA polymerases? DNA polymerases can attach new nucleotides only in the 5' to 3' direction. DNA polymerases must have a template strand to copy from. DNA polymerases must begin synthesis using a primer. All of the answers are correct.

All of the answers are correct.

Which of the following best describes the double-helix of DNA? It has directionality The strands are arranged in an anti-parallel arrangement The strands are complementary All of these choices are correct.

All of these choices are correct.

A cross is made between a green four-o' clock plant and a variegated one. If the variegated plant provides the pollen, the expected outcome of the phenotypes of the offspring will be All plants with green leaves 3 plants with green leaves to 1 plant with variegated leaves 3 plants with green leaves to 1 plants with white leaves Some plants with green leaves, some with variegated leaves, and some with white leaves

All plants with green leaves

Assume that genes C and D are located on the same chromosome. On one chromosome, alleles C and D are found, while the homolog contains alleles c and d. Which of the following would be evidence of a recombination event? Check all that apply. Alleles C and D together on one chromosome. Alleles c and d together on one chromosome. Alleles C and d together on one chromosome. Alleles c and D together on one chromosome.

Alleles C and d together on one chromosome. Alleles c and D together on one chromosome.

Inducer lacI gene product Trp operon Lac operon Allolactose Tryptophan Operator

Allolactose

The lac repressor is inactivated by binding to which of the following? Lactose Beta-galactosidase Transcription factors Glucose Allolactose

Allolactose

The binding of _____ to the lac repressor causes the lac repressor to _____ to the operator site, thereby _____ transcription Glucose, bind, inhibiting Allolactose, bind, inhibiting Glucose, not bind, increasing Allolactose, not bind, increasing

Allolactose, not bind, increasing

In the experiment of Avery, McLeod, and McCarty, the addition of RNase or protease to a DNA extract Prevented the conversion of type S bacteria into type R bacteria Allowed the conversion of type S bacteria into type R bacteria Prevented the conversion of type R bacteria into type S bacteria Allowed the conversion of type R bacteria into type S bacteria

Allowed the conversion of type R bacteria into type S bacteria

Why do some amphibians have so much more DNA in their haploid genome than humans? Amphibians have more repetitive sequences than do humans. Amphibians are more biologically complex than mammals. Amphibians have more genes than do humans. Amphibians are tetraploid, while humans are diploid.

Amphibians have more repetitive sequences than do humans.

A ribozyme is A complex between RNA and a protein An RNA that encodes a protein that functions as a enzyme An RNA molecule with a catalytic function A protein that degrades RNA molecules

An RNA molecule with a catalytic function

Which of the following phenotypes is not an example of the wild-type phenotype? Yellow-flowered elderflower orchid Red-flowered elderflower orchid A gray elephant An albino (white elephant)

An albino (white elephant)

For a chi square test involving genes that may be linked, which of the following statements is correct? An independent assortment hypothesis is not proposed because the data usually suggest linkage An independent assortment hypothesis is proposed because it allows the expected numbers of offspring to be calculated A large chi square value suggests that the observed and expected data are in good agreement The null hypothesis is rejected when the chi square value is very ow

An independent assortment hypothesis is proposed because it allows the expected numbers of offspring to be calculated

A mutation in one gene that reverses the phenotypic effects of a mutation in a different gene is An intergenic suppressor An intragenic suppressor An up promoter mutation A position effect

An intergenic suppressor

A change in chromosome structure that does not involve a change in the total amount of genetic material is A deletion A duplication An inversion None of the above

An inversion

A site in a chromosome where DNA replication begins is A promoter An origin of replication An operator A replication fork

An origin of replication

Humans have 23 chromosomes per set. A person with 45 chromosomes can be described as being Euploid Aneuploid Monoploid Trisomic

Aneuploid

Which of the following is not an example of euploidy? Tetraploid Polyploid Triploid Diploid Aneuploid

Aneuploid

A point mutation could be caused by Depurination Deamination Tautomeric shift Any of the above

Any of the above

Dominant alleles may result from a mutation that causes The overexpression of a gene or its protein product Production of a protein that inhibits the function of a normal protein A protein to be inactive and 50% of the normal protein is insufficient for a normal phenotype Any of the above

Any of the above

Used Pneumococcus strains and protease, DNase, and RNase to demonstrate DNA was the transforming factor

Avery, Macleod, and McCarty

In the lagging strand, DNA is made in the direction _____ the replication fork and is made as _____ Toward, one continuous strand Away from, one continuous strand Toward, Okazaki fragments Away from, Okazaki fragments

Away from, Okazaki fragments

A diagram of a linear chromosome (dsDNA) is shown here. The end of each strand is labeled with an A, B, C or D. Remember the replication bubble! Which ends of each strand cannot be replicated by DNA Polymerase? A 5' __________________ 3' B C 3'___________________ 5' D A & D B & C A & C B & D

B & C

Which chromosomal change rarely has an effect on the phenotype of the individual who carries it? Robertsonian translocation Unbalanced translocation Balanced translocation Chromosome loss

Balanced translocation

A gene exists in two alleles, and the heterozygote has the highest fitness. This situation is likely to result to result in Directional selection Stabilizing selection Disruptive selection Balancing selection

Balancing selection

The proofreading function of DNA polymerase involves the recognition of a _____ and the removal of a short segment of DNA in the _____ direction Missing base, 5' to 3' Base pair mismatch, 5' to 3' Missing base, 3' to 5' Base pair mismatch, 3' to 5'

Base pair mismatch, 3' to 5'

When typtophan binds to the trp repressor, this causes trp repressor to _____ to the trp operator and _____ transcription Bind, inhibit Not bind, inhibit Bind, activate Not bind, activate

Bind, inhibit

The lac repressor __________. Binds to the operator and prevents transcription of the lactose operon Binds to the CAP site and prevents transcription of the lactose operon Binds to the CAP site and facilitates transcription of the lactose operon Binds to the operator and facilitates transcription of the lactose operon

Binds to the operator and prevents transcription of the lactose operon

Each ribosomal subunit is composed of Multiple proteins rRNA tRNA Both a and b

Both a and b

Gene flow depends on Migration The ability of migrant alleles to be passed to subsequent generations Genetic drift Both a and b

Both a and b

Mechanisms that make the bacterial chromosome more compact include The formation of microdomains and macrodomains DNA supercoiling Crossing over Both a and b

Both a and b

To make a new DNA strand, which of the following is/are necessary? A template strand Nucleotides Heavy nitrogen Both a and b

Both a and b

What is the function of the kinetochore during mitosis? It promotes the attachment of monads to each other to form a dyad It is a location where a kinetochore microtubule can attach to a chromosome It promotes the condensation of chromosomes during prophase Both a and b are correct

Both a and b are correct

A type of secondary structure found in proteins is A alpha helix A beta sheet Both a and b are secondary structures in proteins Neither a nor b is a secondary structure in proteins

Both a and b are secondary structures in proteins

Which of the following is an example of a somatic mutation? A mutation in an embryonic muscle cell A mutation in a sperm cell A mutation in an adult nerve cell Both a and c are examples of somatic mutations

Both a and c are examples of somatic mutations

Due to crossing over within an inversion loop, a heterozygote with a pericentric inversion may produce gametes that carry A deletion A duplication A translocation Both a deletion and a duplication

Both a deletion and a duplication

A key difference between the nucleotides found in DNA and those in RNA is that Those in DNA have phosphate, and those in RNA do not Those in DNA have deoxyribose and those in RNA have ribose Those in DNA have thymine, and those in RNA have uracil Both b and c are correct

Both b and c are correct

What is the explanation for maternal effect at the molecular and cellular levels? The father's genotype is silenced at fertilization During oogenesis, nurse cells transfer gene products to the oocyte The gene products from the nurse cells exert effects on the very early stages of development Both b and c are correct

Both b and c are correct

In the experiment by Bateson and Punnett, which of the following observations suggested genetic linkage in the sweet pea? A 9:3:3:1 ratio was observed in the F2 offspring A 9:3:3:1 ratio was not observed in the F2 offspring An unusually high number of F2 offspring had the phenotype of the P generation Both b and c suggested linkage

Both b and c suggested linkage

The outcome if an individual's traits is determined by Genes The environment Both genes and the environment Neither genes nor the environment

Both genes and the environment

The Law of Independent Assortment applies to meiosis in ____________

Both males and females

Which of the following is not found in a prokaryotic cell? Plasma membrane Ribosome Cell nucleus Cytoplasm

Cell nucleus

Where do kinetochores form on chromosomes? Telomeres Specific genes on the chromosome Centromeres They don't attach to DNA

Centromeres

You are a researcher examining the expression pattern of a wobbly fly phenotype. You have flies that fly straight and those having a wobble flight. When you cross a straight flying strain with a strain showing a wobble flight, all the F1 flies fly straight. In the F2 generation, you get 762 straight flying flies and 238 wobbly flies. Your null hypothesis is that one gene controls flight patterns and that straight is dominant to wobbly. Use chi square analysis to test your hypothesis. What is your chi square number? Do you reject or accept the null hypothesis? Use the table listed below to help answer the question. Chi square = 0.768; accept Chi square = 0.192; accept Chi square = 0.192; reject Chi square = 0.768; reject

Chi square = 0.768; accept

Which of the following operations could be used for hypothesis testing? Product rule Binomial expansion Chi square test Any of the above operations could be used

Chi square test

Which of the following is not one of the tenets of the chromosome theory of inheritance? Chromosomes contain the genetic material that is transmitted from parent to offspring and from cell to cell Chromosomes are replicated and passed along, generation after generation, from parent to offspring Chromosome replication occurs during S phase of the cell cycle Each parent contributes one set of chromosomes to its offspring

Chromosome replication occurs during S phase of the cell cycle

Which of the following principles is part of the chromosome theory of inheritance? (Check all that apply.) Chromosomes contain genetic material that is transmitted from parent to offspring. DNA is always the genetic material. The nuclei of most eukaryotic cells contain chromosomes that are found in homologous pairs. Each parent contributes one set of chromosomes to its offspring.

Chromosomes contain genetic material that is transmitted from parent to offspring. The nuclei of most eukaryotic cells contain chromosomes that are found in homologous pairs. Each parent contributes one set of chromosomes to its offspring.

Cis or trans acting? Enhancer

Cis

Cis or trans acting? Promoter

Cis

Cis or trans acting? Silencer

Cis

An enhancer is a _____ that _____ the rate of transcription Trans-acting factor, increases Trans-acting factor, decreases Cis-acting factor, increases Cis-acting factor, decreases

Cis-acting factor, increases

The function of condensin is to __________. Cause the chromosomes to decondense following mitosis Coat the chromosomes and condense them into heterochromatin through the compaction of radial loops Hold the DNA to the histone proteins in the nucleosome core particle Trigger DNA to be compacted in a nucleosome core particle None of these choices are correct.

Coat the chromosomes and condense them into heterochromatin through the compaction of radial loops

Two different strains of sweet peas are true-breeding and have white flowers. When plants of these two strains are crossed, the F1 offspring all have purple flowers. This outcome is due to Epistasis Complementation Incomplete dominance Incomplete penetrance

Complementation

Which of the following best describes the mechanism of DNA replication in which both parental strands remain together following replication? Dispersive Semiconservative Conservative All of these choices are correct.

Conservative

UV light and other ionizing radiations damage DNA molecules by __________. Creating guanine dimers between adjacent guanines in the DNA chain Creating adenine dimers between adjacent adenines in the DNA chain Creating thymine dimers between adjacent thymines in the DNA chain Creating uracil dimers between adjacent uracils in the DNA chain Creating cytosine dimers between adjacent cytosines in the DNA chain

Creating thymine dimers between adjacent thymines in the DNA chain

With regard to linked genes on the same chromosome, which of the following statements is false? Crossing over is needed to produce nonrecombinant offspring Crossing over is needed to produce recombinant offspring Crossing over is more likely to separate alleles if they are far apart on the same chromosome Crossing over that separates linked alleles occurs during prophase of meiosis I

Crossing over is needed to produce nonrecombinant offspring

Chloroplasts and mitochondria evolved from an endosymbiotic relationship involving Purple bacteria and cyanobacteria, respectively. Cyanobacteria and purple bacteria, respectively. Cyanobacteria Purple bacteria

Cyanobacteria and purple bacteria, respectively.

When glucose is present, __________. Cyclic AMP is high, the catabolite activator protein (CAP) binds to the activator binding site, and transcription of lactose operon is turned on Cyclic AMP is low, CAP binds to the site activator binding site, and transcription of lactose operon is turned on Cyclic AMP is high, CAP does not bind to the activator binding site, and transcription of lactose operon is turned on Cyclic AMP is low, CAP does not bind to the activator binding site, and transcription of the lactose operon is turned off

Cyclic AMP is low, CAP does not bind to the activator binding site, and transcription of the lactose operon is turned off

Which of the following best describes transcription? DNA -> DNA DNA -> RNA DNA -> Protein RNA -> DNA RNA -> Protein

DNA -> RNA

Which of the following attaches adjacent Okazaki fragments, forming a continuous DNA strand? DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

DNA ligase

Which enzyme replaces the RNA primer with DNA? Helicase DNA pol I DNA pol III Primase

DNA pol I

Which of the following fills in small regions of DNA where the RNA primers were located? DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

DNA polymerase I

Which of the following is an example of a processive enzyme? DNA A protein DNA polymerase III DNA ligase Single stranded DNA binding protein

DNA polymerase III

What critical event occurs during the S phase of the eukaryotic cell cycle? The cell either prepares to divide or commits to not dividing DNA replication produces pairs of sister chromatids The chromosomes condense The single nucleus is divided into two nuclei

DNA replication produces pairs of sister chromatids

A nucleosome is a combination of __________ and __________. histone proteins; scaffold proteins RNA; transcription proteins DNA; histone proteins RNA; histone proteins DNA; scaffold proteins

DNA; histone proteins

A female snail that coils to the left has an offspring that coil to the right. What are the genotypes of this mother and of the maternal grandmother of the offspring, respectively? dd, DD Dd, Dd dd, Dd Dd, dd

Dd, dd

Nitrous acid replaces amino groups with keto groups, a process called Alkylation Deamination Depurination Crosslinking

Deamination

Which of the following could be the components of a single nucleotide found in DNA? Deoxyribose, adenine, and thymine Ribose, phosphate, and cytosine Deoxyribose, phosphate, and thymine Ribose, phosphate, uracil

Deoxyribose, phosphate, and thymine

In nucleotide excision repair in E coli, the function of the UvrA/UvrB complex is to Detect DNA damage Make cuts on both sides of the damage Remove the damaged piece of DNA Replace the damaged DNA with undamaged DNA

Detect DNA damage

Within a particular population, darkly colored rats are more likely to survive than more lightly colored individuals. This situation is likely to result in Directional selection Stabilizing selection Disruptive selection Balancing selection

Directional selection

You have isolated what appears to be alien DNA. While studying its replication, you performed the exact experiment Meselson and Stahl did. After three generations, the DNA is subjected to a CsCl gradient and only one band appears. What type of replication does this DNA undergo? Semiconservative Conservative Dispersive

Dispersive

A population occupies heterogenous environments in which the fitness of some genotypes is higher in one environment and the fitness of other individuals is higher in another environment. This situation is likely to result in Directional selection Stabilizing selection Disruptive selection Balancing selection

Disruptive selection

Which of the following types of selection creates two phenotypic classes from a single original distribution? Disruptive selection Stabilizing selection Directional selection

Disruptive selection

Which type of selection would lead to two distinct phenotypes? Stabilizing selection Phenotype selection Fitness selection Disruptive selection Directional selection

Disruptive selection

Staining eukaryotic chromosomes is useful because it makes possible Distinguish chromosomes that are similar in size and centromere location Identify changes in chromosome structure Explore evolutionary relationships among different species Do all of the above

Do all of the above

Enzymes that are processive __________. Do not dissociate from the growing strand once it has joined two nucleotides Have a high degree of accuracy Are very error-prone Release the product before associating with two new substrate

Do not dissociate from the growing strand once it has joined two nucleotides

A double-stranded region of RNA Forms a helical structure Obey the AU/GC rule May result in the formation of a structure such as a bulge loop or a stem-loop Does all of the above

Does all of the above

DNA gyrase Promotes negative supercoiling Relaxes positive supercoils Cuts DNA strands as part of its function Does all of the above

Does all of the above

A paracentric inversion Includes the centromere within the inverted region Does not include the centromere within the inverted region Has 2 adjacent inverted regions Is an inverted region at the very end of a chromosome

Does not include the centromere within the inverted region

In fruit flies, dosage compensation is achieved by X-chromosome inactivation Doubling the expression of genes on the single X chromosome in the male Halving the expression of genes on each X chromosome in the female All of the above

Doubling the expression of genes on the single X chromosome in the male

P generation: True-breeding fruit flies with red eyes and long wings were crossed to flies with white eyes and miniature wings. All F1 offspring had red eyes and long wings. The F1 female flies were then crossed to males with white eyes and miniature wings. The following results were obtained for the F2 generation: 129 red eyes, long wings 133 white eyes, miniature wings 71 red eyes, miniature wings 67 white eyes, long wings The recombinant offspring of the F2 generation were due to crossing over that occurred During spermatogenesis in the P generation males During oogenesis in the P generation females During spermatogenesis in the F1 males During oogenesis in the F1 females

During oogenesis in the F1 females

A mechanism that can produce a translocation is The joining of reactive ends when 2 different chromosomes break Crossing over between nonhomologous chromosomes Crossing over between homologous chromosomes Either a or b

Either a or b

Double-strand breaks can be replaced by Homologous recombination repair (HRR) Nonhomologous end joining (NHEJ) Nucleotide excision repair (NER) Either a or b

Either a or b

In a dihybrid cross of two heterozygous individuals, you expect a 9:3:3:1 phenotypic ratio in the offspring, but observe a ratio of 9:7. What is the most likely explanation? Codominance It is a sex-limited trait Simple Mendelian inheritance Incomplete penetrance Epistatic interaction of the two genes

Epistatic interaction of the two genes

Probability theory can be applied to inheritance since each gamete will have an ____________ chance of containing any one allele or allelic combination

Equal

The Law of Segregation means that the number of gametes with one allele should be ____________ the number of gametes with the other allele

Equal to

Which of the following is not a phase of XCI? Nucleation Spreading Maintenance Erasure

Erasure