Genetics (final) midterms to study (Jason Leonhard)
10. You have test version 'A'. Fill in the 'A' bubble on your scantron. This is going to be used to grade your test.
a
12. Imagine that DNA polymerase makes a mistake during DNA replication that eventually leads to the incorporation of Leu instead of a Phe into the Optix protein at position 98 of the polypeptide chain. Which of the following terms best describes this mutation? A) Missense Mutation B) Nonsense Mutation C) Silent Mutation D) Frameshift Mutation E) Indel
a
14. A fragment of pre-mRNA containing a noncoding region is shown below. Given this information, do you think that the noncoding portion of this pre-mRNA will be removed properly (choose the best possible answer). A) Yes, this segment will likely be removed properly B) No, the 5' splice site has a mutation that will prevent excision C) No, the 5' splice site has a mutation that will prevent excision D) No, the branch site has a mutation that will prevent excision E) No, the pyrimidine rich area should be on the other side of the branch point, closer to the 5' splice site
a
15. Which of the following individuals will have the MOST trouble producing functional gametes during meiosis? A) A triploid with a genome of 8 chromosomes B) A diploid with a genome of 1 chromosome C) A diploid with a genome of 23 chromosomes D) A tetraploid with a genome of 13 chromosomes E) A tetraploid with a genome of 48 chromosomes
a
16. After the S phase of a cell cycle, a chromosome exists as: A. a pair of sister chromatids that share one centromere B. a haploid C. a pair of homologous chromosomes D. a pair of sister chromatids, each with its own centromere E. a pair of homomorphic chromosomes
a
16. Tandem duplications of short segments of DNA are often found in the genomes of organisms. These are thought to be caused by A) Unequal crossing over B) Transversions C) Inversions D) Reciprocal translocations E) Gene conversions
a
16. What amino acid does this short segment of DNA encode for? 5' CGG 3' A) Pro B) Arg C) Gly D) Ala E) None of the above
a
19. Transduction was done to determine the distance of the fad, gap, and pab genes relative to each other. The donor was fad - gap + pab - and the recipient was fad + gap - pab +. Based upon the results below, what is the distance (frequency of cotransduction) between the gap and fad genes? Genotype Number of colonies gap + fad + pab + 98 gap + fad - pab - 54 gap + fad + pab - 19 gap + fad - pab+ 9 A) 35% B) 41% C) 65% D) 78% E) 93% 19
a
21. A DNA sample was treated with the restriction enzyme EcoR1. The resulting DNA fragments were run through an electrophoretic gel. Which of the following fragments is predicted to migrate through the gel the farthest distance? A) 200 bp B) 500 bp C) 750 bp D) 1000 bp E) 2000 bp
a
25. Transduction changes a bacterium when: A) There is a double crossover between the DNA injected by a transducing phage and the bacterial chromosome B) A phage integrates into the bacterial chromosome C) A phage integrates into the bacterial chromosome and then excises itself D) A phage cannot switch to the lysogenic lifestyle E) Fragments of DNA from a dead cell are picked up by another cell
a
29. Which enzyme is responsible for adding nucleotides to a growing strand of DNA and forming bonds between nucleotides on the leading strand? A) DNA polymerase B) Ligase C) Single-strand binding protein D) RNA polymerase E) All of the above
a
35. A geneticist at OHSU isolated a novel bacterial strain. The geneticist isolated variants of this strain that were F- and several which contained the F factor integrated at different places in the genome. After isolating a set of markers, the geneticist performed a mating and assayed for the order of the transfer of the markers for the various strains. Based only the available data, what is the map of the markers in the genome of this organism? F factor - 1st -----------------------Last #1 Q I A X B #2 I Q F N E #3 S T C K V P #4 P D O G L #5 X B M S T A) ENFQIAXBMSTCKVPDOGL B) PDOGVENFQIAXBMSTCKV C) QIAXBSTCKVPDOGLENFM D) STCKVPDOGLXBMSTIQFNE E) QIAXBFNESTCKVPDOGLM
a
35. Which of the following statements about a trait showing discrete variation is true? A. It is usually controlled by one (or very few) genes B. It is influenced by the environment C. It is usually controlled by many genes AND is influenced by the environment D. It is usually encoded by genes found near the ends of chromosome arms E. None of the above is correct
a
36. Gene conversion results from a normal DNA repair process in the cell known as: A) Mismatch repair B) Interference C) DNA priming D) DNA duplexing E) Repairase
a
37. You perform a testcross on a double heterozygote with the genotype EeYy. Offspring that are produced from this cross include 36% EeYy, 26% eeYy, 20% Eeyy and 18% eeyy. Calculate the chi square value. A) 7.8 B) 25.8 C) 27.44 D) 74.1 E) 112.8
a
7. The genetic code is called "degenerate". Which of the following best explains this concept? A) Multiple codons can code for the same amino acid B) A single codon can code for multiple amino acids C) A single tRNA can bind to multiple codons D) Multiple tRNAs can be physically bound to the same amino acid E) Mutations of the first nucleotide in a codon will never change the amino acid
a
8. In a segment of the human genome, 23% of the nucleotides are C's. The DNA in humans is double stranded. What fraction of the nucleotides in this segment are A's? A. 27% B. 23% C. 54% D. 77% E. none of the above
a
10. Which of the following RNAs plays a role in RNA processing? A) Transfer RNA B) Small Nuclear RNA C) Micro RNA D) Small cytoplasmic RNA E) Ribosomal RNA
b
11. Two nucleotides are attached to one another other during replication in the following way: A) 5' carbon of the nucleotide in the growing chain is attached to the 3' carbon of the incoming nucleotide by a phosphodiester bond B) 3' carbon of the nucleotide in the growing chain is attached to the 5' carbon of the incoming nucleotide by a phosphodiester bond C) 5' carbon of the nucleotide in the growing chain is attached to the 3' carbon of the incoming nucleotide by a peptide bond D) 3' carbon of the nucleotide in the growing chain is attached to the 5' carbon of the incoming nucleotide by a peptide bond
b
11. tRNA is important to which of the following: A. DNA replication and repair B. Translation C. Transcription D. Translation and transcription E. Cell division (cytokinesis)
b
12. For the following: Is there a cross that would give different phenotypes for males and females? The gene Ruffle ('R') in chickens is dominant and sex linked, and the phenotype can be distinguished from normal in day old chicks. Females are the heterogametic sex in fowl. A. No, not possible B. Yes, 'R-' females to 'rr' males C. Yes, 'R-' males to 'rr' females D. Yes, 'R-' females to Rr males E. Yes, 'r-' females to rr males
b
13. The Hershey-Chase blender experiment was the first to demonstrate: A. Transduction in bacterial cells B. DNA, not protein, is inherited from parental phage C. Protein, not DNA, is transferred (via transformation) to different bacterial cells D. DNA, not protein, is transferred (via transformation) to different bacterial cells E. None of the above
b
14. If we have a chromosome with three loci in which the distance between the loci is as indicated, then the probability of a double cross over is: lz 8.9 mu su 20.8 mu gl A) 0.008 B) 0.019 C) 0.185 D) 29.7 E) 185.0
b
15. Where is the polyadenylation signal located on the eukaryotic primary transcript? A) The promoter B) The 3' UTR C) The 5' UTR D) The branch site E) None of the above
b
17. In the question above, where will the tRNA carrying that amino acid first enter the ribosome in order to add the amino acid to the growing polypeptide chain? A) The exit site B) The aminoacyl site C) The peptidyl site D) Either the aminoacyl site or the peptidyl site E) None of the above
b
18. From the question above, calculate the interference. A) 0.007 B) 0.27 C) 0.73 D) 0.993 E) 9.57
b
19. A type of euploidy includes: A) Monosomy B) Diploidy C) Trisomy D) Downs syndrome E) All of the above
b
2. For the above question, calculate the Chi-square value. A) 0.095 B) 2.59 C) 2.65 D) 325.59 E) 644.8
b
2. To metabolize glucose, a bacterium requires several enzymes that are part of a metabolic pathway. Which of the following is necessary to produce a mature mRNA encoding one of these enzymes? A) A Shine-Delgarno sequence B) A promoter C) RNA processing D) A release factor E) All of the above
b
6. DNA is transformed: A) When a phage integrates into the bacterial chromosome B) By active uptake into competent bacterial cells. C) Into all bacterial cells that have a competence factor plasmid D) Only into bacteria that are F+ E) By means of bacteriophages
b
34. Crossing over occurs during __________________ A. Anaphase of meiosis I B. Anaphase of meosis II C. Prophase of meiosis I D. Prophase of meiosis II E. None of the above
c
20. What is most likely to happen if you try to ligate plasmid DNA that has been digested with the restriction enzyme HglII [5' A|CATCT 3'] to human genomic DNA that has been digested with the restriction enzyme BamH1 [5' G|GATCC 3']? A) The human genomic DNA insert will be ligated successfully to the plasmid DNA since all restriction enzymes recognize and digest the same DNA sequences B) The human genomic DNA fragments will not be ligated into the plasmid DNA due to the sequence incompatibility of the ends C) The human DNA will ligate at the 5' position but not the 3' position D) The human DNA will ligate at the 3' position but not the 5' position E) None of the above, it is impossible to know for sure
b
22. In a species of cricket, genes T and W affect eye color. T = brown eyes, t = white eyes; W = brown eyes, w= white eyes. You expose your crickets to strong UV light and carry out a mutant screen. You find 4 mutants with white eyes. You perform a complementation test using a parent having the genotype TTww and a parent having the genotype ttWW. Here are your results: Mutant 1 Mutant 2 Mutant 3 Mutant 4 TTww Brown eyes Brown eyes White eyes Brown eyes ttWW Brown eyes White eyes Brown eyes White eyes Mutant 1 Brown eyes Brown eyes Brown eyes Mutant 2 Brown eyes White eyes Mutant 3 Brown eyes True or False: Mutant 1 and mutant 3 show noncomplementation A) True B) False C) There is no way of knowing given this data
b
22. Which of the following explains why RNA primase is not a necessary component of the PCR reaction? A) PCR reactions use a modified version of DNA polymerase that can start replicating DNA de novo (i.e., without the creation of short primer sequences) B) Small DNA oligonucleotides that act as primers are added to the PCR reaction C) Each strand of the double helix serves as a primer for the opposite strand D) Only one strand of DNA is used as template, so primers are not necessary E) Actually, RNA primase is a critical component of the PCR reaction
b
23. Based on your results in the previous question, which of the following is a correct statement? A) There are two genes that encode for eye color in crickets B) There are three genes that encode for eye color in crickets C) There are four genes that encode for eye color in crickets D) Alleles from mutant 2 and mutant 3 belong to the same complementation group E) Mutants 1 and mutants 3 have mutations in the same gene
b
23. Transcription termination requires which of the following? A) A stop codon B) Inverted repeats C) A release factor D) A poly-A tail E) A splice site
b
24. If a plant that is heterozygous at five loci is self-fertilized, what is the probability of having an offspring that is homozygous recessive at all five loci? A. .001% B. .098% C. 1.25% D. 23.7% E. None of the above
b
24. RNA processing in eukaryotes includes which of the following? A) A 3' cap, a 5' poly-A tail, removal of introns B) A 5' cap, a 3' poly-A tail, removal of introns C) A 3' cap, a 5' poly-A tail, removal of exons D) A 5' cap, a 3' poly-A tail, removal of exons E) A 5' cap, a 3' poly-A tail, removal of exons, initiation of the 48S subunit
b
26. What type of chemical bonds hold together complementary strands in duplex DNA? A) Electrostatic interactions via gene-for-gene attraction B) Hydrogen bonds C) Phosphodiester bonds D) Polylinker bonds E) None of the above
b
28. In a triploid organism, genes A, C, H and X are all on chromosome #20. Which of the following statements is true? A) A complementation test will tell you if genes A and X are in the same linkage group B) A and H are in the same linkage group C) C and H are NOT in the same linkage group D) A and H show noncomplementation E) A and C show complementation
b
29. __________ refers to a state wherein the heterozygote expresses both alleles and both products are functional, although they may be different. A. Double homozygote B. Co-dominance C. Incomplete dominance D. Dominance E. Hemizygosity
b
3. The most likely mode of inheritance for the affected phenotype in this pedigree is: A. Autosomal dominant B. Autosomal recessive C. X linked recessive D. X linked dominant E. Discontinuous
b
3. You are interested in testing the first law of genetics. You perform a dihybrid cross using two parents who are heterozygous for both genes. You formulate your null hypothesis, assess the offspring phenotypes, and calculate the chi square value: x2 = 2.46. How many degrees of freedom would you use? Would you reject or accept your null hypothesis? A) 1, reject B) 3, accept C) 3, reject D) 4, accept E) 4, reject
b
30. The karyotype of an individual with a genetic abnormality is shown below What syndrome does this person have? A) Down syndrome B) Patau syndrome C) Edward's syndrome D) Anhidrotic ectodermal dysplasia syndrome E) Cri-du-Chat (cat's cry syndrome)
b
31. In the above question, how many Barr bodies would be visible on the cells of this person following treatment with dye? A) 0 B) 1 C) 2 D) 3 E) Impossible to know for sure
b
33. Two auxotrophic strains of E. coli are mixed in liquid medium and plated on complete medium (in other words, the plate has all the nutrients needed for both auxotrophic bacteria to grow), which then serves as a master for replica plating onto six kinds of media. From the position of the clones on the plates and the ingredients in the media, determine the genotype for clone #6. A) thr- leu+ thi+ bio+ phe+ cys+ B) thr+ leu+ thi+ bio+ phe+ cys- C) thr+ leu+ thi+ bio- phe- cys- D) thr+ leu+ thi+ bio+ phe+ cys+ E) thr- leu- thi+ bio+ phe+ cys+
b
34. In a complementation test, noncomplementation results when A) Mutations encoding for the same trait are at different loci B) Mutations encoding for the same trait are at the same locus C) Mutations at different loci encode for different traits D) Mutations encoding for the same trait are part of the same linkage group E) Mutations encoding for the same trait are NOT part of the same linkage group
b
34. What did the Lederberg replica plating experiment demonstrate? A) Exposure to phage leads to the formation of mutations that make bacterial cells more resistant B) Mutations can exist in populations prior to the population being exposed to selective forces C) Exposure to phage leads to the formation of mutations that make bacterial cells more susceptible D) Mutations cannot exist in populations prior to the population being exposed to selective force, it is the selective force that produces the mutations E) Mutations can be picked up through transformation
b
4. Both mitosis and meiosis are preceded by A. Metaphase B. Interphase C. Prophase D. Intraphase E. Anaphase
b
7. What would you expect to happen to the chromosomes in successive cell cycles in a cell linage that had a nonfunctional telomerase? A. Pleiotrophy B. The telomeres would get shorter with each cell division C. The cell would suffer from nondisjunction D. The heterochromatin would replicate E. None of the above
b
9. Below is a picture of an agarose gel. You know that allele 'a' has a much longer DNA sequence than allele 'A', due to a 300 base pair insertion in the 'a' allele. Assume that the DNA for this gene in three different individuals (genotypes AA, Aa, aa) has been independently extracted, purified and subjected to agarose gel electrophoresis. All three molecular phenotypes are given below. Which of the following gels adequately represents the genotype of the individual who is homozygous for the recessive allele (aa)? if negative is up and positive is down... (A) down (B) up (C) both down and up
b
9. You want to perform a RFLP analysis to compare a particular RFLP in your genome to that of a close family member. Which method is your best option? A) DNA denaturation B) Southern blot C) DNA-RNA hybridization D) Restriction mapping E) None of the above would work (PCR would be the only option)
b
1. In sunflowers yellow seeds (G) is dominant over green seeds (g) and tall plants (S) are dominant over short (s). A true breeding yellow, short plant is crossed to a true breeding green tall plant. The F1 offspring that are produced are allowed to self fertilize. In the F2, the following phenotypes were present: 95 green tall, 260 yellow tall, 25 green short, and 100 yellow short. Assuming independent segregation of G and S, what is the expected F2 number of yellow, short phenotypes? A) 30 B) 53.3 C) 90 D) 160 E) 270
c
17. In Drosophila there are 3 sex-linked genes, A, B and C. For each gene, the mutant allele is recessive to the wild-type allele. You perform a cross between females who are heterozygous for these three loci and wild-type males, and you get the following male progeny. Remember: females are the homogametic sex in Drosophila. Male offspring genotype Number of offspring abc 78 a+c 3 ab+ 394 +b+ 4 a++ 32 +bc 27 ++c 402 +++ 60 Estimate the distance between the A and C genes. A) 0.7 map units B) 6.6 map units C) 14.5 map units D) 21.1 map units E) Greater than 50 map units
c
18. Which of the following are not used during PCR? A) DNA Polymerase B) Oligonucleotide Primers C) DNA Ligase D) Double stranded template DNA E) all of the above are needed for PCR
c
19. You are a genetic counselor. A man and a woman come to you and want to know what the probability that their unborn child will have a blistering skin condition - a recessive autosomal hereditary disease. Neither the man nor the woman have the disease, but both of their fathers do. What is the probability that their unborn child will be affected? A. 0% B. 6.25% C. 25% D. 50% E. 100%
c
2. A human female "carrier" who is heterozygous for the recessive, sex-linked trait color blindness marries a male who is red-green color blind. What is the probability that their male progeny will have red-green color blindness? A. 25% B. 33.3% C. 50% D. 75% E. 100%
c
20. Which of the following is a polymorphism in the human genome that is defined as a tandem repeat? A) SSBP B) RFLP C) SSR D) SNP E) EcoR1
c
20. You conduct a tri-hybrid cross between two strains of moth - one with long antennae (AA), a hairy head (SS) and a black body (WW) to a strain having short antennae (aa), a smooth head (ss) and a white body (ww). All of the F1 offspring have long antennae, hairy heads and black bodies. When you perform an F1xF1 cross, what is the probability of having an F2 offspring with long antennae, a smooth head and a black body? Assume normal Mendelian inheritance. A. 1.8% B. 4.7% C. 14.1% D. 42.2% E. 75%
c
22. Which of the following is a single unit, made up of a sugar, a phosphate group, and adenine? A. Nucleic acid B. Nitrogenous base C. Nucleotide D. Base pair E. None of the above
c
23. In meiosis, separation of the sister chromatids occurs during A. Telophase II B. Metaphase II C. Anaphase II D. Anaphase I E. Metaphase I
c
27. Below is the start of a hypothetical protein coding gene. How many amino acids long will the resulting protein be? 5' CGAATGAGGCACCACACCCCCTAA 3' 3' GCTTACTCCGTGGTGTCGGGCATT 5' A. 8 B. 7 C. 6 D. 5 E. None, this is junk DNA
c
27. You are performing a DNA hybridization in the laboratory and you want to decrease the specificity. What do you do to achieve this? A) Decrease the concentration of the probe B) Increase the concentration of the probe C) Decrease the renaturation temperature D) Increase the renaturation temperature E) Increase the amount of radioactivity used on the probe
c
29. You set up a dideoxy sequencing reaction using standard protocol to sequence the single-stranded piece of DNA shown below. 5' ATCATTACTACATAGACCTAGCCGACCCATATATCATAGCCTAATA 3' Although you remembered to add dideoxynucleotide guanine (ddG), you unknowingly forgot to add the normal guanine DNTP when you set up the reaction (this is the only mistake you made). After running your reaction via electrophoresis in the capillaries on a sequencer, you are surprised with the results. What was the longest piece of DNA that you were able to recover? (Note: primers are not shown). A) 5' TA 3' B) 5' TATTA 3' C) 5' TATTAG 3' D) 5' TAG 3' E) 5' TATTAGGCTATGTATATATGGGTCGGCTAGGTCTATGTAGTAATGAT 3'
c
3. In the above question, the bacterium is able to quickly produce ALL of the enzymes needed for the metabolic pathway because the mRNA is ____________________ A) The pre-mRNA B) Polymorphic C) Polycistronic D) Enhanced by elongation factors E) A polysome
c
32. Two parents with blood types A and B have a child who has O blood type. What is the chance that their next child will have blood type B? A. 0% B. 12.5% C. 25% D. 50% E. 100%
c
33. You perform an experiment and calculate a chi square statistic. The P value is equal to 0.35. How would you interpret this P value? A) There is a 35% chance that the null hypothesis is correct B) There is a 35% chance that the null hypothesis is incorrect C) There is a 35% probability that the critical value would have been as bad (or worse) just due to chance alone D) There is a 35% probability that the critical value would not have been as bad (or worse) just due to chance alone E) You would use the P value and the degrees of freedom to look up your critical value
c
35. Which of the following is the best description for the PARp region of a chromosome? A) It is the short arm of a sex chromosome that has a pericentric inversion (pericentric arm region) B) It is the short arm of a autosome that has a pericentric inversion (pericentric arm region) C) It is the short arm of a sex chromosome that has a very high rate of crossing over and recombination D) It is the long arm of a sex chromosome that has a very high rate of crossing over and recombination E) It is the long arm of a sex chromosome that has a pericentric inversion (pericentric arm region)
c
36. An affected woman who is a heterozygote for an autosomal dominant trait is pregnant with a son. What is the probability that the son will be affected given that the dominant allele shows 60% penetrance? A. 0% B. 25% C. 30% D. 50% E. 75%
c
4. Which enzyme is responsible for relieving the torsional stress caused by helix unwinding during DNA replication? A) Ligase B) Helicase C) Gyrase D) SSB E) RPA
c
5. Which of the following double stranded DNA segments having 100 base pairs would require more energy to separate? The strand containing: A. 25% A, 25% T, 25% C, 25% G B. 20% A, 20% T, 30% C, 30% G C. 10% A, 10% T, 40% C, 40% G D. 50% A, 50% T E. They would all require the same amount of energy
c
6. You cross two mice, both of which are double heterozygous and have brown fur and long tails. Brown (Y) is dominant to yellow fur (y) and long tails (T) are dominant to short tails (t). What is the probability that they will have four offspring that includes two offspring with brown fur and long tails and two offspring with yellow fur and long tails? A. 56.3% and 18.8% B. 1.1% C. 6.7% D. 19.8% E. 35.2%
c
7. Knowing what you know about the consequences of recombination within an inversion loop, how many normal, inverted, dicentric and acentric chromosomes would be generated from the meiosis of a pericentric inversion heterozygote if there is a single crossover? A) 1, 1, 1, 1 B) 2, 2, 0, 0 C) 1, 1, 0, 0 D) 0, 0, 2, 2 E) 2, 2, 2, 2
c
9. A couple had a phenotypically normal son who, upon inspection of his chromosomes, was actually XYY in his chromosome constitution. In which parent, and at what meiotic division, could the nondisjunction causing this constitution have happened? A) Mother, first meiotic division B) Mother, second meiotic division C) Father, second meiotic division D) Father, first meiotic division E) Neither, this had to have occurred in the son after cell division
c
1. A single, human cell has _______ number of chromosomes after the first meiotic division and the cell is considered ________ A. 22, haploid B. 46, haploid C. 46, diploid D. 23, haploid E. 46, pleiotrophic
d
1. Which of the following statements about bacterial conjugation is incorrect? A) F+ cells act as genetic donors B) Genes on the F factor encode proteins for cell-cell contact and the formation of sex pili C) F+ cells can convert F- cells into F+ cells D) F' cells have especially high rates of recombination E) The F factor is transferred as a single strand
d
11. Which of the following statements regarding promoters is NOT true? A) The promoter region is not transcribed B) The promoter region is not translated C) The closer the promoter region is to the consensus (the more conserved it is), the stronger the promoter D) A missing promoter leads to a problem with ribosomal binding E) Eukaryotic promoters contain a TATA box near the -25 position
d
13. Given the following mRNA sequence (below), what was the sequence of the template DNA? Was the template DNA the sense or antisense strand? mRNA 5' AUCCGUACAUCGUUC 3' A) 5' TAGGCATGTAGCAAG 3'; sense B) 5' CTTGCTACATCGGTA 3'; sense C) 5' TAGGCATGTAGCAAG 3'; antisense D) 5' GAACGATGTACGGAT 3'; antisense E) 5' GAACGATGTACGGAT 3'; sense
d
13. Imagine a zygote replicates all of its DNA and then fails to divide. Some time later it replicates all of its DNA again and then divides normally throughout development. What would be the end result? A) Sexual autopolyploidation B) Asexual autopolyploidation C) Sexual allopolyploidation D) Asexual allopolyploidation E) Aneuploidism
d
14. The generally negative effects caused by inbreeding are due to: A. an increase in the mutation rate B. an increase in genetic variability that disrupts developmental sequences C. an increase in allozygosity of all alleles D. an increase in homozygosity of recessive deleterious alleles E. none of the above
d
17. During DNA replication, each strand acts as a ________ for the generation of new _____________. A. Replicate, complimentary strand B. Template, identical strand C. Origin, double helix D. Template, complimentary strand E. Primer, mRNA transcript
d
18. If an affected male has all affected daughters and no affected sons, the trait is likely to be: A. Autosomal recessive B. X linked recessive C. Autosomal dominant D. X linked dominant E. Y linked
d
21. Wing patch color in one species of bird is controlled by incompletely dominant alleles so that bright orange and white are homozygous, while peach is heterozygous. The cross of two peach individuals will produce A. All peach offspring B. Equal numbers of white and orange winged offspring, but no peach offspring. C. Equal numbers of orange, peach and white winged offspring. D. Equal numbers of white and orange winged offspring, and twice as many peach winged offspring as the other two colors. E. Equal numbers of orange and white winged offspring.
d
21. You perform a dihybrid cross between two heterozygotes. The resulting offspring are not in the expected 9:3:3:1 phenotypic ratio, but instead have a modified dihybrid ratio of 12:3:1. What could cause this? A) A homozygous recessive mutation in either or both of two different genes results in the same mutant phenotype B) Homozygosity for a recessive allele with respect to one gene masks the expression of the genotype of a different gene. C) Homozygosity for a recessive allele of either of two genes results in the same phenotype but the phenotype of the double homozygote is distinct D) The presence of a dominant allele of one gene masks the genotype of a different gene. E) Homozygosity for a dominant allele of either of two genes results in the same phenotype but the phenotype of the double homozygote is distinct
d
24. 10 gigabases is equivalent to how many kilobases? A) 0.01 B) 1000 C) 1000000 D) 10000000 E) 10000000000
d
25. From the pedigree shown below, calculate the probability that individual IV-4 will have 3 affected sons if individual IV-4 marries an unaffected person (assume the disorder is rare). A. 0% B. 1.6% C. 6.25% D. 12.5% E. 50.0%
d
26. Amino acids always have: A) Positively charged side groups B) Negatively charged side groups C) Hydrophobic (non-polar) side groups D) A carboxyl group E) Side groups containing sulfur atoms
d
28. For an octoploid (8N) organism, meiosis results in the production of A. two 8N cells B. four 8N cells C. two 4N cells D. four 4N cells E. eight 2N cells
d
30. You cross two P1 hamsters, each of which are heterozygous for three genes (BbDdFf). All three genes display complete dominance and assort independently. The parental hamsters all have big ears (Bb), dark coats (Dd) and full tails (Ff). What is the probability that an offspring will have a phenotype that is different in some way from that of the parents? A. 1.6% B. 15.7% C. 43.9% D. 57.8% E. 71.9%
d
32. If the primary transcript of a eukaryote fails to gain a poly-A tail, what will be the consequence? A) The RNA is less likely to be transported out of the nucleus B) The RNA is more likely to be degraded by exonucleases C) The RNA is less likely to be translated D) All of the above E) None of the above
d
33. The process by which a single strand of DNA is used as a template to build a complementary daughter strand is called (what?) A. Transcription B. Translation C. Mitosis D. Replication E. Meiosis
d
36. Which of the following is a bacterial plasmid that carries a chunk of bacterial chromosomal DNA? A) Hfr B) Cointegrate C) F- D) F' E) None of the above
d
4. Assume that you are trying to amplify a single gene on a piece of single stranded DNA. After 5 rounds of PCR how many copies would you have (again, assume you started with a single strand of DNA)? A) 5 B) 10 C) 25 D) 32 E) 64
d
5. Which of the following allows a transposable element to cut itself out of the genome and paste itself into a new location? A) DNA Polymerase B) Transposase C) Terminal Inverted Repeats D) B and C E) All of the above
d
5. You have a plant with an unknown genotype, but you are interested in the heredity of two linked genes: one gene has alleles W (red flowers) and w (white flowers) and the other gene has alleles F (smooth leaves) and f (fuzzy leaves). You perform a test cross with your unknown plant and produce the following progeny: Phenotype Number of offspring Red flowers, fuzzy leaves 18 Red flowers, smooth leaves 136 White flowers, fuzzy leaves 112 White flowers, smooth leaves 9 What can you determine about the unknown parents genotype? A) Trans conformation, Wf/WF B) Cis conformation, Wf/Wf C) Trans conformation, WF/wf D) Cis conformation, WF/wf E) Trans conformation, Wf/wF
d
6. A chromosome with a centromere near the center is called A) Acrocentric B) Mesocentric C) Acentric D) Metacentric E) Submesocentric
d
8. This sugar is: A) A phosphodiester B) A nucleotide sugar C) An amino sugar D) A deoxyribose sugar E) A ribose sugar
d
10. The most common form of color blindness in human beings results from X-linked recessive alleles. One type of allele, call it cbr, results in defective red perception, whereas another type of allele, call it cbg, results in defective green perception. A woman who is heterozygous cbr/cbg and a normal male produce a son whose chromosome constitution is XXY. What is the genotype of the gamete that produced this boy if nondisjunction took place in the cbr-bearing chromosome in meiosis II of the mother? A. cbr B. cbr cbg C. cbg cbg D. cbg E. cbr cbr
e
12. Chromosomal abnormalities may include duplicated or deleted gene regions. Which of the following is a result of a deleted chromosomal region? A) Downs syndrome B) Patau syndrome C) Edward's syndrome D) Klinefelters E) Cri-du-chat
e
15. The arrow in this picture is pointing to _________ A. The gene rich euchromatin B. The gene rich heterochromatin C. The gene rich centromere D. The gene poor euchromatin E. The gene poor heterochromatin
e
25. Which of the following best describes dosage compensation between the sexes in humans? A) A gene is translated from a long strand of RNA that is called the Xic, the gene product silences one X chromosome B) A gene is translated from a long strand of RNA that is called the Xist, the gene product silences one X chromosome C) A long strand of RNA is translated from a region called Xic, the RNA silences one X chromosome D) A long strand of RNA is transcribed from the Y chromosome, the RNA silences one X chromosome E) A long strand of RNA is transcribed from a region called Xist, the RNA silences one X chromosome
e
26. Two pure breeding plants for round and wrinkled seeds (respectively) are crossed to produce F1 offspring with round seeds. The F1s are crossed to produce 112 plants with round seeds and 38 plants with wrinkled seeds. If you did a testcross with the 112 plants that produced round seeds, what proportion of those plants would you expect to produce some offspring with wrinkled seeds? A. 1/16 B. 1/4 C. 1/3 D. 1/2 E. 2/3
e
27. In the Meselson-Stahl experiment, which result provided convincing evidence of the semi-conservative replication of DNA? A) After the first round of DNA replication, all of the DNA was of an intermediate density B) After the first round of DNA replication, half of the DNA was light and half was heavy C) After the second round of DNA replication, all of the DNA was of an intermediate density D) After the second round of DNA replication, half of the DNA was heavy and half was light E) After the second round of DNA replication, half of the DNA was intermediate and half was light
e
28. A mutation involving the substitution of a cytosine to a guanine is called a ____________? A) Frameshift mutation B) Insertion mutation C) Transition D) Transformation E) Transversion
e
30. A mutation that results in reduced gene expression or activity of a product is best classified as a ________ mutation A) Semiconservative B) Loss-of-function C) Hypermorphic D) Heteromorphic E) Hypomorphic
e
31. During translation, a ____________ bond is formed between amino acids and is catalyzed by ___________. A) covalent/peptidyl transferase B) amino/aminoacyl-tRNA synthetase C) amino/peptidyl tranferase D) peptide/aminoacyl-tRNA synthetase E) peptide/peptidyl transferase
e
31. The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be _____________ A. 5'-GGUUACAUUC-3' B. 5'-CCAATGTAAG-3' C. 5'-CUUACAUUGG-3' D. 5'-CCTTUGUTTG-3' E. 5'-GAATGTAACC-3'
e
32. In an experiment, you are interesting in two genes: W and R. The results of your experiment indicate a recombination frequency of 54.2%. What should you conclude from this? A) There are 54.2 cM between genes W and R B) There are .542 cM between genes W and R C) There are 5.42 cM between genes W and R D) The interference between genes W and R is .458 E) The two genes may be on two separate chromosomes
e
37. All DNA is stored in the nucleus as __________________ A. Euchromatin; DNA wrapped around protein complexes called nucleosomes B. Heterochromatin; DNA wrapped around protein complexes called nucleosomes C. Chromatin; DNA wrapped around protein complexes called H1 histones D. Euchromatin; DNA wrapped around proteins called H1 histones E. Chromatin; DNA wrapped around protein complexes called nucleosomes
e
8. Which of the following prevents a restriction enzyme from digesting the host bacterial genome? A) Acetylation of histones in the bacterial DNA B) Oxidation of guanine residues on the bacterial DNA C) Addition of 7-methylguanosine to the bacterial DNA D) Phosphorylation of each DNA strand of the bacterial chromosome E) Methylation of the bacterial DNA
e
