Genetics practice questions

In a random sequence containing equal proportions of all 4 nucleotides, what is the probability that a particular short sequence of nucleotides matches a restriction site for a restriction enzyme with a 4-base cleavage site?

(0.25)^4

Below is a picture of an agarose gel. You know that allele 'a' has a much longer DNA sequence than allele 'A', due to a 300 base pair insertion in the 'a' allele. Assume that the DNA for this gene in three different individuals (genotypes AA, Aa, aa) has been independently extracted, purified and subjected to agarose gel electrophoresis. All three molecular phenotypes are given below. Which of the following gels adequately represents the genotype of the individual who is homozygous for the recessive allele (aa)? if negative is up and positive is down... (A) down (B) up (C) both down and up

(B) up

In the pedigree below, the female I-1 is heterozygous for a mutant gene M that increases the risk of a certain disease from 5 percent observed among mm genotypes to 50 percent in Mm. The M allele is associated with the larger DNA band in the gel (the band nearer the top). The male I-2 is homozygous mm for the non-mutant form of the gene, and the m allele is associated with the smaller DNA band (the one neared the bottom). Their daughter II-1 has the disease. What is the probability that II-1 has the genotype Mm?

0.909

In the absence of recombination, what ratio of phenotypes is expected in the progeny of the cross aB/Ab x AB/ab?

1 aaB- : 2 A-B- : 1 A-bb

Mutations can fit into three main types

1. Chromosome mutations• Changes in chromosome structure2. Genome mutations• Changes in chromosome number3. Single-gene mutations• Relatively small changes in DNA structure that occur within a particular gene

If a recombination frequency between 2 genes is 1.5%, what is the distance between the genes in map units on the linkage map?

1.5

If a recombination frequency between two genes is 1.5%, what is the distance between the genes in map units on the linkage map?

1.5

In a trihybrid cross between WwGgPp x WwGgPp what is the proportion of WwGGPp

1/16

Assuming equal numbers of boys and girls, if a mating has already produced a girl, what is the probability that the next child will be a boy? If a mating has already produced two girls, what is the probability that the next child will be a boy?

1/2

Assuming equal sex ratios, if a mating has already produced 3 girls, what is the probability that the next child will be a girl? A. 0 B. 1 C. 1/2 D. (1/2)^3 E. 1-(1/2)^3

1/2

In pedigree analysis of patterns of transmission of dominant genes, the chance of the offspring is infected with the genetic disease is: A) 1 B) 1/2 C) 1/4 D) not infected, all offsprings are carriers

1/2

In the accompanying pedigree the filled square represent individuals affected with X-linked recessive Duchenne muscular dystrophy. What is the probability that the woman III-3 is a heterozygous carrier

1/2

Starting with a cross between AA and aa the proportion of heterozygotes in the F2 will be what?

1/2

Starting with a cross between AA and aa, the proportion of heterozygotes in the F2 progeny will be A. 1/8 B. 1/4 C. 1/3 D. 1/2 E. All heterozygotes

1/2

How many completes turns does a double-stranded molecule with 100,000 base pairs undergo?

10,000There are 1o base pairs in a complete turn

What is the level of the lav operon expression in the genotypes shown below? lacO-

100

Starting with a cross between AA and aa, the proportion of heterozygous in the F1 progeny will be

100%

One thousand kilobase pairs equals what?

10^6 bp

In domesticated chickens, a dominant allele C is required for colored feathers, but a dominant allele I of an unlinked gene is an inhibitor of color that overrides the effects of C. White Leghorns have genotype CC II whereas White Wyandottes have genotype cc ii. Both breeds are white, but for different reasons. In the F2 generation of a cross between White Leghorns and White Wyandottes, what is the phenotypic ratio of white : colored?

13:3

What percentage of recognized pregnancies in humans terminate in spontaneous abortion?

15

What is the probability that in a family of 6 children, 4 will be male and 2 female?

15/64

Somatic cells of a deer species, normally have 32 chromosomes. What is the number of chromosomes present in the nucleus in telophase 2 of meiosis?

16

30S subunit of prokaryotic ribosome contains _______ rRNA

16S

Two reciprocal crossovers will appear in the progeny in approximately what ratio?

1:1

In dihybrid testcross, the offspring ratio of four different phenotypes is

1:1:1:1

Snapdragon is a plant shows incomplete dominance. The flower color of the plant is controlled by a single gene. The phenotypic ratio of F2 generation will be

1:2:1

How many replication forms are produced when DNA denatures at an origin?

2

In a lariat, which is an intron intermediate, an adenine and guanine are linked by ____

2' to 5' phosphodiester bond

Genes ho and dp are 9.0 map units apart and genes dp and da are 26.3 map units apart. In the absences of interference, what is the probability of a double crossover in these regions?

2.4%

Genes ho and dp are 9.0 map units apart, and genes dp and da are 26.3 map units apart (gene order is ho - dp - da). In the absence of interference, what is the probability of a double crossover in these regions?

2.4%

Below is the genetic map of linked gene A and B. An individual has the genotype aB/Ab. What is the proportion of AB gametes that this individual produces?

2.5%

How many nucleotides does a double-stranded molecule with 100,000 base pairs contain?

200,000There are 2 nucleotides per base pair

The Drosophila genes for white eyes (w), cut wings (ct) and tan body (t) lie at map positions 1.5, 20.0 and 27.5, respectively. Out of 576 progeny, 6 are double crossovers. What is the degree of interference?

25.0%

In a random sequence containing equal proportions of all 4 nucleotides, what is the average distance between consecutive occurrences of the restriction sites for the Hinf I 5'-G (arrow) ANTC-3', where N is any nucleotide and the arrow is a cleavage site?

256 bp

A sample of DNA contains 24% thymine. What would be the percentage of guanine in the sample

26%

Given the following DNA strand, which of the following is its complementary mRNA? 5' - GGACTGATT - 3'

3' - CCUGACUAA

In tRNA, an amino acid becomes attached to the________

3' end of tRNA

Somatic cells of a plant, normally have 60 chromosomes. What is the number of chromosomes present in the nucleus in telophase 2 of meiosis?

30

In chromatin, nucleosomes coil to form higher order DNA structure, contains 6 nucleosomes per turn, is known as the

30 nm fiber

In eukaryotic chromosome, the second level of compaction is the formation of

30 nm fiber

When the base composition of double-stranded DNA from a new species of bacteria was determined, 20% of the bases were found to be adenine. What % of cytosine would be found in the DNA? a. 10% b. 20% c. 30% d. 35% e. 40%

30%

Assuming independent assortment, how many different gametes can be formed by an organism that is homozygous for 3 genes and heterozygous for 2? A. 2 B. 4 C. 3^2 D. 5 E. 6

4

Eukaryotic ribosome is composed of ______

40S and 60S subunits

DNA synthesis proceeds by the elongation of primer chains, always in the

5' to 3' direction

During replication, the direction of synthesis of new DNA from the leading and lagging strands is what?

5' to 3' only

The sequence of one strand of DNA is 5'-GCTTTAG-3'. The sequence of the complementary strand would be

5'-CTAAAGC

The sequence of one strand of DNA is 5'-GCTTTAG-3'. The sequence of the complementary strand would be what?

5'-CTAAATC-3'

In addition to their ability to polymerize nucleotides, most DNA polymerases also can function as

5'-to-3' exonucleases

The maximum recombination frequency between 2 genes is what?

50%

In the Meselson-Stahl experiment, what was the density distribution of the isolated DNA molecules two generations after shifting bacteria from "heavy" to "light" growth medium?

50% were of light density, 50% were intermediate density

A dihybrid cross SS tt x ss TT is made in which S is dominant, but there is no dominance between T and t. Assuming independent assortment, how many phenotype classes are expected in the F2? A. 2 B. 3 C. 4 D. 5 E. 6

6

In Neurospora, the following tetrads were obtained for gene A near the centromere. What is the distance in map units of A from the centromere?AAaa 131aaAA 127AaAa 23aAaA 19Total 300

7

In eukaryotes, initial binding of mRNA to ribosome requires _______

7 - methylquanosine cap (5' cap)

In a cell in which 2n = 6, the independent assortment of chromosomes during meiosis can by itself give rise to ________ genetically different gametes.-

8

A normal chromosome contains all but which of the following?1 centromere8 telomeres9 histones per nucleotideSatellite DNAHeterochromatin

8 telomeres

What is the level of the lav operon expression in the genotypes shown below? lacI-

<1

A cigarette butt found at the scene of a robbery is found to have a sufficient number of epithelial cells stuck to the paper that DNA can be extracted and analyzed by DNA typing. Showne here are the results of typing for three probes (locus 1- locus 3) of the evidence (X) and cells from seven suspects (A-G). Which cannot be excluded?

A

n the deoxyribonucleotide shown below, which carbon atom carries the 3' hydroxyl group?

A

purines

A & G with a double ring structure

A peptide bond is formed between ________

A carboxyl group of a growing peptide chain and an amino group of an amino acid being added

Bivalent

A pair of homologous chromosomes

In DNA replication, the lagging strand is

A single DNA strand synthesized in short fragments that are ultimately joined together

What do restriction enzymes recognize?

A single site.

The difference between a cis-acting regulatory element and a trans-acting regulatory element that________

A trans element is diffusible while a cis element is not

In a particular plant, leaf color is controlled by gene locus D. Plants with at least one D allele have dark green leaves, and plants with the homozygous recessive dd genotype have light green leaves. A true-breeding dark-leaved plant is crossed with a light-leaved one, and the F1 offspring is allowed to self-pollinate. The predicted outcome of the F2 is diagrammed in the Punnett square shown in the figure above, where 1, 2, 3, and 4 represent the genotypes corresponding to each box within the square. Which of the plants will be true-breeding?(Punnett square Dd x Dd) A) 1 and 4 only B) 2 and 3 only C) 1, 2, 3, and 4 D) 1 only

A) 1 and 4 only

A plantlike organism on the planet Pandora can have three recessive genetic traits: bluishleaves, due to an allele (a) of gene A; a feathered stem, due to an allele (b) of gene B; and hollowroots, due to an allele (c) of gene C. The three genes are linked and recombine.A geneticist did a testcross with an organism that had been found to be heterozygous for thethree recessive traits and was able to identify progeny of the phenotypic distribution (+ = wildtype) shown in the figure below.In which progeny phenotypes has there been recombination between genes A and B? The parentphenotypes are 4 and 8. A) 1, 2, 5, and 6 B) 1, 3, 6, and 7 C) 2, 4, 5, and 8 D) 2, 3, 5, and 7

A) 1, 2, 5, and 6

You perform a testcross on a double heterozygote with the genotype EeYy. Offspring that are produced from this cross include 36% EeYy, 26% eeYy, 20% Eeyy and 18% eeyy. Calculate the chi square value. A) 7.8 B) 25.8 C) 27.44 D) 74.1 E) 112.8

A) 7.8

In the human species, all somatic cells have 46 chromosomes. Which of the following can also be true?A) A plant species (privet shrubs) has 46 chromosomes per cell. B) Some adult humans have 69 chromosomes per cell. C) Some adult humans have 23 chromosomes per cell. D) A certain fungal species has only one chromosome per cell. E) A certain bacterial species has 23 chromosomes.

A) A plant species (privet shrubs) has 46 chromosomes per cell.

Which of the following individuals will have the MOST trouble producing functional gametes during meiosis? A) A triploid with a genome of 8 chromosomes B) A diploid with a genome of 1 chromosome C) A diploid with a genome of 23 chromosomes D) A tetraploid with a genome of 13 chromosomes E) A tetraploid with a genome of 48 chromosomes

A) A triploid with a genome of 8 chromosomes

Which of the following happens at the conclusion of meiosis I? A) Homologous chromosomes are separated. B) The chromosome number per cell is conserved. C) Sister chromatids are separated. D) Four daughter cells are formed. E) The sperm cells elongate to form a head and a tail end.

A) Homologous chromosomes are separated.

For the following question, match the key event of meiosis with the stages listed below.I. Prophase I V. Prophase IIII. Metaphase I VI. Metaphase IIIII. Anaphase I VII. Anaphase IIIV. Telophase I VIII. Telophase II 39) Synaptonemal complexes form or are still present. A) I only B) I and IV only C) I and VIII only D) II and VI only E) I, II, III, and IV only

A) I only

If a cell has completed the first meiotic division and is just beginning meiosis II, which of the following is an appropriate description of its contents? A) It has half the amount of DNA as the cell that began meiosis. B) It has the same number of chromosomes but each of them has different alleles than another cell from the same meiosis. C) It has half the chromosomes but twice the DNA of the originating cell. D) It has one-fourth the DNA and one-half the chromosomes as the originating cell. E) It is identical in content to another cell from the same meiosis.

A) It has half the amount of DNA as the cell that began meiosis.

Phenylketonuria (PKU) is a disease in humans that results from the abnormal metabolism of the amino acid phenylalanine. If untreated, it can lead to severe brain damage in infants. Two normal parents have a child who has PKU. What can you determine about the inheritance of the PKU allele from this information? A) It is recessive. B) It is dominant. C) It is pleiotropic. D) It is epistatic.

A) It is recessive.

The genetic code is called "degenerate". Which of the following best explains this concept? A) Multiple codons can code for the same amino acid B) A single codon can code for multiple amino acids C) A single tRNA can bind to multiple codons D) Multiple tRNAs can be physically bound to the same amino acid E) Mutations of the first nucleotide in a codon will never change the amino acid

A) Multiple codons can code for the same amino acid

What amino acid does this short segment of DNA encode for? 5' CGG 3' A) Pro B) Arg C) Gly D) Ala E) None of the above

A) Pro

Which of the following statements correctly describes gene linkage? A) The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them. B) The observed frequency of recombination of two genes that are far apart from each other has a maximum value of 100%. C) Linked genes always assort independently .D) Linked genes are found on different chromosomes

A) The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them.

Map units on a linkage map cannot be relied upon to calculate physical distances on a chromosome for which of the following reasons? A) The frequency of crossing over varies along the length of the chromosome. B) The relationship between recombination frequency and map units is different in every individual. C) Physical distances between genes change during the course of the cell cycle. D) The gene order on the chromosomes is slightly different in every individual.

A) The frequency of crossing over varies along the length of the chromosome.

Which of the following statements correctly describes one difference between the law of independent assortment and the law of segregation? A) The law of independent assortment explains the segregation of two or more genes relative to one another. B) The law of segregation explains the segregation of two or more genes relative to one another. C) The law of segregation requires having two or more generations to describe. D) The law of segregation is accounted for by anaphase of mitosis.

A) The law of independent assortment explains the segregation of two or more genes relative toone another.

Two autosomal genes have a recombination frequency of 16%. Which of the following conclusions can be drawn regarding these genes? A) The two genes are closely linked on the same chromosome. B) The two genes are linked but on different chromosomes. C) Recombination between these two genes cannot occur in the cell during meiosis .D) The genes are located on the X chromosome.

A) The two genes are closely linked on the same chromosome.

What does a frequency of recombination of 50% between two genes indicate? A) The two genes are likely to be located on different chromosomes. B) All of the offspring have combinations of traits that match one of the two parents. C) The genes are located on sex chromosomes. D) Independent assortment of the two genes will not occur.

A) The two genes are likely to be located on different chromosomes.

Transduction changes a bacterium when: A) There is a double crossover between the DNA injected by a transducing phage and the bacterial chromosome B) A phage integrates into the bacterial chromosome C) A phage integrates into the bacterial chromosome and then excises itself D) A phage cannot switch to the lysogenic lifestyle E) Fragments of DNA from a dead cell are picked up by another cell

A) There is a double crossover between the DNA injected by a transducing phage and the bacterial chromosome

Tandem duplications of short segments of DNA are often found in the genomes of organisms. These are thought to be caused by A) Unequal crossing over B) Transversions C) Inversions D) Reciprocal translocations E) Gene conversions

A) Unequal crossing over

A fragment of pre-mRNA containing a noncoding region is shown below. Given this information, do you think that the noncoding portion of this pre-mRNA will be removed properly (choose the best possible answer). A) Yes, this segment will likely be removed properly B) No, the 5' splice site has a mutation that will prevent excision C) No, the 5' splice site has a mutation that will prevent excision D) No, the branch site has a mutation that will prevent excision E) No, the pyrimidine rich area should be on the other side of the branch point, closer to the 5' splice site

A) Yes, this segment will likely be removed properly

A fragment of pre-mRNA containing a noncoding region is shown below. Given this information, do you think that the noncoding portion of this pre-mRNA will be removed properly (choose the best possible answer). A) Yes, this segment will likely be removed properly B) No, the 5' splice site has a mutation that will prevent excision C) No, the 5' splice site has a mutation that will prevent excision D) No, the branch site has a mutation that will prevent excisionE) No, the pyrimidine rich area should be on the other side of the branch point, closer to the 5' splice site

A) Yes, this segment will likely be removed properly

Which of the following might result in a human zygote with 45 chromosomes? A) an error in either egg or sperm meiotic anaphase B) failure of the egg nucleus to be fertilized by the sperm C) fertilization of a 23 chromosome human egg by a 22 chromosome sperm of a closely related species D) an error in the alignment of chromosomes on the metaphase plate E) lack of chiasmata in prophase I

A) an error in either egg or sperm meiotic anaphase

If an organism is diploid and a certain gene found in the organism has 18 known alleles (variants), then any given organism of that species can/must have which of the following? A) at most, 2 alleles for that gene B) up to 18 chromosomes with that gene C) up to 18 genes for that trait D) a haploid number of 9 chromosomes E) up to, but not more than, 18 different traits

A) at most, 2 alleles for that gene

How does the sexual life cycle increase the genetic variation in a species? A) by allowing crossing over B) by allowing fertilization C) by increasing gene stability D) by conserving chromosomal gene order E) by decreasing mutation frequency

A) by allowing crossing over

The centromere is a region in which A) chromatids remain attached to one another until anaphase. B) metaphase chromosomes become aligned at the metaphase plate. C) chromosomes are grouped during telophase. D) the nucleus is located prior to mitosis. E) new spindle microtubules form at either end.

A) chromatids remain attached to one another until anaphase.

The human genome is minimally contained in which of the following? A) every human cell B) each human chromosome C) the entire DNA of a single human D) the entire human population E) each human gene

A) every human cell

Meiosis II is similar to mitosis in that A) sister chromatids separate during anaphase. B) DNA replicates before the division. C) the daughter cells are diploid. D) homologous chromosomes synapse. E) the chromosome number is reduced.

A) sister chromatids separate during anaphase.

Independent assortment of chromosomes is a result of A) the random and independent way in which each pair of homologous chromosomes lines up at the metaphase plate during meiosis I. B) the random nature of the fertilization of ova by sperm. C) the random distribution of the sister chromatids to the two daughter cells during anaphase II. D) the relatively small degree of homology shared by the X and Y chromosomes. E) the random and independent way in which each pair of homologous chromosomes lines up at the metaphase plate during meiosis I, the random nature of the fertilization of ova by sperm, the random distribution of the sister chromatids to the two daughter cells during anaphase II, and the relatively small degree of homology shared by the X and Y chromosomes.

A) the random and independent way in which each pair of homologous chromosomes lines up at the metaphase plate during meiosis I.

Cells that are in a nondividing state are in which phase? A) G0 B) G2 C) G1 D) S E) M

A)G0

If after several rounds of artificial selection all alleles affecting the trait are fixed or lost, the narrow-sense heritability of a trait is A. 0 B. 0.5 C. 1 D. 2 E. Undeterminable

A. 0

The probability that each of four children in a family will be male is A. 1/16 (0.062) B. 1/4 (0.25) C. 1/2 (0.50) D. 1/64 (0.016) E. 1/8 (0.125)

A. 1/16 (0.062)

In a segment of the human genome, 23% of the nucleotides are C's. The DNA in humans is double stranded. What fraction of the nucleotides in this segment are A's? A. 27% B. 23% C. 54% D. 77% E. none of the above

A. 27%

If a eukaryotic chromosome was composed of 20% adenine, how much cytosine should theoretically be present in that same chromosome? A. 30% B. 20% C. 60% D. 40% E. 10%

A. 30%

A population in Hardy-Weinberg proportion is found to have a population frequency for albinism of 0.09. Given albinism is recessive, what percentage of the population is expected to be albino? A. 9% B. 8.1% C. 0.09% D. 0.81% E. 0.91%

A. 9%

Which of the following is NOT consistent with Erwin Chaffe's findings? A. A + T = G + C B. A + G = T + C C. A + C = G + T D. A + C/G + T = 1 E. A = T

A. A + T = G + C

Which of the following is true regarding the machinery of translation? A. A single mRNA can be translated simultaneously by multiple ribosomes. B. Polycistronic mRNA usually has a single ribosome binding site. C. tRNAs released from the ribosome are degraded. D. Termination in eukaryotes requires three release factors.

A. A single mRNA can be translated simultaneously by multiple ribosomes.

mating 2 organisms produces a 3:1 ratio of the phenotype in progeny; the parental genotypes are A. Aa Aa B. Aa aa C. AA aa D. AA AA E. aa aa

A. Aa Aa

Mating of two organisms produces a 1:1 ratio of phenotypes in the progeny. What are the parental genotypes? A. Aa aa B. Aa aa C. AA aa D. AA AA E. aa aa

A. Aa aa

The variance calculated from a distribution of phenotypes equals zero when (Think Carefully) A. All individuals have the same phenotype B. The standard deviation equals one C. Approximately 50% of the population has the same phenotype D. All individuals have different phenotype

A. All individuals have the same phenotype

Which of the following features of a protein structure is most directly determined by the DNA?A. Amino acid sequence B. Shape C. Subunit composition (quaternary structure) D. Catalytic or structural role

A. Amino acid sequence

Which site of the tRNA molecule binds to the mRNA molecule? A. anticodon B. codon C. 3' end of tRNA D. 5' end of tRNA

A. Anticodon

Histone proteins contain high amounts of amino acids __________ A. Arginine and Lysine B. Glutamic acid and aspartic acid C. glycine and alanine D. tyrocine and phenylalanine E. cysteine and methionine

A. Arginine and lysine

Sister chromatids in a replicated chromosome that is ready to enter mitosis are held together at a specific region of the chromosome called the A. Centromere B. Mitotic spindle C. Centrosome D. Chiasma

A. Centromere

The questions below consist of five phrases or sentences concerned with the cell cycle. For each one, select the answer below that is most closely related to it. Each answer may be used once, more than once, or not at all. A. G0 B. G1 C. S D. G2 E. M 20) Nerve and muscle cells are in this phase.-

A. G0

Which of the following statements about a trait showing discrete variation is true? A. It is usually controlled by one (or very few) genes B. It is influenced by the environment C. It is usually controlled by many genes AND is influenced by the environment D. It is usually encoded by genes found near the ends of chromosome arms E. None of the above is correct

A. It is usually controlled by one (or very few) genes

After which stage or phase of the cell cycle does cytokinesis occur? A. M phase B. G1 C. G2 D. S E. G0

A. M phase

The coupling relationship or phase (coupling or repulsion) of alleles in a doubly heterozygous parent is detectable as the A. Most frequent type of gametes B. Lowest incidence of crossing over C. Largest number of map units between corresponding alleles D. Highest frequency of recombination

A. Most frequent type of gametes

Which of the following is a categorical trait? A. Number of ears on a stalk of corn B. Milk production in cows C. Yield in soybean acreage D. Growth rate of a line of turkey E. Blood pressure

A. Number of ears on a stalk of corn

The mold used by Beadle and Tatum could: A. Produce all its own amino acids when grown on minimal media. B. All grew normally following treatment with X-Rays. C. Were unable to produce any amino acids following X-Ray treatment. D. All of the above are true

A. Produce all its own amino acids when grown on minimal media.

A genetically important event called crossing-over occurs during a. Prophase I b. Anaphase I c. Telophase I d. Metaphase II e. Telophase II

A. Prophase I

A single-nucleotide polymorphism that causes the loss or creation of a restriction site is called A. RFLP B. Copy number variation C. tandem repeat D. simple sequence R

A. RFLP

What are two distinguishing features of RNA? A. RNA has a ribose sugar and uracil nitrogenous base. B. RNA contains a methylated form of thymine. C. RNA forms a double helix of reverse complementary strands. D. RNA contains a pyrophosphate group bound to the ribose. E. RNA contains phosphodiester bonds as part of its sugar backbone

A. RNA has a ribose sugar and uracil nitrogenous base.

The "calico" pattern of coat coloration in female cats is an example of A. random x chromosome inactivation B. position effect variegation C. endoreduplication D. reciprocal translocation E. trisomy of the X chromosome

A. Random X chromosome inactivation

Reverse transcriptase catalyzes what reaction? A. Synthesis of DNA from a single-stranded RNA molecule B. Synthesis of RNA from a DNA template C. Circularization of restriction fragments D. Cleavage of DNA at a sequence-specific site E. Ligation of DNA fragments

A. Synthesis of DNA from a single-stranded RNA molecule

Selection for or against a dominant allele in diploids is inefficient when A. The dominant allele is rare B. The dominant allele is frequent C. The frequencies of the dominant allele in males and females are different D. The population is not in Hardy-Weinberg equilibrium

A. The dominant allele is rare

Use the following key to answer the following questions. Each answer may be used once, more than once, or not at all. A. The statement is true for mitosis only. B. The statement is true for meiosis I only. C. The statement is true for meiosis II only. D. The statement is true for mitosis and meiosis I .E. The statement is true for mitosis and meiosis II. 57) A cell divides to produce two daughter cells that are genetically identical.-

A. The statement is true for mitosis only.

Four genes are linked. In a series of testcross experiments, the frequency of recombination between a and b is 19%; between a and c is 48%; between a and d is 10%; between b and d is 10%; between c and d is 39%. What is the order of these four genes? A. a - d - b - c B. b - a - c - d C. b - c - d - a D. b - a - c - d E. a - b - c - d

A. a - d - b - c

After the S phase of a cell cycle, a chromosome exists as: A. a pair of sister chromatids that share one centromere B. a haploid C. a pair of homologous chromosomes D. a pair of sister chromatids, each with its own centromere E. a pair of homomorphic chromosomes

A. a pair of sister chromatids that share one centromere

Apoptosis _____. A. is a normal response to severe DNA damage B. can abnormally occur during development C. is a common characteristic of cancer cells D. is a process that repairs damaged DNA E. is controlled by genes unrelated to those controlling the cell cycle

A. is a normal response to severe DNA damage

Prokaryotes and eukaryotes produce which of the following types of RNA? A. mRNA, tRNA, rRNA B. mRNA, gRNA, sqRNA C. qRNA, suRNA, snRNA D. 1RNA, pRNA iRNA E. miRNA, rRNA, snRNA

A. mRNA, tRNA, rRNA

Sexual reproduction uses _________ to generate ___________ gametes, which join at fertilization. A. meiosis; haploid B. mitosis; haploid C. meiosis; diploid D. mitosis; diploid E. mitosis; identical

A. meiosis; haploid

Gene conversion results from a normal DNA repair process in the cell known as: A) Mismatch repair B) Interference C) DNA priming D) DNA duplexing E) Repairase

A. mismatch repair

King George III of England and other members of the royal family were afflicted with a series of strange, seemingly unrelated symptoms including abdominal pain, rapid pulse, convulsions, and insanity. It has been determined that he likely suffered from porphyria, caused by a mutation in a single allele. What is the genetic term describing the alteration of multiple, distinct traits of an organism by a mutation in a single gene? A. pleiotropy B. incomplete dominance C. codominance D. epistasis E. incomplete penetrance

A. pleiotropy

Which statement regarding genotypes and phenotypes is false? A: An organism with two different alleles for a single trait is said to be homozygous for that trait. B: The expressed physical traits of an organism are called its phenotype. C: Alleles are alternate forms of a gene. D: The genetic makeup of an organism constitutes its genotype.

A: An organism with two different alleles for a single trait is said to be homozygous for that trait.

Blood samples are taken from the heel of newborn babies to test for a mutation in the PKU gene. Why is this so important? A: PKU can be completely treated with dietary management of the amino acid phenylalanine, preventing any negative outcomes in the child, but the diet needs to be started immediately. B: PKU inevitably leads to mental retardation, reduced skin pigmentation, and other behavior problems and the family needs to plan for care for the child. C: PKU is lethal in newborns if not treated immediately. D: The government must track all cases of PKU to be sure the disease does not spread through the population

A: PKU can be completely treated with dietary management of the amino acid phenylalanine, preventing any negative outcomes in the child, but the diet needs to be started immediately.

Which statement regarding sickle-cell disease is false? A: Sickle-cell disease causes white blood cells to be sickle-shaped. B: Persons who are heterozygous for sickle-cell disease are also resistant to malaria. C: The multiple symptoms of sickle-cell disease result from the actions of just one allele. D: About 1 in 10 African Americans is a carrier of sickle-cell disease.

A: Sickle-cell disease causes white blood cells to be sickle-shaped.

Which statement regarding cross-breeding and hybridization is false? A: The hybrid offspring of a cross are the P1 generation. B: The offspring of two different varieties are called hybrids. C: The parental plants of a cross are the P generation .D: The hybrid offspring of an F1 cross are the F2 generation.

A: The hybrid offspring of a cross are the P1 generation.

A test cross is A: a mating between an individual of unknown genotype and an individual homozygous recessive for the trait of interest. B: a mating between two individuals of unknown genotype. C: a mating between an individual of unknown genotype and an individual heterozygous for the trait of interest. D: a mating between two individuals heterozygous for the trait of interest.

A: a mating between an individual of unknown genotype and an individual homozygous recessive for the trait of interest.

A carrier of a genetic disorder who does not show symptoms is most likely to be ________ to transmit it to offspring. A: heterozygous for the trait and able B: homozygous for the trait and unable C: homozygous for the trait and able D: heterozygous for the trait and unable

A: heterozygous for the trait and able

Genes located close together on the same chromosomes are referred to as ________ genes and generally ________. A: linked; do not sort independently during meiosis B: codependent; do not sort independently during meiosis C: linked; sort independently during meiosisB: homologous; are inherited together

A: linked; do not sort independently during meiosis

The chromosome theory of inheritance states that A: the behavior of chromosomes during meiosis and fertilization accounts for patterns of inheritance. B: chromosomes that exhibit mutations are the source of genetic variation. C: the behavior of chromosomes during mitosis accounts for inheritance patterns. D: humans have 46 chromosomes.

A: the behavior of chromosomes during meiosis and fertilization accounts for patterns of inheritance.

Which blood type is considered as "the universal recipient"?

AB type

In gel electrophoresis, which of the following DNA fragments would travel the farthest distance from the sample well?AT, ATCCCG, ATCCCGAT, ATCCCGATTGCACGTT

AT

If only one gene is involved in a certain trait, genetic test Ross produces 1/2 dominant and 1/2 recessive individuals, then the parent is

Aa

Mating of two organisms produces a 1:1 ratio of phenotypes in the progeny. The parental genotype are

Aa aa

Which of the following is a characteristic of restriction enzymes A. Most restriction enzymes recognize a single site. B. The restriction site is recognized regardless of the source of the DNA .C. The number of times a piece of DNA is cut is determined by the number of times the restriction site is present in the DNA. D. Most restriction sites are palindromes. E. All of the Above

All of the above

The concept that a set of 3 nucleotides specifies a particular amino acid provides the basis for what?

All of theseOne-gene-one-enzyme hypothesis, one-gene-one-polypeptide hypothesis, the genetic code, and biochemical reactions among nucleic acids

If polyploid species have complete sets of chromosomes from 2 or more different ancestral species they are called what?

Allopolyploids

The term "chromatin remodeling" refers to_________

Alteration of chromatin structure in association with transcription

An allele is

Alternative forms of gene

A peptide bond forms between the ____ of one animo acid and the ____ of another

Amino group, carboxyl group

Prophase I V. Prophase IIII. Metaphase I VI. Metaphase IIIII. Anaphase I VII. Anaphase IIIV. Telophase I VIII. Telophase II54) Centromeres of sister chromatids uncouple and chromatids separate.-

Anaphase II

DNA fragments migrate in an electrical field because DNA molecules

Are negatively charged

One map unit is equivalent to which of the following values? A) the physical distance between two linked genes B) 1% frequency of recombination between two genes C) 1 nanometer of distance between two genes D) the distance between a pair of homologous chromosomes

B) 1% frequency of recombination between two genes

What fraction of their daughter will be color-blinded and have achondroplasia A) none, 0% B) 1/4 25% C) 1/2 50% D) 3/4 75% E) all 100%

B) 1/4 25%

What fraction of their sons will be color-blinded and have achondroplasia A) none, 0% B) 1/4 25% C) 1/2 50% D) 3/4 75% E) all 100%

B) 1/4 25%

Two true-breeding stocks of pea plants are crossed. One parent has red axial flowers, and the other has white terminal flowers; all F1 individuals have red axial flowers. The genes for flower color and location assort independently. If 1,000 F2 offspring resulted from the cross, approximately how many of them would you expect to have red terminal flowers? A) 65 B) 190 C) 250 D) 565

B) 190

Labrador retrievers are black, brown, or yellow. In a cross of a black female with a brown male, results can be all black puppies, 1/2 black to 1/2 brown puppies, or 3/4 black to 1/4 yellow puppies. How many genes must be responsible for these coat colors in Labrador retrievers? A) 1 B) 2 C) 3 D) 4

B) 2

For the above question, calculate the Chi-square value. A) 0.095 B) 2.59 C) 2.65 D) 325.59 E) 644.8

B) 2.59

If there are 20 chromatids in a cell, how many centromeres are there? A) 10 B) 20 C) 30 D) 40 E) 80

B) 20

The following question refers to the essential steps in meiosis described below.1. Formation of four new nuclei, each with half the chromosomes present in the parental nucleus2. Alignment of tetrads at the metaphase plate3. Separation of sister chromatids4. Separation of the homologs; no uncoupling of the centromere5. Synapsis; chromosomes moving to the middle of the cell in pairs 41) Which of the steps takes place in both mitosis and meiosis? A) 2 B) 3 C) 5 D) 2 and 3 only E) 2, 3, and 5

B) 3

A plantlike organism on the planet Pandora can have three recessive genetic traits: bluishleaves, due to an allele (a) of gene A; a feathered stem, due to an allele (b) of gene B; and hollowroots, due to an allele (c) of gene C. The three genes are linked and recombine.A geneticist did a testcross with an organism that had been found to be heterozygous for thethree recessive traits and was able to identify progeny of the phenotypic distribution (+ = wildtype) shown in the figure below.If recombination frequency is equal to distance in map units, what is the approximate distancebetween genes A and B? A) 1.5 map units B) 3 map units C) 6 map units D) 15 map units

B) 3 map units

Two nucleotides are attached to one another other during replication in the following way: A) 5' carbon of the nucleotide in the growing chain is attached to the 3' carbon of the incoming nucleotide by a phosphodiester bond B) 3' carbon of the nucleotide in the growing chain is attached to the 5' carbon of the incoming nucleotide by a phosphodiester bond C) 5' carbon of the nucleotide in the growing chain is attached to the 3' carbon of the incoming nucleotide by a peptide bond D) 3' carbon of the nucleotide in the growing chain is attached to the 5' carbon of the incoming nucleotide by a peptide bond

B) 3' carbon of the nucleotide in the growing chain is attached to the 5' carbon of the incoming nucleotide by a phosphodiester bond

You are interested in testing the first law of genetics. You perform a dihybrid cross using two parents who are heterozygous for both genes. You formulate your null hypothesis, assess the offspring phenotypes, and calculate the chi square value: x2 = 2.46. How many degrees of freedom would you use? Would you reject or accept your null hypothesis? A) 1, reject B) 3, accept C) 3, reject D) 4, accept E) 4, reject

B) 3, accept

Achondroplasia, a form of dwarfism in humans, is caused by a dominant allele. What is the probability of a heterozygous dwarf man and a normal, homozygous woman having a child who is a heterozygous dwarf? A) 100% B) 50% C) 25% D) 0%

B) 50%

Tallness (T) in snapdragon plants is dominant to dwarfness (t), and red (CR) flower color is not dominant to white (CW). The heterozygous condition results in pink (CRCW) flower color. If snapdragons are heterozygous for height as well as for flower color, a mating between them will result in what ratio? A) 9:3:3:1 B) 6:3:3:2:1: C) 1:2:1 D) 27:9:9:9:3:3:3:1

B) 6:3:3:2:1:

How many unique gametes could be produced through independent assortment by an individual with the genotype AaBbCCDdEE? A) 4 B) 8 C) 16 D) 64

B) 8

In a triploid organism, genes A, C, H and X are all on chromosome #20. Which of the following statements is true? A) A complementation test will tell you if genes A and X are in the same linkage group B) A and H are in the same linkage group C) C and H are NOT in the same linkage group D) A and H show noncomplementation E) A and C show complementation

B) A and H are in the same linkage group

DNA is transformed: A) When a phage integrates into the bacterial chromosome B) By active uptake into competent bacterial cells. C) Into all bacterial cells that have a competence factor plasmid D) Only into bacteria that are F+ E) By means of bacteriophages

B) By active uptake into competent bacterial cells.

A type of euploidy includes: A) Monosomy B) Diploidy C) Trisomy D) Downs syndrome E) All of the above

B) Diploidy

In a species of cricket, genes T and W affect eye color. T = brown eyes, t = white eyes; W = brown eyes, w= white eyes. You expose your crickets to strong UV light and carry out a mutant screen. You find 4 mutants with white eyes. You perform a complementation test using a parent having the genotype TTww and a parent having the genotype ttWW. Here are your results:Mutant 1 Mutant 2 Mutant 3 Mutant 4TTww Brown eyes Brown eyes White eyes Brown eyesttWW Brown eyes White eyes Brown eyes White eyesMutant 1 Brown eyes Brown eyes Brown eyesMutant 2 Brown eyes White eyesMutant 3 Brown eyesTrue or False: Mutant 1 and mutant 3 show noncomplementation A) True B) False C) There is no way of knowing given this data Based on your results in the previous question, which of the following is a correct statement? A) There are two genes that encode for eye color in crickets B) There are three genes that encode for eye color in crickets C) There are four genes that encode for eye color in crickets D) Alleles from mutant 2 and mutant 3 belong to the same complementation group E) Mutants 1 and mutants 3 have mutations in the same gene

B) False B) There are three genes that encode for eye color in crickets

The figure above represents a pedigree for a family in which dark-shaded symbols represent individuals with one of the two major types of colon cancer. Numbers under the symbols are the individuals' age at the time of diagnosis. A slash through the symbol indicates that the individual is deceased. In each generation of this family after generation I, the age at diagnosis is significantly lower than would be found in nonfamilial (sporadic) cases of this cancer (~63 years). What is the most likely reason?A) Members of this family know to be checked for colon cancer early in life. B) Hereditary (or familial) cases of this cancer typically occur at earlier ages than do nonfamilial forms. C) This is pure chance; it would not be expected if you were to look at a different family. D) This cancer requires mutations in more than this one gene.

B) Hereditary (or familial) cases of this cancer typically occur at earlier ages than do nonfamilial forms.

What type of chemical bonds hold together complementary strands in duplex DNA? A) Electrostatic interactions via gene-for-gene attraction B) Hydrogen bonds C) Phosphodiester bonds D) Polylinker bonds E) None of the above

B) Hydrogen bonds

For the following question, match the key event of meiosis with the stages listed below.I. Prophase I V. Prophase IIII. Metaphase I VI. Metaphase IIIII. Anaphase I VII. Anaphase IIIV. Telophase I VIII. Telophase II 38) Tetrads of chromosomes are aligned at the equator of the spindle; alignment determines independent assortment. A) I B) II C) IV D) VI E) VIII b

B) II

Which of the following statements correctly describes an example of epistasis? A) Recessive genotypes for each of two genes (aabb) result in an albino corn snake. B) In rabbits and many other mammals, one genotype (ee) prevents any fur color from developing. C) In Drosophila (fruit flies), white eyes can be due to a combination of multiple genes. D) In cacti, there are several genes for the type of spines.

B) In rabbits and many other mammals, one genotype (ee) prevents any fur color from developing.

Which of the following is a true statement about sexual vs. asexual reproduction? A) Asexual reproduction, but not sexual reproduction, is characteristic of plants and fungi. B) In sexual reproduction, individuals transmit 50% of their genes to each of their offspring. C) In asexual reproduction, offspring are produced by fertilization without meiosis. D) Sexual reproduction requires that parents be diploid. E) Asexual reproduction produces only haploid offspring.

B) In sexual reproduction, individuals transmit 50% of their genes to each of their offspring.

Transcription termination requires which of the following? A) A stop codon B) Inverted repeats C) A release factor D) A poly-A tail E) A splice site

B) Inverted repeats

Which of the following statements describes the chromosome theory of inheritance as expressed in the early twentieth century? A) Individuals inherit particular chromosomes attached to genes. B) Mendelian genes are at specific loci on the chromosome and in turn segregate during meiosis. C) Homologous chromosomes give rise to some genes and crossover chromosomes to other genes. D) No more than a single pair of chromosomes can be found in a healthy normal cell.

B) Mendelian genes are at specific loci on the chromosome and in turn segregate during meiosis.

In a complementation test, noncomplementation results when A) Mutations encoding for the same trait are at different loci B) Mutations encoding for the same trait are at the same locus C) Mutations at different loci encode for different traits D) Mutations encoding for the same trait are part of the same linkage group E) Mutations encoding for the same trait are NOT part of the same linkage group

B) Mutations encoding for the same trait are at the same locus

When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 generation included both red- and white-eyed flies. Remarkably, all the white-eyed flies were male. What was the explanation for this result? A) The gene involved is on the Y chromosome. B) The gene involved is on the X chromosome. C) The gene involved is on an autosome, but only in males. D) Eye color in flies is a multifactorial trait.

B) The gene involved is on the X chromosome.

A cell divides to produce two daughter cells that are genetically different. A) The statement is true for mitosis only. B) The statement is true for meiosis I only. C) The statement is true for meiosis II only. D) The statement is true for mitosis and meiosis I. E) The statement is true for mitosis and meiosis II.

B) The statement is true for meiosis I only.

What was the most significant conclusion that Gregor Mendel drew from his experiments with pea plants? A) There is considerable genetic variation in garden peas. B) Traits are inherited in discrete units and are not the results of the "blending" of traits. C) Recessive genes occur more frequently in the F1 generation than do dominant ones. D) An organism that is homozygous for many recessive traits is at a disadvantage

B) Traits are inherited in discrete units and are not the results of the "blending" of traits.

Normally, only female cats have the tortoiseshell phenotype because A) the males die during embryonic development. B) a male inherits only one allele of the X-linked gene controlling hair color. C) the Y chromosome has a gene blocking orange coloration. D) only males can have Barr bodies.

B) a male inherits only one allele of the X-linked gene controlling hair color.

What is a chromatid? A) a chromosome in G1 of the cell cycle B) a replicate chromosome C) a chromosome found outside the nucleus D) a special region that holds two centromeres together E) another name for the chromosomes found in genetics

B) a replicate chromosome

Which term describes centromeres uncoupling, sister chromatids separating, and the two new chromosomes moving to opposite poles of the cell? A) telophase B) anaphase C) prometaphase D) metaphase E) prophase

B) anaphase

Gene S controls the sharpness of spines in a type of cactus. Cactuses with the dominant allele, S, have sharp spines, whereas homozygous recessive ss cactuses have dull spines. At the same time, a second gene, N, determines whether or not cactuses have spines. Homozygous recessive nn cactuses have no spines at all. The relationship between genes S and N is an example of A) incomplete dominance. B) epistasis. C) complete dominance. D) pleiotropy.

B) epistasis.

Homologous chromosomes move toward opposite poles of a dividing cell during A) mitosis. B) meiosis I. C) meiosis II. D) fertilization. E) binary fission.

B) meiosis I.

At which stage of mitosis are chromosomes usually photographed in the preparation of a karyotype? A) prophase B) metaphase C) anaphase D) telophase E) interphase

B) metaphase

At the end of ________ and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids.

B) telophase I

Sex determination in mammals is due to the SRY gene on the Y chromosome. An abnormality of this region could allow which of the following individuals to have a male phenotype? A) Turner syndrome, 45,X B) translocation of the SRY gene to an autosome of a 46,XX individual C) a person with an extra X chromosome D) a person with one normal and one shortened (deleted) X

B) translocation of the SRY gene to an autosome of a 46,XX individual

A tetrad includes which of the following sets of DNA strands? A) two single-stranded chromosomes that have synapsed B) two sets of sister chromatids that have synapsed C) four sets of sister chromatids D) four sets of unique chromosomes E) eight sets of sister chromatids

B) two sets of sister chromatids that have synapsed

In humans, wavy hair occurs in heterozygotes (HSHC) offspring of people with straight hair (HSHS) and curly hair (HCHC). Which of the following crosses would produce offspring with the ratio of 1 straight:2 wavy:1 curly? A) straight × straight B) wavy × wavy C) curly × wavy D) curly × curly

B) wavy × wavy

The following questions refer to the essential steps in meiosis described below.1. formation of four new nuclei, each with half the chromosomes present in the parental nucleus2. alignment of tetrads at the metaphase plate3. separation of sister chromatids4. separation of the homologues; no uncoupling of the centromere5. synapsis; chromosomes moving to the middle of the cell in pairs 61) Which of the steps take place in both mitosis and meiosis?-

B)3

Among sibships consisting of five children, and assuming a sex ratio of 1:1, what is the proportion with no boys? A. 1/2 B. (1/2)^5 C.(1/5)^5 D. 1‐(1/2)5

B. (1/2)^5

If a plant that is heterozygous at five loci is self-fertilized, what is the probability of having an offspring that is homozygous recessive at all five loci? A. .001% B. .098% C. 1.25% D. 23.7% E. None of the above

B. .098%

How many Barr bodies would be present in white blood cells of an individual with karyotype 48, XXYY? A.0 B.1 C. 2 D.3 E.4

B. 1

A woman with keratosis, a skin condition caused by a rare dominant allele, marries a normal man, and they have a son. What is the probability that their son is normal? A. 0 B. 1/2 C. 1/4 D. 3/4 E. 1

B. 1/2

A normal woman has a sister who suffers from deafness determined by a rare recessive allele. What is the probability that her phenotypically normal daughter is heterozygous for the gene? A. 1/2 B. 1/3 C. 1/4 D. 1/6 E. 0

B. 1/3

if one of the parents is a 14/21 translocation carrier, ( ) of the viable offspring would have Down syndrome?***** A. 1/2 B. 1/3 C. 1/4 D. 1/5

B. 1/3

What is the frequency of recombination between b and cn? A. 2% B. 10% C. 23% D. 27% E. 50%

B. 10%

Which of the following sequences is palindromic? A. 5'-CCAG-3' B. 5'-CCGG-3' C. 5'-CCAGG-3' D. 5'-ACCGGA-3' E. 5'-CCAAGG-3'

B. 5'-CCGG-3'

Assuming independent assortment, what phenotypic ratio would you expect to see if an individual with the genotype RrGg is self-crossed? A. 1:3 B. 9:3:3:1 C. 1:3:2:1 D. 1:3:2:1 E. 3:1

B. 9:3:3:1

Which of the following features is common to both DNA replication and transcription? A. Nucleotides are added to the 5' end of the newly synthesized strand. B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate. C. Deoxyribonucleotides are incorporated into the growing sequence. D. All the same nucleotides are used in both processes.

B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate.

Mating of two organisms produces a 1:1 ratio of phenotypes in the progeny. What are the parental genotypes? A. Aa Aa B. Aa aa C. AA aa D. AA AA E. aa AA

B. Aa aa

Individuals that are heterozygous for translocation produce what? A. the normal number of offspring. B. about one‐half as many offspring as normal. C. about one‐fourth as many offspring as normal. D. about one‐tenth as many offspring as normal. E. no offspring.

B. About 1/2 as many offspring as normal

A rare human disease affected a family as shown in the pedigree below. The most likely mode of inheritance is A. Autosomal dominant B. Autosomal recessive C. X-linked dominant D. X-linked recessive E. There is not enough information to solve the problem.

B. Autosomal recessive

__________ refers to a state wherein the heterozygote expresses both alleles and both products are functional, although they may be different. A. Double homozygote B. Co-dominance C. Incomplete dominance D. Dominance E. Hemizygosity

B. Co-dominance

The Hershey-Chase blender experiment was the first to demonstrate: A. Transduction in bacterial cells B. DNA, not protein, is inherited from parental phage C. Protein, not DNA, is transferred (via transformation) to different bacterial cells D. DNA, not protein, is transferred (via transformation) to different bacterial cells E. None of the above

B. DNA, not protein, is inherited from parental phage

The questions below consist of five phrases or sentences concerned with the cell cycle. For each one, select the answer below that is most closely related to it. Each answer may be used once, more than once, or not at all. A. G0 B. G1 C. S D. G2 E. M 19) The "restriction point" occurs here.-

B. G1

Structural genes code for A. all of these choices B. Gene expression elements C. Transfer RNA molecules D. Cellular proteins E. Ribosomal RNA molecules

B. Gene expression elements

Which of the followings is NOT true? A. more than one codon is used for most amino acids B. in most cases, the first base of the codon can be altered without changing the amino acid C. the genetic code is almost universal D. AUG is the start codon

B. In most cases, the first base of the codon can be altered without changing the amino acid

Both mitosis and meiosis are preceded by A. Metaphase B. Interphase C. Prophase D. Intraphase E. Anaphase

B. Interphase

47, XXY is a condition known as A. trisomy-X syndrome B. Klinefelter syndrome C. turner syndrome D. double-Y syndrome E. Fragile X syndorme

B. Klinefelter syndrome

A man known to have a normal karyotype (46, XY) is married to a woman known to have a normal karyotype (46, XX). They have a son who is XYY (47, XYY). The best explanation for this is A. Nondisjunction at meiosis I in the father. B. Nondisjunction at meiosis II in the father. C. Nondisjunction at meiosis I in the mother. D. Nondisjunction at meiosis II in the mother. E. Nondisjunction at meiosis I in both parents.

B. Nondisjunction at meiosis II in the father.

What chemical group appears on the 5' carbon of a DNA nucleotide? A. Carboxyl group B. Phosphate group C. Amino group D. Hydroxyl group E. Nitrogenous base

B. Phosphate group

Which of the following processes does not contribute to changing allele frequencies in populations? A. Mutation B. Random Mating C. Migration D. Natural selection E. Genetic drift

B. Random Mating

In the lytic cycle of a virulent bacteriophage where multiple bacteriophage are present A. Phage DNA recombines with the host chromosome. B. Recombination may occur between different infecting phage particles. C. The host bacterium transmits the bacteriophage to daughter cells. D. All of the above

B. Recombination may occur between different infecting phage particles.

The phenotypic variance of the F1 progeny of a cross between two clonal lines equals (Think Carefully) A. The total phenotypic variance B. The environmental variance C. 0 D. 0.5 E. 1

B. The environmental variance

Deafness is caused by recessive mutations in any one of at least five genes. Two deaf individuals have nin children, all of whom have normal hearing. Which of the following can you conclude? A. The parents have mutations in the same gene. B. The parents have mutations in different genes. C. The parents have the same mutated protein involved in inner ear development. D. The mutations are codominant to the normal allele. E. The mutations are incompletely dominant to the normal allele.

B. The parents have mutations in different genes

a cell division to produce two daughter cells that are genetically different A. The statement is trie for meiosis ll only B. The statement is true for meiosis 1 only C. The statement is true for mitosis and meiosis ll only D. The statement is true for mitosis only E. The statement is true for mitosis and meiosis l

B. The statement is true for meiosis 1 only

Use the following key to answer the following questions. Each answer may be used once, more than once, or not at all. A. The statement is true for mitosis only. B. The statement is true for meiosis I only. C. The statement is true for meiosis II only. D. The statement is true for mitosis and meiosis I. E. The statement is true for mitosis and meiosis II. 58) Homologous chromosomes synapse and crossing over occurs.-

B. The statement is true for meiosis I only.

Which of the following are NOT true about the Waston-crick DNA Model?A. Replication occurs in a semi-conservative method. B. The strands run parallel. C. There are two strands. D. Strands are held together by Hydrogen bonds.

B. The strands run parallel.

What would you expect to happen to the chromosomes in successive cell cycles in a cell linage that had a nonfunctional telomerase? A. Pleiotrophy B. The telomeres would get shorter with each cell division C. The cell would suffer from nondisjunction D. The heterochromatin would replicate E. None of the above

B. The telomeres would get shorter with each cell division

What is the process of synthesizing single-stranded RNA from template DNA? A. Replication B. Transcription C. Translation D. Transformation E. Transduction

B. Transcription

A process in which bacterial cells acquire genes from free DNA molecules in the surrounding medium is called A. Specialized transduction B. Transformation C. Generalized transduction D. ConjugationE. Recombination

B. Transformation

tRNA is important to which of the following: A. DNA replication and repair B. Translation C. Transcription D. Translation and transcription E. Cell division (cytokinesis)

B. Translation

For the following: Is there a cross that would give different phenotypes for males and females? The gene Ruffle ('R') in chickens is dominant and sex linked, and the phenotype can be distinguished from normal in day old chicks. Females are the heterogametic sex in fowl. A. No, not possible B. Yes, 'R-' females to 'rr' males C. Yes, 'R-' males to 'rr' females D. Yes, 'R-' females to Rr males E. Yes, 'r-' females to rr males

B. Yes, 'R-' females to 'rr' males

The questions below refer to the following terms. Each term may be used once, more than once, or not at all. A. telophase B. anaphase C. prometaphase D. metaphase E. prophase 9) Centromeres uncouple, sister chromatids are separated, and the two new chromosomes move to-

B. anaphase

Probabilities are calculated using the multiplication rule when they A. are equally likely. B. are independent. C. are mutually exclusive. D. occur disproportionately.

B. are independent.

True-breeding Siamese cats with color at the "points" are homozygous for a temperature-sensitive allele of the tyrosinase gene, cscs. There are also true-breeding albino cats, cc. True-breeding black cats are CC. In this series of alleles, C > cs > c, so C- are black and csc are Siamese. a. (5 pts.) A cat with color at the points is mated to a black cat, producing a litter of three kittens: one black, one with color at the points, and one albino. The genotypes of the parents in this cross are A. cscs x Cc B. csc x Cc C. csc x Ccs D. cscs x Ccs E. There is not enough information to solve the problem.

B. csc x Cc

When a diploid cell divides by mitosis, the end result is _____________. A. identical haploid cells B. identical diploid cells C. unique diploid cells D. unique haploid cells E. a zygote

B. identical diploid cells

Which mode of inheritance produces heterozygotes with phenotypes that differ from either homozygote but typically more closely resembles one homozygous phenotype than the other? A. complete dominance B. incomplete dominance C. codominance D. epistasis E. incomplete penetrance

B. incomplete dominance

Which phenomenon explains differences in the inheritance patterns of the appearance of a chin beard between males and females of certain species of goats, even when their genotypes are the same? A. sex-limited trait B. sex-influenced trait C. incomplete penetrance D. variable expressivity E. lethal allele

B. sex-influenced trait

Below is the structure of gene 1 and 2 in the chromosome. Which of the following is NOT true? A. the anti-sense strand for gene 1 is the bottom strand of DNA B. the coding strand for gene 2 is the top strand of DNA C. the template strand for gene 1 is the bottom strand of DNA D. the sense strand for gene 2 is the bottom strand of DNA

B. the coding strand for gene 2 is the top strand of DNA

Messenger RNA (mRNA) is __________. An rRNA is ______. A tRNA is ________. A. the major structural material making up ribosomes B. the molecule that carries the genetic information from DNA and is used as a template for protein synthesis C. the major structural component of chromosomes D. a molecule that incorporates a specific amino acid into the growing protein when it recognizes a specific group of three bases E. the monomer of polypeptides

B. the molecule that carries the genetic information from DNA and is used as a template for protein synthesis A. the major structural material making up ribosomes D. a molecule that incorporates a specific amino acid into the growing protein when it recognizes a specific group of three bases

Which of the follow refers to all the RNA produced by transcription of DNA? A. proteome B. transcriptome C. genome D. translatome E. Population genetics

B. transcriptome

In a complementation test, if the combination of two recessive mutations results in a mutant phenotype, then the mutations are regarded as A.pleiotropic. B.alleles of the same gene. C.alleles of different genes. D.codominant. E.epistatic.

B.alleles of the same gene.

The phenotypic ratio resulting from a dihybrid cross of two heterozygote individuals showing independent assortment is expected to be A: 3:1. B: 9:3:3:1. C: 1:2:1. D: 9:1:1:3.

B: 9:3:3:1.

The individual features of all organisms are the result of A: only the environment in which the organism develops. B: both the interaction between genetics and the environment. C: only the genes present. D: both the environment and the needs of the individual.

B: both the interaction between genetics and the environment.

For most sexually reproducing organisms, Mendel's laws A: help us understand the global geographic patterns of genetic disease. B: cannot strictly account for the patterns of inheritance of many traits. C: can predict whether offspring will be male or female with 100% accuracy. D: explain the biological mechanisms behind why certain genes are dominant or recessive.

B: cannot strictly account for the patterns of inheritance of many traits.

The expression of both alleles for a trait in a heterozygous individual illustrates A: polygenic inheritance. B: codominance. C: pleiotropy.

B: codominance.

The mechanism that "breaks" the linkage between linked genes is A: pleiotropy. B: crossing over. C: codominance. D: independent assortment.

B: crossing over.

Which trait is an example of incomplete dominance in humans? A: skin color B: hypercholesterolemia C: albinism D: ABO blood groups

B: hypercholesterolemia

Most people afflicted with recessive disorders are born to parents who were A: both affected by the disease. B: not affected at all by the disease. C: slightly affected by the disease, showing some but not all of the symptoms.

B: not affected at all by the disease.

Six bands in a salivary gland chromosome of Drosophila are shown in the figure, along with the extent of five deletions (Del1 - Del5). Recessive alleles a, b, c, d, e, and f are known to be in the region, but their order is unknown. When the deletions are combined with each allele, the following results are obtained:In this table, a minus sign means that the deletion is missing the corresponding wild-type allele (the deletion uncovers the recessive) and a plus sing means that the corresponding wild-type allele is still present. Use these data to infer which salivary band corresponds to gene d

Band 1

In both prokaryotes and eukaryotes, DNA replication is what?

Bidirectional and semiconservative

A round seed parent can produce

Both A) and B) are possible

A cell with a nucleus containing only one set of chromosomes, consisting of one member of each homologous pair, is

Both B and D

Endonucleases

Break internal phophodiester bonds in a single- or double-stranded nucleic acid molecule

Knowing what you know about the consequences of recombination within an inversion loop, how many normal, inverted, dicentric and acentric chromosomes would be generated from the meiosis of a pericentric inversion heterozygote if there is a single crossover? A) 1, 1, 1, 1 B) 2, 2, 0, 0 C) 1, 1, 0, 0 D) 0, 0, 2, 2 E) 2, 2, 2, 2

C) 1, 1, 0, 0

What fraction of their daughter will be normal height A) none, 0% B) 1/4 25% C) 1/2 50% D) 3/4 75% E) all 100%

C) 1/2 50%

What fraction of their daughter will be will have normal vision and be carriers for all color blindness? A) none, 0% B) 1/4 25% C) 1/2 50% D) 3/4 75% E) all 100%

C) 1/2 50%

What fraction of their sons will have normal vision A) none, 0% B) 1/4 25% C) 1/2 50% D) 3/4 75% E) all 100%

C) 1/2 50%

In Drosophila there are 3 sex-linked genes, A, B and C. For each gene, the mutant allele is recessive to the wild-type allele. You perform a cross between females who are heterozygous for these three loci and wild-type males, and you get the following male progeny. Remember: females are the homogametic sex in Drosophila.Male offspring genotype Number of offspringabc 78a+c 3ab+ 394+b+ 4a++ 32+bc 27++c 402+++ 60Estimate the distance between the A and C genes. A) 0.7 map units B) 6.6 map units C) 14.5 map units D) 21.1 map units E) Greater than 50 map units

C) 14.5 map units

In a particular plant, leaf color is controlled by gene locus D. Plants with at least one D allele have dark green leaves, and plants with the homozygous recessive dd genotype have light green leaves. A true-breeding dark-leaved plant is crossed with a light-leaved one, and the F1 offspring is allowed to self-pollinate. The predicted outcome of the F2 is diagrammed in the Punnett square shown in the figure above, where 1, 2, 3, and 4 represent the genotypes corresponding to each box within the square. Which of the boxes correspond(s) to plants with a heterozygous genotype? (Punnett square Dd x Dd) A) 1 only B) 1 and 2 C) 2, and 3 D) 1, 2 and 3

C) 2, and 3

Two true-breeding stocks of pea plants are crossed. One parent has red axial flowers, and the other has white terminal flowers; all F1 individuals have red axial flowers. The genes for flower color and location assort independently. Among the F2 offspring, what is the probability of plants with white axial flowers? A) 9/16 B) 1/16 C) 3/16 D) 1/8

C) 3/16

Given the following cross between parents of the genotypes AABBCc × AabbCc, assume complete dominance for each trait and independent assortment. What proportion of the progeny will be expected to phenotypically resemble the first parent? A) 1/4 B) 1/8 C) 3/4 D) 3/8

C) 3/4

A plantlike organism on the planet Pandora can have three recessive genetic traits: bluishleaves, due to an allele (a) of gene A; a feathered stem, due to an allele (b) of gene B; and hollowroots, due to an allele (c) of gene C. The three genes are linked and recombine.A geneticist did a testcross with an organism that had been found to be heterozygous for thethree recessive traits and was able to identify progeny of the phenotypic distribution (+ = wildtype) shown in the figure below.Which of the following are the phenotypes of the parents in this cross? A) 2 and 5 B) 1 and 6 C) 4 and 8 D) 3 and 7

C) 4 and 8

The figure above shows a pedigree chart for a family, some of whose members exhibit the dominant trait, W. Affected individuals are indicated by a dark square or circle. What is the likelihood that the offspring of IV-3 and IV-4 will have the trait? A) 0% B) 25% C) 50% D) 75%

C) 50%

When crossing an organism that is homozygous recessive for a single trait with one that is heterozygous for the same trait, what is the chance of producing an offspring with the homozygous recessive phenotype? A) 0% B) 25% C) 50% D) 75%

C) 50%

In sunflowers yellow seeds (G) is dominant over green seeds (g) and tall plants (S) are dominant over short (s). A true breeding yellow, short plant is crossed to a true breeding green tall plant. The F1 offspring that are produced are allowed to self fertilize. In the F2, the following phenotypes were present: 95 green tall, 260 yellow tall, 25 green short, and 100 yellow short. Assuming independent segregation of G and S, what is the expected F2 number of yellow, short phenotypes? A) 30 B) 53.3 C) 90 D) 160 E) 270

C) 90

Which of the following statements correctly describes a dihybrid cross? A) A dihybrid cross involves two parents. B) A dihybrid cross produces two offspring. C) A dihybrid cross involves organisms that are heterozygous for two characters. D) A dihybrid cross results in a 3:1 phenotype ratio in the F2 offspring

C) A dihybrid cross involves organisms that are heterozygous for two characters.

Which of the following statements correctly describes a monohybrid cross? A) A monohybrid cross involves a single parent. B) A monohybrid cross produces a single offspring. C) A monohybrid cross involves organisms that are heterozygous for one character. D) A monohybrid cross is performed for one generation.

C) A monohybrid cross involves organisms that are heterozygous for one character.

A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. Which of the following is a possible phenotype for the father? A) A negative B) O negative C) B positive D) AB negative

C) B positive

Which of the following events causes recombination between linked genes to occur? A) Mutation that causes one homolog to be different from the other homolog. B) Independent assortment of the genes. C) Crossovers between the genes results in chromosomal exchange. D) Nonrecombinant chromosomes break and then re-join with one another.

C) Crossovers between the genes results in chromosomal exchange.

The frequency of heterozygosity for the sickle-cell anemia allele is unusually high, presumably because this reduces the frequency of malaria. Such a relationship is related to which of the following concepts? A) Mendel's law of independent assortment B) Mendel's law of segregation C) Darwin's explanation of natural selection D) Darwin's observations of competition

C) Darwin's explanation of natural selection

Which of the following is true of a species that has a chromosome number of 2n = 16? A) The species is diploid with 32 chromosomes per cell. B) The species has 16 sets of chromosomes per cell. C) Each cell has eight homologous pairs. D) During the S phase of the cell cycle there will be 32 separate chromosomes. E) A gamete from this species has four chromosomes.

C) Each cell has eight homologous pairs.

A couple had a phenotypically normal son who, upon inspection of his chromosomes, was actually XYY in his chromosome constitution. In which parent, and at what meiotic division, could the nondisjunction causing this constitution have happened? A) Mother, first meiotic division B) Mother, second meiotic division C) Father, second meiotic division D) Father, first meiotic division E) Neither, this had to have occurred in the son after cell division

C) Father, second meiotic division

Eukaryotic sexual life cycles show tremendous variation. Of the following elements, which do all sexual life cycles have in common?I. Alternation of generationsII. MeiosisIII. FertilizationIV. GametesV. Spores A) I, IV, and V B) I, II, and IV C) II, III, and IV D) II, IV, and V E) I, II, III, IV, and V

C) II, III, and IV

Which of the following statements best describes the SRY gene? A) It is a gene present on the X chromosome that triggers female development. B) It is an autosomal gene that is required for the expression of genes on the Y chromosome. C) It is a gene region present on the Y chromosome that triggers male development. D) It is an autosomal gene that is required for the expression of genes on the X chromosome.

C) It is a gene region present on the Y chromosome that triggers male development.

Which of the following is the best description for the PARp region of a chromosome? A) It is the short arm of a sex chromosome that has a pericentric inversion (pericentric arm region) B) It is the short arm of a autosome that has a pericentric inversion (pericentric arm region) C) It is the short arm of a sex chromosome that has a very high rate of crossing over and recombination D) It is the long arm of a sex chromosome that has a very high rate of crossing over and recombination E) It is the long arm of a sex chromosome that has a pericentric inversion (pericentric arm region)

C) It is the short arm of a sex chromosome that has a very high rate of crossing over and recombination

How does the recombination of linked genes contribute to natural selection?A) It reduces genetic variability in a sexually reproducing species. B) It eliminates specific alleles in a population. C) It maintains genetic variability in a species. D) It increases the number of alleles associated with a specific gene.

C) It maintains genetic variability in a species.

If cell X enters meiosis, and nondisjunction of one chromosome occurs in one of its daughter cells during meiosis II, what will be the result at the completion of meiosis? A) All the gametes descended from cell X will be diploid. B) Half of the gametes descended from cell X will be n + 1, and half will be n - 1. C) One-fourth of the gametes descended from cell X will be n + 1, 1/4 will be n - 1, and 1/2 will be n. D) All of the gametes will have the normal number of chromosomes.

C) One-fourth of the gametes descended from cell X will be n + 1, 1/4 will be n - 1, and 1/2 will be n.

Which of the following is a polymorphism in the human genome that is defined as a tandem repeat? A) SSBP B) RFLP C) SSR D) SNP E) EcoR1

C) SSR

When homologous chromosomes crossover, what occurs? A) Two chromatids get tangled, resulting in one re-sequencing its DNA. B) Two sister chromatids exchange identical pieces of DNA. C) Specific proteins break the two strands and re-join them with their homologs. D) Each of the four DNA strands of a tetrad is broken and the pieces are mixed. E) Maternal alleles are "corrected" to be like paternal alleles and vice versa.

C) Specific proteins break the two strands and re-join them with their homologs.

You perform an experiment and calculate a chi square statistic. The P value is equal to 0.35. How would you interpret this P value? A) There is a 35% chance that the null hypothesis is correct B) There is a 35% chance that the null hypothesis is incorrect C) There is a 35% probability that the critical value would have been as bad (or worse) just due to chance alone D) There is a 35% probability that the critical value would not have been as bad (or worse) just due to chance alone E) You would use the P value and the degrees of freedom to look up your critical value

C) There is a 35% probability that the critical value would have been as bad (or worse) just due to chance alone

What was Mendel's explanation for his observation that traits that had disappeared in the F1 generation reappeared in the F2 generation of the pea plants he used in his experiments?A) New mutations were frequently generated in the F2 progeny, "reinventing" traits that had been lost in the F1. B) The mechanism controlling the appearance of traits was different between the F1 and the F2 plants. C) Traits can be dominant or recessive, and the recessive traits were"hidden" by the dominant ones in the F1. D) The traits were lost in the F1 due to dominance of the parental traits.

C) Traits can be dominant or recessive, and the recessive traits were"hidden" by the dominant ones in the F1.

Which of the following statements describes the major reason that an individual with the genotype AaBbCCDdEE can make many kinds of gametes? A) segregation of maternal and paternal alleles B) crossing over during prophase I C) different possible assortment of chromosomes into gametes D) the tendency for dominant alleles to segregate together

C) different possible assortment of chromosomes into gametes

homologus chromosomes move toward opposite poles of a dividing cell during A) binary fission B) mitosis C) meiosis 1 D) fertilization E) meiosis ll

C) meiosis 1

Cystic fibrosis affects the lungs, the pancreas, the digestive system, and other organs, resulting in symptoms ranging from breathing difficulties to recurrent infections. Which of the following terms best describes this expression of phenotypes? A) incomplete dominance B) multiple alleles C) pleiotropy D) epistasis

C) pleiotropy

Which of the following describes the ability of a single gene to have multiple phenotypic effects? A) incomplete dominance B) multiple alleles C) pleiotropy D) epistasis

C) pleiotropy

Which term describes two centrosomes arranged at opposite poles of the cell? A) telophase B) anaphase C) prometaphase D) metaphase E) prophase

C) prometaphase

Chromosomes first become visible during which phase of mitosis? A) prometaphase B) telophase C) prophase D) metaphase E) anaphase

C) prophase

The addition rule of probability can be defined as A) the probability that two or more independent events will both occur B) the probability that two or more independent events will both occur in the offspring of one set of parents. C) the probability that either one of two mutually exclusive events will occur. D) the probability of producing two or more heterozygous offspring.

C) the probability that either one of two mutually exclusive events will occur.

The figure above shows a pedigree chart for a family, some of whose members exhibit the dominant trait, W. Affected individuals are indicated by a dark square or circle. What is the genotype of individual II-5? A) WW B) Ww C) ww D) WW or ww

C) ww

If the DNA content of a diploid cell in the G₁ phase of the cell cycle is x, then the DNA content of a single cell at metaphase of meiosis II would be A) 0.25x. B) 0.5x. C) x. D) 2x .E) 4x.

C) x.

Labrador retrievers have black, brown, or yellow fur. Fur color is controlled by two genes, one of which exhibits epistasis. Black (B) is dominant over brown (b) in one gene, and (E) is dominant over (e) in the other gene. The (E) gene is epistatic to the (B) gene. In a cross of a black female with a brown male, results can be all black puppies, 1/2 black to 1/2 brown puppies, or 3/4 black to 1/4 yellow puppies. In one cross of black × black, the results were as follows:9/16black, 4/16 yellow, 3/16 brown. The genotype eebb must result in which of the following? A) black B) brown C) yellow D) a lethal result

C) yellow

Phenylketonuria is an inborn error of metabolism caused by autosomal recessive gene. The frequency of this allele in the population is 0.03. Assuming Hardy-Weinberg proportion, what is the expected frequency of phenylketonuria in offspring where both parents are known to be carriers of the disease? A. 0.0009 B. 0.03 C. 0.25 D. 0.97 E. Not enough information to determine

C. 0.25

If in a population in Hardy-Weinberg equilibrium the frequency of homozygous recessive genotypes is 0.16. What is the frequency of the recessive allele? A. 0.026 B. 0.16 C. 0.4 D. 0.6 E. 0.84

C. 0.4

In a population with two alleles, B and b, the frequency of b is 0.6. What would be the frequency of the heterozygotes, assuming Hardy-Weinberg equilibrium? A. 0.36 B. 0.4 C. 0.48 D. 0.36 E. 0.64

C. 0.48

A woman with keratosis, a skin condition caused by a rare dominant allele, marries a normal man, and they have two children. What is the probability we that both children are normal? A. 0 B. 1/2 C. 1/4 D. 3/4 E. 1

C. 1/4

Two parents with blood types A and B have a child who has O blood type. What is the chance that their next child will be AB? a. 0 b. 1/2 c. 1/4 d. 1 e. 3/4

C. 1/4

Two parents with blood types AB and O have a child. What is the chance that this child will be A? A. 0 B. 1/2 C. 1/4 D. 1

C. 1/4

Which of the following double stranded DNA segments having 100 base pairs would require more energy to separate? The strand containing: A. 25% A, 25% T, 25% C, 25% G B. 20% A, 20% T, 30% C, 30% G C. 10% A, 10% T, 40% C, 40% G D. 50% A, 50% T E. They would all require the same amount of energy

C. 10% A, 10% T, 40% C, 40% G

You conduct a tri-hybrid cross between two strains of moth - one with long antennae (AA), a hairy head (SS) and a black body (WW) to a strain having short antennae (aa), a smooth head (ss) and a white body (ww). All of the F1 offspring have long antennae, hairy heads and black bodies. When you perform an F1xF1 cross, what is the probability of having an F2 offspring with long antennae, a smooth head and a black body? Assume normal Mendelian inheritance. A. 1.8% B. 4.7% C. 14.1% D. 42.2% E. 75%

C. 14.1%

What phenotypic ratio would you expect as a result of a test cross between two individuals where one that is homozygous recessive for alleles at two independent loci? A. 3:1 B. 1:2:1 C. 1:1:1:1 D. 9:3:3:1 E. 9:4:2:1

C. 1:1:1:1

In a cross between two highly inbred lines of Drosophila, the F1 progeny has the variance of 0.87 for the number of abdominal bristles. The F2 generation has the variance of 3. What is the genetic variance? A. 0.87 B. 3 C. 2.13 D. 3.87 E. 3.45

C. 2.13

Two parents with blood types A and B have a child who has O blood type. What is the chance that their next child will have blood type B? A. 0% B. 12.5% C. 25% D. 50% E. 100%

C. 25%

You are a genetic counselor. A man and a woman come to you and want to know what the probability that their unborn child will have a blistering skin condition - a recessive autosomal hereditary disease. Neither the man nor the woman have the disease, but both of their fathers do. What is the probability that their unborn child will be affected? A. 0% B. 6.25% C. 25% D. 50% E. 100%

C. 25%

An affected woman who is a heterozygote for an autosomal dominant trait is pregnant with a son. What is the probability that the son will be affected given that the dominant allele shows 60% penetrance? A. 0% B. 25% C. 30% D. 50% E. 75%

C. 30%

A human female "carrier" who is heterozygous for the recessive, sex-linked trait color blindness marries a male who is red-green color blind. What is the probability that their male progeny will have red-green color blindness? A. 25% B. 33.3% C. 50% D. 75% E. 100%

C. 50%

The maximum observable frequency of recombination between two genes is A. 100% B. 80% C. 50% D. 10% E. 1%

C. 50%

5000 Thailand natives were tested for their MN blood grouping. This allele has incomplete dominance and analysis indicated a phenotypic distribution of 600M, 4000MN, 400N. What is the frequency of the M allele? A. 4600/5000 =0.92 B. 4400/5000 = 0.88 C. 5200/10000 = 0.52 D. 1200/10000 = 0.12 E. 800/10000 = 0.08

C. 5200/10000 = 0.52

Below is the start of a hypothetical protein coding gene. How many amino acids long will the resulting protein be? 5' CGAATGAGGCACCACACCCCCTAA 3'3' GCTTACTCCGTGGTGTCGGGCATT 5' A. 8 B. 7 C. 6 D. 5 E. None, this is junk DNA

C. 6

You cross two mice, both of which are double heterozygous and have brown fur and long tails. Brown (Y) is dominant to yellow fur (y) and long tails (T) are dominant to short tails (t). What is the probability that they will have four offspring that includes two offspring with brown fur and long tails and two offspring with yellow fur and long tails? A. 56.3% and 18.8% B. 1.1% C. 6.7% D. 19.8% E. 35.2%

C. 6.7%

Some XY individuals are phenotypically females. What chromosomal abnormality could account for this? A. mosaicism B. dosage compensation C. a deletion of the portion of the Y chromosome containing the testis determining factor D. mitotic segregationE. Fragile X syndrome

C. A deletion of the portion of the Y chromosome containing the testis-determining factor

The products of crossing-over within the paracentric inversion include A. submetacentric chromosome B. robertsonian translocation C. a dicentric and an acentric chromatid D. two monocentric chromatids with deletions and duplications

C. A dicentric and an acentric chromatid

In meiosis, separation of the sister chromatids occurs during A. Telophase II B. Metaphase II C. Anaphase II D. Anaphase I E. Metaphase I

C. Anaphase II

(5 pts.) An albino mouse is testcrossed to a true-breeding brown dilute stock ( bb CC dd ). The mating produces a set of litters with a total of 15 dilute and 11 black mice. The genotype of the albino mouse is A. BB cc DD B. Bb cc DD C. Bb cc Dd D. BB cc Dd E. bb Cc dd

C. Bb cc Dd

An albino mouse is testcrossed to a true-breeding brown dilute stock ( bb CC dd ). The mating produces a set of litters with a total of 9 brown dilute, 7 dilute, 7 brown, and 8 black mice. The genotype of the albino mouse is A. BB cc DD B. Bb cc DD C. Bb cc Dd D. BB cc Dd E. bb Cc dd

C. Bb cc Dd

Which of the following statements is TRUE of polypeptide chains and nucleotide chains? A. Both have a sugar-phosphate backbone. B. Both are chains consisting of 20 types of repeating units. C. Both are linear and unbranched (basic units NOT chemical structure). D. Both types of molecules contain unambiguous and interconvertible triplet codes.

C. Both are linear and unbranched (basic units NOT chemical structure).

Which of the following results from a physical exchange between chromatids of homologous chromosomes in meiosis? A. Bivalent B. Meiotic division C. Chiasma D. Tetrad E. Synapsis

C. Chiasma

How is a tRNA able to recognize its proper mRNA codon? A. The amino acid on the tRNA recognizes the mRNA codon through hydrogen and ionic bonding. B. Appropriate shape of the tRNA allows it to fit onto the extended mRNA strand. C. Complementary hydrogen bonding between the anticodon of the tRNA and the codon of the mRNA. D. Ionic bonds between the tRNA and the active site of the ribosomal subunits promote binding to the mRNA. E. Hydrogen bonding between the ribosomal subunits and mRNA creates the proper active site conformation to allow tRNA binding

C. Complementary hydrogen bonding between the anticodon of the tRNA and the codon of the mRNA.

The following are statements about genotype and phenotype. Which one is NOT true: A. An individual's alleles constitute its genotype, whereas observable traits (biochemical, behavioral, and others) constitute its phenotype. B. Phenotype is totally determined by genotype. C. Different genotypes can give rise to the same phenotype. D. There is no one-to-one correspondence between genotype and phenotype.

C. Different genotypes can give rise to the same phenotype.

A mutant bread mold line is identified that has a mutation for at least one enzyme is the Arginine Amino Acid synthesis pathway. Using the pathway pictured below with three Arginine intermediary requirements for Arginine production, cultures are grown on minimal media with Precursor's, Ornithine, Citrulline, and Arginine separately (i.e., 4 test cultures). Among the cultures, growth occurs in the Citrulline and Arginine supplemented media. Which of the following conclusions can we make about these results?Metabolic pathway for Arginine: Precursor --> ENZYME 1 --> Ornithine --> ENZYME 2 --> Citrulline --> ENZYME 3 --> Arginine A. Enzyme 2 is functional. B. Enzyme 3 is functional C. Enzyme 3 is mutated and non-functional D. Enzyme 1 is mutated and non-functional E. A, B, and D are ALL true

C. Enzyme 3 is mutated and non-functional

What did the Griffith Experiment prove? A. DNA is the molecule of inheritance. B. Dead Strep pneumonia can still be lethal C. Factors of inheritance (as yet unknown) can be transmitted between pneumonia strains. D. All of the above

C. Factors of inheritance (as yet unknown) can be transmitted between pneumonia strains.

Regions of the chromosome with very few functional genes are called a. euchromatin b. chromatin c. heterochromatin d. mid repetitive sequences e. nucleosomes

C. Heterochromatin

What kind of bond is formed between complementary base pairs to join the two DNA strands into a double helix? A. Ionic bond B. Phosphodiester bond C. Hydrogen bond D. Disulfide bond E. Peptide bond

C. Hydrogen bond

The mode of cell division that results in four daughter cells that are genetically different, with each cell containing one haploid set of chromosomes, is known as A. Mitosis B. Cell Division C. Meiosis D. Interphase E. Diakinesis

C. Meiosis

In the specialized transduction of a strain pro-leu- of E. coli using bacteriophage l from a pro+leu+ lysogen, what medium would select for pro+ transductants without selecting for leu+? (Assume NO cotransduction) A. Minimal medium B. Minimal medium + proline C. Minimal medium + leucine D. Minimal medium + proline + leucine

C. Minimal medium + leucine

Two pure-breeding mutant plants produce white flowers. When they are crossed, all of the progeny have wild-type purple flowers. What does this genetic complementation tell you? A. The genes are part of two distinct biosynthetic pathways. B. The two lines exhibit different mutations in the same gene. C. More than one gene is involved in determining the phenotype. D. The allele is pleiotropic E. The allele exhibits incomplete dominance.

C. More than one gene is involved in determining the phenotype.

Red-green colorblindness is an X-linked trait in humans. A man with normal color vision is married to a woman with normal vision whose father was colorblind. They have a daughter with Turner Syndrome (45, X0) who is colorblind. The best explanation for this is A. Nondisjunction at meiosis I in the father B. Nondisjunction at meiosis II in the father C. Nondisjunction at an unknown division in the father D. Nondisjunction at meiosis I in the mother E. Nondisjunction at meiosis II in the mother

C. Nondisjunction at an unknown division in the father

Which of the following is a single unit, made up of a sugar, a phosphate group, and adenine? A. Nucleic acid B. Nitrogenous base C. Nucleotide D. Base pair E. None of the above

C. Nucleotide

Crossing over occurs during __________________ A. Anaphase of meiosis I B. Anaphase of meosis II C. Prophase of meiosis I D. Prophase of meiosis II E. None of the above

C. Prophase of meiosis I

An event in which the centromeric regions of two non-homologous acrocentric chromosomes become fused to form a singular centromere is know as a(n) A. reciprocal translocation B. nonreciprocal transversion C. robertsonian translocation D. louisian translocation E. inversion

C. R,obertsonian translocation

The portion of cell cycle during which the chromosomes are replicated is called a. G1 b. G2 c. S d. M e. prophase

C. S

The questions below consist of five phrases or sentences concerned with the cell cycle. For each one, select the answer below that is most closely related to it. Each answer may be used once, more than once, or not at all. A. G0 B. G1 C. S D. G2 E. M 22) DNA is replicated at this time of the cell cycle.-

C. S

The genetic code is degenerate because A. mRNA is rapidly degraded. B. The code is not universal among organisms. C. Some amino acids have more than one codon. D. Frameshift mutations are tolerated. E. Stop codons may have corresponding tRNA molecules.

C. Some amino acids have more than one codon.

DNA polymerase III A. Proofreads new DNA B. Unzips the DNA helix C. Synthesizes primer D. Joins Okasaki fragments E. Removes fragments

C. Synthesizes primer

What does it mean for two codons to be synonymous? A. they share two of the same nucleotides in their codon sequence. B. They share one of the same nucleotides in their codon sequence. C. They encode the same amino acid. D. They are adjacent on the mRNA. E. They occur in equal abundance in an mRNA sequence.

C. They encode the same amino acid.

RNA is synthesized on a DNA template in a process called ______, which utilizes the enzyme _______ A. translation, RNA polymerase B. transcritpion, DNA polymerase C. transcription, RNA polymerase D. replication, DNA polymerase

C. Transcription, RNA polymerase

Mitosis is a process of cell division that results in A. Two unique daughter cells B. Four unique daughter cells C. Two identical daughter cells D. Three identical daughter cells E. Four identical daughter cells

C. Two identical daughter cells

Which of the following is false regarding denaturation of DNA? A. Each chain makes one complete turn every 34 angstroms. B. Hydrogen bonds are the main force holding the strands together. C. Two strands are parallel. D. The purine adenine base pairs with the pyrimidine thymine. E. The paired bases are parallel to one another and perpendicular to the long axis of the helix.

C. Two strands are parallel.

Which dosage compensation mechanism is employed by female mammals? A. Synteny B. Y-inactivation C. X-inactivation D. X-nondisjunction E. X chromosome crossing over

C. X-inactivation

The most likely mode of inheritance is A. Autosomal dominant B. Autosomal recessive C. X-linked dominant D. X-linked recessive E. There is not enough information to solve the problem.

C. X-linked dominant

probabilities are calculated using the addition rule when they A. are equally likely. B. are independent. C. are mutually exclusive. D. occur disproportionately.

C. are mutually exclusive.

In Drosophila, black body is caused by a recessive mutation symbolized b, while cinnabar eyes are caused by a recessive mutation symbolized cn. Females that are phenotypically wild type (tan body, brick-red eyes) are crossed to homozygous black cinnabar (b cn / b cn) tester males. Four progeny types are seen in the frequencies shown below. PhenotypeGenotypeNumber wild type+ + / b cn27black cinnabarb cn / b cn23blackb + / b cn239cinnabar+ cn / b cn211 a. (5 pts.) What is the genotype of the female parents? A. + + / + + B. b cn / + + C. b + / + cn D. b b / cn cn E. There is not enough information to solve the problem.

C. b + / + cn

Which mode of inheritance results in both alleles being detected equally in the heterozygous phenotype? A. complete dominance B. incomplete dominance C. codominance D. epistasis E. incomplete penetrance

C. codominance

A cat with color at the points is mated to an albino, producing a litter of four kittens: two with color at the points and two albinos. The genotypes of the parents in this cross are A. cscs x csc B. csc x csc C. csc x cc D. cscs x cc E. There is not enough information to solve the problem.]

C. csc x cc

Two cats with color at the points are mated, producing a litter of four kittens: two with color at the points and two albinos. The genotypes of the parents in this cross are A. cscs x cscs B. cscs x csc C. csc x csc D. csc x cc E. There is not enough information to solve the problem.

C. csc x csc

A palindrome is a sequence that A. reads differently when read from either direction B. can be found in multiple origins of replication C. is the same when read from either 5' to 3'direction D. is used as a primer in DNA replication E. contains only purines

C. is the same when read from either 5' to 3'direction

What type of allele is often detected as a distortion in segregation ratios, where one class of expected progeny is missing? A. dominant negative allele B. temperature-sensitive allele C. lethal allele D. partially dominant allele E. incompletely penetrant allele

C. lethal allele

The process of cell division that ensures that each of the two daughter cells receives a complement of chromosomes identical with the complement of the parent cell is known as a. Meiosis b. Replication c. Mitosis d. Nondisjunction e. Crossing over

C. mitosis

In families where both parents are heterozygous for a recessive trait, what is their probability of having a child with the homozygous recessive genotype? A.1 B.1/2 C.1/4 D.3/4

C.1/4

Two parents with blood types A and B have a child who has O blood type. What is the chance that their next child will be A? A. 0 B.1/2 C.1/4 D.1

C.1/4

The situation in which an expected phenotype is not expressed is referred to as A.pleiotropy. B.variable expressivity. C.incomplete penetrance. D.recessivity

C.incomplete penetrance.

Which statement is true about the determination of sex in humans? A: An individual with an X and a Y will always be male. B: The SRY gene alone can determine maleness. C: An individual may have some genes producing proteins for maleness and other genes producing proteins for femaleness. D: Any individual without a Y chromosome will always become a female.

C: An individual may have some genes producing proteins for maleness and other genes producing proteins for femaleness.

Any gene located on a sex chromosome A: is called a recessive gene. B: will exhibit pleiotropy. C: is called a sex-linked gene .D: will exhibit codominance.

C: is called a sex-linked gene

Amniocentesis and chorionic villus sampling allow for ________ and ________ of the fetus so that it can be tested for abnormalities. A: imaging; karyotyping B: direct observation; biochemical testing C: karyotyping; biochemical testing D: sexing; imaging

C: karyotyping; biochemical testing

Sex-linked conditions are more common in men than in women because A: men acquire two copies of the defective gene during fertilization. B: most genes associated with the sex-linked conditions are linked to the Y chromosome, which determines maleness. C: men need to inherit only one copy of the recessive allele for the condition to be fully expressed. D: the sex chromosomes are more active in men than in

C: men need to inherit only one copy of the recessive allele for the condition to be fully expressed.

What is the usual complement of sex chromosomes in a human male? A: two Y chromosomes and zero X chromosomes B: one Y chromosome and zero X chromosomes C: one X chromosome and one Y chromosome D: two X chromosomes and one Y chromosome

C: one X chromosome and one Y chromosome

gene are found at ________ chromosomes. A: different loci on nonhomologous B: different loci on homologous C: the same locus on homologous D: the same locus on nonhomologous

C: the same locus on homologous

DNA ligase functions to

Catalyze the formation of covalent bonds between adjacent 5'-P and 3'-OH termini

The most common statistical analysis of Mendel's experiment is

Chi-square analysis

Homologous chromosomes

Chromosome pairs, one from each parent, that are similar in length, gene position and centromere locatio

The ratio of the observed double crossovers divided by the expected number of double crossovers is

Coefficient of coincidence

Which of the following is NOT a modification of eukaryotic mRNA?

Coupling of transcription and translation

There are three common ways that the function of regulatory transcription factors can be affected. The regulation of CREB protein is an example of ________

Covalent modification

In RNA editing, Uracil is generated from deamination of ______

Cytosine

Pyrimidines

Cytosine and Thymine, single single structure

In certain plants, the tall trait is dominant to the short trait. If a heterozygous plant is crossed with a homozygous tall plant, what is the probability that the offspring will be short? A) 1 B) 1/2 C) 1/4 D) 0

D) 0

The figure above shows a pedigree chart for a family, some of whose members exhibit the dominant trait, W. Affected individuals are indicated by a dark square or circle. What is the probability that individual III-1 is Ww? A) 3/4 B) 1/4 C) 2/4 D) 1

D) 1

In a particular plant, leaf color is controlled by gene locus D. Plants with at least one D allele have dark green leaves, and plants with the homozygous recessive dd genotype have light green leaves. A true-breeding dark-leaved plant is crossed with a light-leaved one, and the F1 offspring is allowed to self-pollinate. The predicted outcome of the F2 is diagrammed in the Punnett square shown in the figure above, where 1, 2, 3, and 4 represent the genotypes corresponding to each box within the square. Which of the boxes marked 1-4 correspond(s) to plants with dark leaves? (Punnett square Dd x Dd) A) 1 only B) 1 and 2 C) 2 and 3 D) 1, 2, and 3

D) 1, 2, and 3

Black fur in mice (B) is dominant to brown fur (b). Short tails (T) are dominant to long tails (t). What fraction of the progeny of crosses BbTt × BBtt will be expected to have black fur and long tails? A) 1/16 B) 3/16 C) 3/8 D) 1/2

D) 1/2

In the cross AaBbCc × AaBbCc, what is the probability of producing the genotype AABBCC? A) 1/4 B) 1/8 C) 1/16 D) 1/64

D) 1/64

A man who is a dwarf due to achondroplasia and has normal vision marries a color-blindwoman of normal height. The man&#39;s father was 6 feet tall, and both the woman&#39;s parents were ofaverage height. Achondroplasia is autosomal dominant, and red-green color blindness is X-linked recessive.They have a daughter who is a dwarf with normal color vision. What is the probability that she isheterozygous for both genes? A) 0% B) 25% C) 50% D) 100%

D) 100%

Cinnabar eyes is a sex-linked recessive characteristic in fruit flies in which the eyes of the individual are lighter in color than the normal wild-type red color. If a female having cinnabar eyes is crossed with a wild-type male, what percentage of the F1 males will have cinnabar eyes? A) 0% B) 25% C) 50% D) 100%

D) 100%

How many different combinations of maternal and paternal chromosomes can be packaged in gametes made by an organism with a diploid number of 8(2n = 8)?A) 2 B) 4 C) 8 D) 16 E) 32

D) 16

Drosophila (fruit flies) usually have long wings (+ is the symbol used to represent this allele), but mutations in two different genes can result in bent wings (bt) or vestigial wings (vg). The bent and vestigial wing alleles segregate independently. In symbolizing fruit fly alleles, it iscommon to use two letters as opposed to only one. If flies that have long wings and are heterozygous for both the bent wing gene and the vestigial wing gene are mated, what is the probability of offspring with bent wings only? A) 1/8 B) 3/8 C) 1/4 D) 3/16

D) 3/16

Assume that you are trying to amplify a single gene on a piece of single stranded DNA. After 5 rounds of PCR how many copies would you have (again, assume you started with a single strand of DNA)? A) 5 B) 10 C) 25 D) 32 E) 64

D) 32

Radish flowers may be red, purple, or white. A cross between a red-flowered plant and a white-flowered plant yields all-purple offspring. The part of the radish we eat may be oval or long, with long being the dominant trait. True-breeding red-flowered long radishes are crossedwith true-breeding white-flowered radishes. All of the F1 offspring are purple-flowered and long radishes. In the F2 generation of this cross, which of the following phenotypic ratios would be expected?A) 9:3:3:1 B) 9:4:3 C) 1:1:1:1 D) 6:3:3:2:1:1

D) 6:3:3:2:1:1

Amino acids always have: A) Positively charged side groups B) Negatively charged side groups C) Hydrophobic (non-polar) side groups D) A carboxyl group E) Side groups containing sulfur atoms

D) A carboxyl group

This sugar is: A) A phosphodiester B) A nucleotide sugar C) An amino sugar D) A deoxyribose sugar E) A ribose suga

D) A deoxyribose sugar

Which of the following statements regarding promoters is NOT true?A) The promoter region is not transcribed B) The promoter region is not translated C) The closer the promoter region is to the consensus (the more conserved it is), the stronger the promoter D) A missing promoter leads to a problem with ribosomal binding E) Eukaryotic promoters contain a TATA box near the -25 position

D) A missing promoter leads to a problem with ribosomal binding

All seven of the pea plant traits studied by Mendel obeyed the principle of independent assortment. Which of the following statements correctly describes what this indicates about those traits? A) None of the traits obeyed the law of segregation. B) Some traits obeyed the law of segregation, and some did not. C) All of the genes controlling the traits were located on the same chromosome. D) All of the genes controlling the traits behaved as if they were located on different

D) All of the genes controlling the traits behaved as if they were located on different

Which of these statements is false?A) In humans, each of the 22 maternal autosomes has a homologous paternal chromosome. B) In humans, the 23rd pair, the sex chromosomes, determines whether the person is female (XX) or male (XY). C) Single, haploid (n) sets of chromosomes in ovum and sperm unite during fertilization, forming a diploid (2n), single-celled zygote. D) At sexual maturity, ovaries and testes produce diploid gametes by meiosis. E) Sexual life cycles differ with respect to the relative timing of meiosis and fertilization.

D) At sexual maturity, ovaries and testes produce diploid gametes by meiosis.

Which of the following allows a transposable element to cut itself out of the genome and paste itself into a new location? A) DNA Polymerase B) Transposase C) Terminal Inverted Repeats D) B and C E) All of the above

D) B and C

Which of the following calculations described in the following statements require that you use the addition rule?A) Calculate the probability of black offspring from the cross AaBb × AaBb, when B is the symbol for the black allele. B) Calculate the probability of children with both cystic fibrosis and polydactyly when parents are each heterozygous for both genes. C) Calculate the probability of each of four children having cystic fibrosis if the parents are both heterozygous. D) Calculate the probability of a child having only sickle-cell anemia or cystic fibrosis if each parent is each heterozygous for both traits.

D) Calculate the probability of a child having only sickle-cell anemia or cystic fibrosis if each parent is each heterozygous for both traits.

You have a plant with an unknown genotype, but you are interested in the heredity of two linked genes: one gene has alleles W (red flowers) and w (white flowers) and the other gene has alleles F (smooth leaves) and f (fuzzy leaves). You perform a test cross with your unknown plant and produce the following progeny:Phenotype Number of offspringRed flowers, fuzzy leaves 18Red flowers, smooth leaves 136White flowers, fuzzy leaves 112White flowers, smooth leaves 9What can you determine about the unknown parents genotype? A) Trans conformation, Wf/WF B) Cis conformation, Wf/Wf C) Trans conformation, WF/wf D) Cis conformation, WF/wf E) Trans conformation, Wf/wF

D) Cis conformation, WF/wf

Labrador retrievers are black, brown, or yellow. In a cross of a black female with a brown male, results can be all black puppies, 1/2 black to 1/2 brown puppies, or 3/4 black to 1/4 yellow puppies. These results indicate which of the following about the inheritance pattern of fur colorin Labrador retrievers? A) Brown is dominant to black. B) Black is dominant to brown and to yellow. C) Yellow is dominant to black. D) Epistasis is involved.

D) Epistasis is involved.

Which of the following statements about bacterial conjugation is incorrect? A) F+ cells act as genetic donors B) Genes on the F factor encode proteins for cell-cell contact and the formation of sex pili C) F+ cells can convert F- cells into F+ cells D) F' cells have especially high rates of recombination E) The F factor is transferred as a single strand

D) F' cells have especially high rates of recombination

Three genes (A, B, and C) at three loci are being mapped in a particular species. Each gene has two alleles, each of which results in a dominant or recessive phenotype. The dominant allele of gene A is inherited with the dominant allele of gene B or C about 50% of the time. However, the dominant alleles of genes B and C are inherited together 14.4% of the time. Which of the following statements describes what is happening regarding the inheritance of these genes? A) The three genes are showing independent assortment. B) The three genes are linked. C) Gene A is linked but genes B and C are not. D) Gene A is assorting independently of genes B and C, which are linked.

D) Gene A is assorting independently of genes B and C, which are linked.

A sexually reproducing animal has two unlinked genes, one for head shape (H) and one fortail length (T). Its genotype is HhTt. Which of the following genotypes is possible in a gametefrom this organism? A) tt B) Hh C) HhTt D) HT

D) HT

A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. Which of the following is a possible partial genotype for the mother? A) IAIA B) IBIB C) ii D) IAi

D) IAi

A women who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. Which of the following is a possible genotypefor the son? A) IBIB B) IAIB C) ii D) IBi

D) IBi

A couple has a child with Down syndrome. The mother is 39 years old at the time of delivery. Which of the following is the most probable cause of the child's condition? A) The woman inherited this tendency from her parents. B) One member of the couple carried a translocation. C) Nondisjunction occurred in one member of the couple during somatic cell production. D) Nondisjunction occurred in one member of the couple during gamete production.

D) Nondisjunction occurred in one member of the couple during gamete production.

Why did the F1 offspring of Mendel's classic pea cross always look like one of the two parental varieties? A) No genes interacted to produce the parental phenotype. B) Each allele affected phenotypic expression. C) The traits blended together during fertilization. D) One allele was dominant.

D) One allele was dominant.

How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle? A) The daughter cells have half the amount of cytoplasm and half the amount of DNA. B) The daughter cells have half the number of chromosomes and half the amount of DNA. C) The daughter cells have the same number of chromosomes and half the amount of DNA. D) The daughter cells have the same number of chromosomes and the same amount of DNA. E) The daughter cells have the same number of chromosomes and twice the amount of DNA

D) The daughter cells have the same number of chromosomes and the same amount of DNA.

You perform a dihybrid cross between two heterozygotes. The resulting offspring are not in the expected 9:3:3:1 phenotypic ratio, but instead have a modified dihybrid ratio of 12:3:1. What could cause this? A) A homozygous recessive mutation in either or both of two different genes results in the same mutant phenotype B) Homozygosity for a recessive allele with respect to one gene masks the expression of the genotype of a different gene. C) Homozygosity for a recessive allele of either of two genes results in the same phenotype but the phenotype of the double homozygote is distinct D) The presence of a dominant allele of one gene masks the genotype of a different gene. E) Homozygosity for a dominant allele of either of two genes results in the same phenotype but the phenotype of the double homozygote is distinct

D) The presence of a dominant allele of one gene masks the genotype of a different gene.

How do cells at the completion of meiosis compare with cells that have replicated their DNA and are just about to begin meiosis? A) They have twice the amount of cytoplasm and half the amount of DNA. B) They have half the number of chromosomes and half the amount of DNA. C) They have the same number of chromosomes and half the amount of DNA. D) They have half the number of chromosomes and one-fourth the amount of DNA. E) They have half the amount of cytoplasm and twice the amount of DNA.

D) They have half the number of chromosomes and one-fourth the amount of DNA.

Which of the following phases of cell division confirms Mendel's observation of the segregation of alleles in gamete formation? A) prophase I of meiosis B) anaphase II of meiosis C) metaphase I of meiosis D) anaphase I of meiosis

D) anaphase I of meiosis

The figure above represents a pedigree for a family in which dark-shaded symbols represent individuals with one of the two major types of colon cancer. Numbers under the symbols are the individuals' age at the time of diagnosis. A slash through the symbol indicates that the individual is deceased. From this pedigree, what is the most likely manner by which this trait is inherited? A) from mothers B) as a recessive trait C) as a result of epistasis D) as a dominant trait

D) as a dominant trait

In a series of mapping experiments, the recombination frequencies for four different linked genesof Drosophila were determined as shown in the figure above. Based on these frequencies, whatis the order of these genes on a chromosome map? A) rb-cn-vg-b B) vg-b-rb-cn C) cn-rb-b-vg D) b-rb-cn-vg

D) b-rb-cn-vg

Which of the following results might be caused by a chromosomal translocation? A) deletion only B) exchange of homologous chromosome fragments C) nondisjunction D) exchange of nonhomologous chromosome fragments

D) exchange of nonhomologous chromosome fragments

After telophase I of meiosis, the chromosomal makeup of each daughter cell is A) diploid, and the chromosomes are each composed of a single chromatid. B) diploid, and the chromosomes are each composed of two chromatids. C) haploid, and the chromosomes are each composed of a single chromatid. D) haploid, and the chromosomes are each composed of two chromatids. E) tetraploid, and the chromosomes are each composed of two chromatids

D) haploid, and the chromosomes are each composed of two chromatids.

The human X and Y chromosomes A) are both present in every somatic cell of males and females alike. B) are of approximately equal size and number of genes. C) are almost entirely homologous, despite their different names. D) include genes that determine an individual's sex. E) include only genes that govern sex determination.

D) include genes that determine an individual's sex.

Radish flowers may be red, purple, or white. A cross between a red-flowered plant and awhite-flowered plant yields all-purple offspring. The part of the radish we eat may be oval orlong, with long being the dominant trait. True-breeding red-flowered long radishes are crossedwith true-breeding white-flowered radishes. All of the F1 offspring are purple-flowered and longradishes. The flower color trait in radishes is an example of which of the following types ofinheritance? A) a multiple allelic system B) sex linkage C) codominance D) incomplete dominance

D) incomplete dominance

Males are more often affected by sex-linked traits than females because A) sex-linked traits are located on autosomes that affect males more severely than females. B) the presence of a Y chromosome often worsens the effects of X-linked mutations. C) X chromosomes in males generally have more mutations than X chromosomes in females. D) males are hemizygous for the X chromosome.

D) males are hemizygous for the X chromosome.

Characters in humans such as a person's red and white blood cell counts vary quite a bit depending on such factors as altitude and physical activity. Traits like this are referred to as A) polygenic. B) completely dominant. C) recessive. D) multifactorial.

D) multifactorial.

What is the source of the extra chromosome 21 in an individual with Down syndrome? A) nondisjunction in the mother only B) nondisjunction in the father only C) duplication of the chromosome D) nondisjunction in either parent

D) nondisjunction in either parent

Skin color in humans has a wide variety of phenotypes. The expression of this trait is caused by more than two genes. What type of inheritance pattern is responsible for this expression? A) codominance B) incomplete dominance C) complete dominance D) polygenic inheritance

D) polygenic inheritance

Radish flowers may be red, purple, or white. A cross between a red-flowered plant and a white-flowered plant yields all-purple offspring. The part of the radish we eat may be oval or long, with long being the dominant trait. If true-breeding red-flowered long radishes are crossedwith true-breeding white-flowered oval radishes, the F1 will be expected to be which of the following?A) red-flowered and long B) red-flowered and oval C) white-flowered and long D) purple-flowered and long

D) purple-flowered and long

Which of the following events of meiosis I confirms Mendel's second law of independent assortment? A) synapsis of homologous chromosomes B) crossing over C) alignment of synapsed pairs of homologous chromosomes on the metaphase plate D) separation of homologs at anaphase

D) separation of homologs at anaphase

Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait. What does this suggest about the trait? A) that the parents were true-breeding for contrasting traits B) that the trait shows incomplete dominance C) that a blending of traits has occurred D) that the parents were both heterozygous for a single trait

D) that the parents were both heterozygous for a single trait

In cats, black fur color is caused by an X-linked allele; the other allele at this locus causes orange color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a black female and an orange male? A) tortoiseshell females; tortoiseshell males B) black females; orange males C) orange females; orange males D) tortoiseshell females; black males

D) tortoiseshell females; black males

One possible result of chromosomal breakage is for a fragment to join a nonhomologous chromosome. What is this alteration called? A) deletion B) transversion C) inversion D) translocation

D) translocation

Tallness (T) in snapdragon plants is dominant to dwarfness (t), and red (CR) flower color is not dominant to white (CW). The heterozygous condition results in pink (CRCW) flower color. A dwarf red snapdragon is crossed with a plant homozygous for tallness and white flowers. What are the genotype and phenotype of the F1 individuals? A) W— ttCRCW, dwarf and pink B) — ttCWCW, dwarf and white C) —TtCRCW, tall and red D) —TtCRCW, tall and pink

D) —TtCRCW, tall and pink

A trait caused by a recessive X-linked allele in a large, randomly mating population affects 1 male in 100. What is the frequency of affected females? A. 1 in 10 B. 1 in 100 C. 1 in 1,000 D. 1 in 10,000 E. 1 in 100,000

D. 1 in 10,000

A couple has four children. What is the probability that they have four boys? A. 1/2 B. 1/4 C. 1/8 D. 1/16 E. 1/32

D. 1/16

Three genes (A, B, and C) show independent assortment. What is the probability that AaBbCc x AAbbCc will produce Aabbcc? A. 1/2 B. 1/4 C. 1/8 D. 1/16 E. 1/32

D. 1/16

From the pedigree shown below, calculate the probability that individual IV-4 will have 3 affected sons if individual IV-4 marries an unaffected person (assume the disorder is rare). A. 0% B. 1.6% C. 6.25% D. 12.5% E. 50.0%

D. 12.5%

A single, human cell has _______ number of chromosomes after the first meiotic division and the cell is considered ________ A. 22, haploid B. 46, haploid C. 46, diploid D. 23, haploid E. 46, pleiotrophic

D. 23, haploid

In a cross, F2 progeny exhibit a modified dihybrid ratio of 12:3:1. What phenotypic ratio would be expected from a test-cross with one of the F1 progeny? A. 1:3:1 B. 1:2:1 C. 1:1:1 D. 2:1:1 E. 3:1:1

D. 2:1:1

The sequence of one strand of DNA is 5'-GTTAG-3' the sequence of the RNA transcribed using this strand as a template would be a. 5'-GCTTTAG-3' b. 5'-CTAAAGC-3' c. 5'-CTUUUGC-3' d. 5'-CUAAAGC-3' e. 5'-GCUUUAG-3'

D. 5'-CUAAAGC-3'

In a random sequence consisting of equal proportions of all four nucleotides, what is the average distance between consecutive occurrences of the restriction sites for the Hinf I 5'-GAYTC-3', where Y stands for any pyrimidine? A. 64 bp (4 x 4) B. 128 bp (4 x 4 x 2) C. 256 bp (44) D. 512 bp (44 x 2)

D. 512 bp (44 x 2)

You cross two P1 hamsters, each of which are heterozygous for three genes (BbDdFf). All three genes display complete dominance and assort independently. The parental hamsters all have big ears (Bb), dark coats (Dd) and full tails (Ff). What is the probability that an offspring will have a phenotype that is different in some way from that of the parents? A. 1.6% B. 15.7% C. 43.9% D. 57.8% E. 71.9%

D. 57.8%

A chicken researcher has identified a new disease that is more common in females (ZW) than males (ZZ). What is(are) reason(s) explaining this finding A. The disease is a sex linked recessive disorder B. The disease is autosomal dominant C. Females are Hemizygous D. A and C E. B and C

D. A and C

Which of the following is TRUE about splicing in Eukaryotes? A. Splicing removes introns B. Splicing is necessary to create functional proteins C. Multiple snRPS are required for splicing to occur properly D. All of the Above are True E. None of the Above are True

D. All of the Above are True

Which of the following checkpoints can cell development be arrested at A. At the G1/S transition B. At the G2/M boundary C. In the S period D. All of the above E. All but C

D. All of the above

Once transcription has been completed, which of the following is NOT necessary for protein synthesis to occur? A. tRNA B. Ribosomes C. mRNA D. DNA

D. DNA

Wing patch color in one species of bird is controlled by incompletely dominant alleles so that bright orange and white are homozygous, while peach is heterozygous. The cross of two peach individuals will produce A. All peach offspring B. Equal numbers of white and orange winged offspring, but no peach offspring. C. Equal numbers of orange, peach and white winged offspring. D. Equal numbers of white and orange winged offspring, and twice as many peach winged offspring as the other two colors. E. Equal numbers of orange and white winged offspring.

D. Equal numbers of white and orange winged offspring, and twice as many peach winged offspring as the other two colors.

An enzyme used to separate DNA strands during replication is called a what? A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase

D. Helicase

Turner syndrome is the result of A. trisomy of the X chromosome B. the presence of an extra Y chromosome C. the absence of a Y chromsome D. monosomy of the X chromosome E. an extra chromosome number

D. Monosomy of the X chromosome

The presence in a population of more than two alleles of a gene is called A. Mutant B. Codominant C. Pleiotropic D. Multiple alleles E. Dihybrid

D. Multiple alleles

The process by which a single strand of DNA is used as a template to build a complementary daughter strand is called (what?) A. Transcription B. Translation C. Mitosis D. Replication E. Meiosis

D. Replication

During DNA replication, each strand acts as a ________ for the generation of new _____________. A. Replicate, complimentary strand B. Template, identical strand C. Origin, double helix D. Template, complimentary strand E. Primer, mRNA transcript

D. Template, complimentary strand

If an affected male has all affected daughters and no affected sons, the trait is likely to be: A. Autosomal recessive B. X linked recessive C. Autosomal dominant D. X linked dominant E. Y linked

D. X linked dominant

The generally negative effects caused by inbreeding are due to A. an increase in the mutation rate B. an increase in genetic variability that disrupts developmental sequences C. an increase in allozygosity of all alleles D. an increase in homozygosity of recessive deleterious alleles E. none of the above

D. an increase in homozygosity of recessive deleterious alleles

Biological sex in some species, such as Drosophila, is determined by genes present on both the ________. A. haploid and diploid chromosomes B. nuclear and mitochondrial DNA C. stem and gonad cells D. autosomal and sex chromosomes E. Prophase and Telophase chromosomes

D. autosomal and sex chromosomes

Gene interactions in which an allele of the one gene modifies or prevents expression of alleles of another gene is known as _______. A. pleiotropy B. incomplete dominance C. codominance D. epistasis E. incomplete penetrance

D. epistasis

For an octoploid (8N) organism, meiosis results in the production of A. two 8N cells B. four 8N cells C. two 4N cells D. four 4N cells E. eight 2N cells

D. four 4N cells

What is the genotype of the woman? A.DdXnXc B. ddXnXc C. DdXnXc D.ddXnXn E.DdXcXx

D.ddXnXn

Which term refers to a situation where a single phenotypic character is determined by the additive effects of two or more genes? A: incomplete dominance B: pleiotropy C: codominance D: polygenic inheritance

D: polygenic inheritance

After removal of the RNA primers and replacement with DNA nucleotides, the single-stranded nick adjacent to Okazaki fragments is filled in through a reaction that involves which enzyme?

DNA ligase

Recombination frequencies

Decrease with distance

What property of the genetic code allows the use of several codons for a particular amino acid?

Degeneracy

In ABCD_EFGH, what is the following mutation?ABD_EFGH

Deletion

Is Tm a constant or can it depend on other small molecules in the solution? How does high salt concentration effect Tm?

Depends on small moleculesDecrease

The karyotype shown is associated with which of the following genetic disorders? (3 chromatids on the 21st chromosome)

Down syndrome

The following questions refer to the essential steps in meiosis described below. 1. formation of four new nuclei, each with half the chromosomes present in the parental nucleus 2. alignment of tetrads at the metaphase plate 3. separation of sister chromatids 4. separation of the homologues; no uncoupling of the centromere 5. synapsis; chromosomes moving to the middle of the cell in pairs 60) From the descriptions above, which of the following is the order that most logically illustrates a sequence of meiosis?-

E) 5, 2, 4, 3, 1

Which of the following best describes dosage compensation between the sexes in humans? A) A gene is translated from a long strand of RNA that is called the Xic, the gene product silences one X chromosome B) A gene is translated from a long strand of RNA that is called the Xist, the gene product silences one X chromosome C) A long strand of RNA is translated from a region called Xic, the RNA silences one X chromosome D) A long strand of RNA is transcribed from the Y chromosome, the RNA silences one X chromosome E) A long strand of RNA is transcribed from a region called Xist, the RNA silences one X chromosome

E) A long strand of RNA is transcribed from a region called Xist, the RNA silences one X chromosome

In the Meselson-Stahl experiment, which result provided convincing evidence of the semi-conservative replication of DNA? A) After the first round of DNA replication, all of the DNA was of an intermediate density B) After the first round of DNA replication, half of the DNA was light and half was heavy C) After the second round of DNA replication, all of the DNA was of an intermediate density D) After the second round of DNA replication, half of the DNA was heavy and half was light E) After the second round of DNA replication, half of the DNA was intermediate and half was light

E) After the second round of DNA replication, half of the DNA was intermediate and half was light

Chromatids are separated from each other. A) The statement is true for mitosis only. B) The statement is true for meiosis I only. C) The statement is true for meiosis II only. D) The statement is true for mitosis and meiosis I. E) The statement is true for mitosis and meiosis II.

E) The statement is true for mitosis and meiosis II.

In an experiment, you are interesting in two genes: W and R. The results of your experiment indicate a recombination frequency of 54.2%. What should you conclude from this? A) There are 54.2 cM between genes W and R B) There are .542 cM between genes W and R C) There are 5.42 cM between genes W and R D) The interference between genes W and R is .458 E) The two genes may be on two separate chromosomes

E) The two genes may be on two separate chromosomes

A mutation involving the substitution of a cytosine to a guanine is called a ____________? A) Frameshift mutation B) Insertion mutation C) Transition D) Transformation E) Transversion

E) Transversion

For the following question, match the key event of meiosis with the stages listed below.I. Prophase I V. Prophase IIII. Metaphase I VI. Metaphase IIIII. Anaphase I VII. Anaphase IIIV. Telophase I VIII. Telophase II 40) Centromeres of sister chromatids disjoin and chromatids separate. A) II B) III C) IV D) V E) VII

E) VII

Red-green color blindness is a sex-linked recessive trait in humans. The normal, dominant allele is symbolized with XN, and the recessive allele is symbolized with Xn. Two people with normal color vision have a color-blind son. What are the genotypes of these parents? A) XNXn and XnY B) XnXn and XNY C) XNXN and XnY D) XNXN and XNY E) XNXn and XNY

E) XNXn and XNY

During which phases of mitosis are chromosomes composed of two chromatids? A) from interphase through anaphase B) from G1 of interphase through metaphase C) from metaphase through telophase D) from anaphase through telophase E) from G2 of interphase through metaphase

E) from G2 of interphase through metaphase

Which is the longest of the mitotic stages? A) telophase B) anaphase C) prometaphase D) metaphase E) prophase

E) prophase

Which term describes centrioles beginning to move apart in animal cells? A) telophase B) anaphase C) prometaphase D) metaphase E) prophase

E) prophase

Which of the following defines a genome? A) representation of a complete set of a cell's polypeptides B) the complete set of an organism's polypeptides C) the complete set of a species' polypeptides D) a karyotype E) the complete set of an organism's genes

E) the complete set of an organism's genes

Two pure breeding plants for round and wrinkled seeds (respectively) are crossed to produce F1 offspring with round seeds. The F1s are crossed to produce 112 plants with round seeds and 38 plants with wrinkled seeds. If you did a testcross with the 112 plants that produced round seeds, what proportion of those plants would you expect to produce some offspring with wrinkled seeds? A. 1/16 B. 1/4 C. 1/3 D. 1/2 E. 2/3

E. 2/3

The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be _____________ A. 5'-GGUUACAUUC-3' B. 5'-CCAATGTAAG-3' C. 5'-CUUACAUUGG-3' D. 5'-CCTTUGUTTG-3 E. 5'-GAATGTAACC-3'

E. 5'-GAATGTAACC-3'

Inbreeding results in A. Increased frequencies of heterozygotes B. Increased frequencies of homozygotes C. Increased frequencies of rare recessive alleles D. Increased frequencies of dominant alleles E. All except A

E. All except A

Centromeres of sister chromatids disjoin and chromatids separate. A. Anaphase l B. Telophase l C. Metaphase ll D. Prophase ll E. Anaphase 11

E. Anaphase 11

The centromeres of sister chromatids uncouple and chromatids separate in which meiotic phase? A. Prophase I B. Anaphase I C. Metaphase II D. Telophase I E. Anaphase II

E. Anaphase II

Which of the following mutations in DNA sequence will most likely have significant effects on protein structure? A. Nucleotide changes that DO NOT change the Amino Acid codon B. Mutations that change the Amino Acid Polarity (i.e., hydrophobic or hydrophilic) C. Mutations that change Amino Acid R group charge (i.e., positive or negative) D. A and B E. B and C

E. B and C

Gene Transfer in bacteria can occur from which of the following types (instigator(s) of conjunction) of cells? A. F- B. F+ C. HFr D. A and B Only E. B and C Only

E. B and C Only

Why did Mendel use pea plants as his model? A. He could control their fertilization. B. Produced large numbers of progeny. C. Pea plant flowers are pretty D. He knew pea's have 7 chromosomes E. Both A and B are True

E. Both A and B are True

All DNA is stored in the nucleus as __________________ A. Euchromatin; DNA wrapped around protein complexes called nucleosomes B. Heterochromatin; DNA wrapped around protein complexes called nucleosomes C. Chromatin; DNA wrapped around protein complexes called H1 histones D. Euchromatin; DNA wrapped around proteins called H1 histones E. Chromatin; DNA wrapped around protein complexes called nucleosomes

E. Chromatin; DNA wrapped around protein complexes called nucleosomes

A process in which DNA is transferred from a bacterial donor cell to a recipient cell by cell-to-cell contact is known as A. Specialized transduction B. Generalized transduction C. Transformation D. Recombination E. Conjugation

E. Conjugation

The master sex-determining gene SRY that codes for the testis-determining factor, resides on A. the X chromosome. B. one of the autosomes. C. the pseudoautosomal region of the X chromosome. D. the pseudoautosomal region of the Y chromosome. E. in the short arm of the Y chromosome, but out of pseudoautosomal region.

E. In the short arm of the Y chromosome, but out of pseudoautosomal region

If the first nucleotide in a codon is mutated to a different nucleotide, what would be the effect on the encoded protein? A. No effect as the problem nucleotide would be corrected by RNA editing mechanisms. B. A missense mutation from one encoded amino acid changing to another. C. A frameshift mutation for all of the subsequent amino acids in the protein. D. A silent mutation and nochange in the encoded amino acid. E. It depends on what the changed nucleotide is.

E. It depends on what the changed nucleotide is.

The questions below consist of five phrases or sentences concerned with the cell cycle. For each one, select the answer below that is most closely related to it. Each answer may be used once, more than once, or not at all. A. G0 B. G1 C. S D. G2 E. M 21) the shortest part of the cell cycle-

E. M

What factor causes the allelic frequencies of a gene to shift due specifically to environmental change? A. Genetic drift B. High mutation rate C. Assortative mating D. Migration E. Natural selection

E. Natural selection

Which of the followings is NOT true? A. the core promoter in eukaryotes is composed of the TATA box and a transcription start site B. E. coli promoters have conserved sequences as -10 and -35 nucleotides upstream of the transcription start site C. the general transcription factors are necessary for the assembly of a transcription apparatus and recruitment of RNA polymerase II to a core promoter D. the regulatory elements are the binding site of specific transcription factors E. none of the above

E. None of the above

A gene has acquired a mutation in which the protein product has 50 additional amino acids at the end. Which region of the gene was likely mutated? A. Coding region B. Start codon C. Promoter sequence D. Terminator sequence E. Stop codon

E. Stop codon

During which phase of the cell cycle does the cell initiate replication of its nuclear DNA? A. Metaphase B. Gap 1 phase C. Gap 2 phase D. Gap 0 phase E. Synthesis phase

E. Synthesis phase

The arrow in this picture is pointing to _________ A. The gene rich euchromatin B. The gene rich heterochromatin C. The gene rich centromere D. The gene poor euchromatin E. The gene poor heterochromatin

E. The gene poor heterochromatin

The chromosome designation 11p refers to what? A. the long arm of chromosome 11 B. a partial deletion of chromosome 11 C. a specific band on chromosome 11 D. an inversion on chromosome 11 E. the short arm of chromosome 11

E. The short arm of chromosome 11

Use the following key to answer the following questions. Each answer may be used once, more than once, or not at all. A. The statement is true for mitosis only. B. The statement is true for meiosis I only. C. The statement is true for meiosis II only. D. The statement is true for mitosis and meiosis I. E. The statement is true for mitosis and meiosis II. 59) Centromeres uncouple and chromatids are separated from each other.-

E. The statement is true for mitosis and meiosis II.

Endonucleases A. connect two DNA fragments B. remove terminal nucleotides from the 3'-end of a polynucleotide chain C.remove amino acids from the carboxyl end of a polypeptide chain D. connect two oligopeptides E. break internal phosphodiester bonds in a single-or double stranded nucleic acid molecule

E. break internal phosphodiester bonds in a single-or double stranded nucleic acid molecule

The most common form of color blindness in human beings results from X-linked recessive alleles. One type of allele, call it cbr, results in defective red perception, whereas another type of allele, call it cbg, results in defective green perception. A woman who is heterozygous cbr/cbg and a normal male produce a son whose chromosome constitution is XXY. What is the genotype of the gamete that produced this boy if nondisjunction took place in the cbr-bearing chromosome in meiosis II of the mother? A. cbr B. cbr cbg C. cbg cbg D. cbg E. cbr cbr

E. cbr cbr

Which of the following is NOT true? A. the modifications of the histone tails are important to gene activity B. part of compaction of the circular bacterial chromosome results from supercoiling C. in highly condensed eukaryotic chromosomes , the radial loops are anchored to a scaffold D. all of the above E. none of the above

E. none of the above

The questions below refer to the following terms. Each term may be used once, more than once, or not at all. A. telophase B. anaphase C. prometaphase D. metaphase E. prophase 7) Centrioles begin to move apart in animal cells.-

E. prophase

The questions below refer to the following terms. Each term may be used once, more than once, or not at all. A. telophase B. anaphase C. prometaphase D. metaphase E. prophase 8) This is the longest of the mitotic stages.-

E. prophase

The interaction between non-allelic genes in their effects on a trait is called A) Epistasis B) Epigentics C) dominance D) codominance E) incomplete dominance

Epistasis

What is the interaction between non-allelic genes in their effects on a trait called?

Epistasis

The banded regions of the Drosophila polytene chromosome consists of what?

Euchromatin

True or False: If two affected people have an unaffected child, it is an autosomal recessive pedigree.

False

The synaptonemal complex

Forms during prophase I of meiosis

Which pair of pentamer primer could be use to amplify the DNA sequence shown below?5' - AAAAAGATTACATCGGGCATTACCGATTTAAAGCCCTGGGGG - 3'3' - TTTTTCTAATGTAGCCGTAATGGCTAAATTTCGGGACCCCC - 5'

Forward primer 5' - AAAAA - 3' and reverse primer 5' - CCCCC - 3'

Who discovered DNA?

Friedrich Meischer

In dihybrid cross F2 generation, 9:7 ratio occurs when a homozygous recessive mutations in either or both of two different genes produces the same phenotype, the phenomenon is called as

Genetic epistasis

A ____ is defined as any difference in DNA, no matter how it is detected, whose pattern of transmission from generation to generation can be tracked A. mutation B. genetic marker C. genetic drift D. consensus sequence

Genetic marker

____________ is the study of all genes in an organism to understand their molecular organization, function, interaction, and evolutionary history

Genomics

Which histone protein is present as a monomer within the nucleosome?

H1

Which of the followings is NOT included in core particle?

HI

A cell with a nucleus containing only one set of chromosomes, consisting of one member of each homologous pair, is what?

Haploid

What enzyme unwinds DNA?

Helicase

The sigma factor protein's role in bacterial transcription includes which of the following?

Helps the RNA polymerase to bind to the promoter

Blocks of satellite DNA clustered near the centromere and telomere are called what?

Heterochromatin

Which of the followings is NOT true? Wrong answers: ➢ Acetylation of histone results in the decreased interaction between DNA and histones ➢ DNA methylation usually inhibits the transcription of eukaryotic genes ➢ Gene expression can be regulated at the level of alternative patterns of splicing, mRNA stability, and RNA interference

Heterochromatin is an open chromatin which allows the access of transcription machinery

In the Holliday model of homologous recombination, two nicked duplexes come together to form regions which can be substrates for mismatch repair and gene conversion, and are known as

Heteroduplexes

Which of the following happens at the conclusion of meiosis I?-

Homologous chromosomes are separated.

Which parts of the DNA region shown in the diagram encode proteins?

I, Z, Y, A

Sister chromatids

Identical copies of a chromosome joined by a centromere

Which of the followings is true?Wrong Answers: ➢ In gene expression, information in the nucleotide sequence of DNA is used to dicatate the linear order of amino acids in a protein by means of a protein intermediate ➢ Nearly all organisms use the standard genetic code with 61 codons for 60 amino acids and 3 stop codons ➢ In prokaryotes, the genes coding for the enzymes in a metabolic pathway are often scattered throughout the genome

In repressible transcription, the default state is "on" until the active repressor turns it "off"

In genetic crosses, F2 products show identical phenotypic and genotypes ratios. This phenomenon is due to:

Incomplete dominance

We all know that smoking increases a person's chance of getting lung cancer. The reason why not all individuals that smoke get lung cancer is contributed to the phenomenon known as

Incomplete penetrance

Does the Tm increase or decrease if there are more G+C base pairs? Does the Tm increase or decrease as the length of DNA increases? Why?

Increase G+C are no more easily broken in heatTm increase as length does because tehre is more DNA to be melted

In a dihybrid cross, what does the 9:3:3:1 ratio indicate? A) codominance B) Independent assortment C) intermediate dominance D) three alleles for each trait

Independent assortment

Which of the following is not true about DNA structure? 1-Two strands are antiparallel 2-Each chain makes one complete turn every 34 angstroms 3-Ionic bonds are the main force holding strands together 4-Purine adenine base pairs with the pyrimidine thymine5-Paired bases are parallel to one another and perpendicular to the long axis of the helix

Ionic bonds are the main force holding strands together

Dideoxyribose is chemically different from deoxyribose in what?

It lacks a 3'-OH group

Dideoxyribose is chemically different from deoxyribose in that it

Lacks a 3'-OH group

R type strain of S. pneumonia does not cause pneumonia because it

Lacks a capsule

In the lac operon, under which of the following conditions will the lac genes be transcribed at high levels?

Low glucose, high lactose

Cell division happens at

M

Who demonstrated that DNA undergoes semiconservative replication?

Mathew Meselson and Franklin Stahl

Separation of homologous chromosomes occurs in the

Meiosis I

The codon AUG, which is the "start" codon for polypeptide synthesis, also specifies the amino acid

Met.

A chromosome with a centromere near the center is called A) Acrocentric B) Mesocentric C) Acentric D) Metacentric E) Submesocentric

Metacentric

A chromosome with its centromere in the middle is

Metacentric

Avery observed that a non-pathogenic strain of bacteria (type R) could be genetically transformed into a pathogenic strain if they took up a cellular component of a related pathogenic strain (type S). To determine which substance was the transforming material, Avery treated a solution of the heat killed type S bacteria with the following enzyme solutions, then mixed this with the nonpathogenic type R bacteria and injected these mixtures to mice.I) Nothing II) Proteinase III) DNase IV) RNase V) Proteinase, RNase, and DNaseAssuming that the injection of the pathogenic bacteria killed the mice, which of the following outcomes are consistent with the idea that DNA is the transforming material?

Mice injected mixture I, II, and IV died

In tetrad analysis, 4-strand double crossing-over between 2 linked genes results in what?

NPD tetrad

Mutations provide allelic variations:

On the positive side, mutations are the foundation for evolutionary changeo On the negative side, mutations are the cause of many diseases

The DNA content of an organism contains 50% GC base pairs. On average, how frequently would you expect to find the sequence 5' ATGG 3'?

Once every 256 bases

The DNA content of an organism contains 80% GC base pairs. On average, how frequently would you expect to find the sequence 5' ATGG 3'?

Once every 625 bases

Haploid

One complete set of chromosomes

Discontinuous replication refers to what?

One of the daughter strands of a replicated piece of DNA is made in short fragments that are joined together

During translation, an initiator tRNA binds to the________ of ribosome

P site

In ABCD_EFGH, what is the following mutation?ABCFE_DGH

Pericentric inversion

Which chemical group is at the 5' end of a single polynucleotide strand?

Phosphate group

The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked are called?

Phosphodiester bonds

Euploid

Possessing the correct number of chromosomes

Aneuploid

Possessing too few or too many copies of a single chromosome

Which of the following is NOT a nonpolar, acromatic amino acids?

Proline

Which of the followings is NOT the function of 5' capping of mRNA?

Promotes the termination of mRNA transcription

transcript

RNA created by DNA transcription

The calico pattern of coat coloration in female cats is an example of what?

Random X chromosome inactivation

The DNA from 2 different species can be distinguished by a difference in what?

Ratio of A+T to G+C

RNA-induced gene silencing (RNA interference) is commonly used experimentally to _________

Reduce expression of a specific target gene

An exonuclease is an enzyme that can

Remove a terminal nucleotide in a polynucleotide chain

In a replicating DNA molecule, the region in which parental strands are separating and new strands are being synthesized are called what?

Replication fork

In ABCD_EFGH, what is the following mutation?ABCD_EFFEGH

Reverse tandem duplication

The mode of DNA replication in which a circular parent molecule produces a linear branch of newly formed DNA is called

Rolling-circle replication

The mode of DNA replication in which a circular parent molecule produces a linear branch of newly formed DNA is called what?

Rolling-circle replication

Polyploid

Several complete sets of chromosomes

As helicase unwinds the DNA molecule, what keeps the strands apart?

Single-strand binding proteins

Which of the following is NOT the ribozyme?

Small interfering RNA (siRNA)

Which of the followings is NOT true? Wrong answers: ➢ In bacteria, small cytoplasmic RNA (scRNA) is needed for protein secretion ➢ Transfer RNA (tRNA) is necessary for the translation of mRNA ➢ microRNA (miRNA) is involved in gene regulation in eukaryotes

Small nuclear RNA (snRNA) is necessary for the splicing of prokaryotic pre-mRNA

In DNA replication, primase is responsible for

Synthesizing an RNA primer for DNA synthesis

In DNA replication, primase is responsible for what?

Synthesizing an RNA primer for DNA synthesis

In tetrad analysis, 3-strand double crossing over between two linked genes results in what?

TT tetrad

In ABCD_EFGH, what is the following mutation?ABCD_EFEFGH

Tandem repeat duplication

Which of the followings is NOT true? Wrong answers: ➢ Telomeres cap the ends of the chromosome ➢ Telomeres are also thought to be the "clock" that regulates how many times an individual cell can divide ➢ Telomerase has a reverse-transcriptase activity ➢ Telomerase activity is increased in many cancer cells

Telomerase catalyzes the addition of telomeric repeats to the 5' ends of DNA

Which of the following is false regarding Tm? 1-Tm increases with G+C content 2-Tm decreases with A+T content 3-Tm decreases with G+C content

The Tm decreases with G + C content

Which of the followings is (are) NOT true? Wrong answers :➢ DNA markers that are close to a disease gene tend to be inherited together with the disease gene ➢ Cystic fibrosis gene was identified by genetic mapping analysis ➢ A and C ➢ B and C

The first step in identifying a disease gene is the localization of the disease gene on chromosome by genetic mapping

A coefficient of coincidence of 0.25 means what?

The frequency of double crossovers is 1/4 of the number expected if there were no interference

A coefficient of coincidence of 0.25 means that

The frequency of double crossovers is ¼ of the number expected if there were no interference

The C-value paradox refers to what?

The lack of correlation between genome size and level of metabolic, developmental, and behavioral complexity among eukaryotes

Telomeres serve as caps at the ends of linear chromosomes. What is not true regarding the replication of telomeric sequences?

The leading strand doubles back on itself to form a primer for the lagging strand

Which of the following is NOT true?Wrong answers:➢ Recombination is lower in heterochromatin➢ In euchromatin, there is a good correlation between the physical distance the map distance➢ Map distance between any two genes is 0 in Drosophila male

The map distance of heterochromatin is longer than the physical distance

Southern blot is the technique that is used to detect

The presence of a specific nucleotide sequence in DNA

Gene Expression

The process by which a gene produces its product & the product carries out its function

What does the coefficient of coincidence measure?

The ratio of double crossovers to the number expected if there were no interference

Where would the lac repressor normally be bound in an E. coli cell that is growing in low glucose and high lactose?

The repressor would not be bound

The chromosome designation 11p refers to

The short arm of chromosome 11

In DNA replication, the leading strand is

The single DNA strand that is synthesized as a continuous unit

In a sequencing gel, were is the 5' end?

The top of the sequence where the pairs are closest together

Which of the statements below regarding X-linked inheritance is false? 1-Heterozygous females will transmit each A-linked allele to about half their daughters 2-Males inheriting an X-linked allele have the trait 3-The trait would be more common in females 4-Heterozygous females will not display the trait

The trait would be more common in females

Which of the following is true of a species that has a chromosome number of 2n = 16?

There are 8 homologous pairs.

A male with hypophosphatemix rockets marries a normal woman. They have 4 children (2 boys, 2 girls). All the boys are normal but all the females are affected. What type of inheritance does this suggest?

This suggest there's an issue with the X chromosome. It's a X-linked trait.

What is the predicted Tm for a stretch of double helix that is 100 nucleotides long and contains 50% G+C contentEquation: Tm = 59.9 + 0.41 [%(G+C)] - [675-length of duplex]

Tm = 59.9 + 0.41 (.5) - (675/100)=59.9 + 0.205 - 6.75=53.56

The role of tRNA is________

To act as transporters bringing amino acids to the site of protein synthesis

What is the function of a ribosome?

To hold mRNA and tRNAs in the correct positions to enable translation

Which kind of enzyme prevents DNA from tangling up by introducing negative supercoils as the replication fork migrates during replication?

Topoisomerase

In ABCD_EFGH, what is the following mutation?AD_EFBCGH

Translocation

True or False: A single SNP defines two alleles

True

True or False: The sequence of coding strand is identical to the mRNA

True

Diploids

Two complete sets of chromosomes

Which of the following is NOT the stop codon?

UGG

Which of the following is not a "stop codon"?

UUU

Satellite DNA is an example of _________

Unique or single copy sequences

____________ is referred to as the helical structure assumed by two strands of DNA, held together throughout their length by hydrogen bonds between bases on opposite strands

Watson-Crick pairing

Temperature-sensitve mutations

Wild type phenotype below the critical temperature (protein stable)• Mutant phenotype above the certain temperature (protein become unstable)

In the dihybrid testcross, the ratio of offspring of WwGg+Wwgg+wwGg+wwgg is 1:1:1:1, what is the genotype of the plant?

WwGg

In Neurospora, a linear biochemical pathway synthesizes an amino acid Z.E1 E2 E3W → X → Y → Z15. Null mutants lacking enzyme E2 gene will grow on minimal medium supplemented with which of the following compounds?

Y or Z

(Questions 14-15) In Neurospora, a linear biochemical pathway synthesizes an amino acid Z.E1 E2 E3W → X → Y → Z14. Which compound(s) will be absent in null mutants lacking enzyme, E3?

Z

point mutation

a change in a single base pair-it involves a base substitute

transition

a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine-transitions are more common than transversions

transversion

a change of a pyrimidine to a purine or vice versa

complete medium

a complex medium enriched with a variety of amino acids, vitamins, and other substances expected to be essential metabolites

mutation

a heritable change in the genetic material

Helicase

a protein that hydrolyzes ATP to drive forward the unwinding reaction

How many DNA fragments a restriction enzyme can generate on the agarose gel when it cuts the pUC19 plasmid with no cDNA insertions? a. 1 b. 0 c. 2 d. 3 e. 10

a. 1

The sequence of the transcript is 5'-GGUUA-3'. The sequence of the DNA template would be a. 5'-GGTTA-3' b. 5'-GAATG-3' c. 5'-CCAATGTAAG-3' d. 5'-CUUAC-3

a. 5'-GGTTA-3'

When crossing an organism that is homozygous recessive for a single trait with a heterozygote, what is the chance of producing an offspring with the homozygous recessive phenotype? Select one: a. 50% b. 0% c. 100% d. 25% e. 75%

a. 50%

A triploid cell contains three sets of chromosomes. If a cell of a usually diploid species with 42 chromosomes per cell is triploid, this cell would be expected to have which of the following?Select one: a. 63 chromosomes in 21 sets of 3 b. 63 chromosomes in 31 1/2 pairs c. 63 chromosomes, each with three chromatids d. 21 chromosome pairs and 21 unique chromosomes

a. 63 chromosomes in 21 sets of 3

The start codon for translation is a. AUG b. ACG c. UAA d. UGG

a. AUG

In the Avery, McLeod, McCarty Experiment using extracted R Strain pneumonia bacterial cell extracts to add a S strain pneumonia cell culture what was the effect of adding RNase to the total cell extract? a. All RNA was degraded and Transformation of the R Strain to S Strain occurred. b. All Protein was degraded and Transformation of the R Strain to S Strain occurred. c. All DNA was degraded and Transformation of the R Strain to S Strain occurred. d. All DNA was degraded and no Transformation occurred indicating DNA is the molecule of Transformation inheritancee. None of the above are true

a. All RNA was degraded and Transformation of the R Strain to S Strain occurred.

A given organism has 46 chromosomes in its karyotype. We can therefore conclude which of the following?Select one: a. Its gametes must have 23 chromosomes. b. It must be an animal. c. It must be sexually reproducing. d. It must be a primate. e. It must be human.

a. Its gametes must have 23 chromosomes.

The image represents an organism with 6 chromosomes. What stage of cell division is represented ? a. Metaphase I b. Prophase I c. Telophase II d. Metaphase II e. Anaphase I

a. Metaphase I

Why did Thomas Hunt Morgan use white eyed fruit flies in his experiments? a. White eyes are recessive b. He knew the gene for eye color was on the sex chromosome c. White eyed flies are easy to find d. He couldn't breed mice in the monastery e. None of the above

a. White eyes are recessive

The "calico" pattern of coat coloration in female cats is a result of a. X-chromosome inactivation b. Fragile X syndrome c. Endoreduplication d. Turner syndrome e. Unequal crossing over

a. X-chromosome inactivation

The base pair Thymine is always paired with a. adenine b. guanine c. cytosined. thymine e. is never paired with another base in DNA molecule

a. adenine

Mendel's second law of independent assortment has its basis in which of the following events of meiosis I?Select one: a. alignment of tetrads at the equator b. separation of cells at telophase c. separation of homologs at anaphase d. synapsis of homologous chromosomese. crossing over

a. alignment of tetrads at the equator

Sister chromatidsSelect one: a. all of the above b. are created when DNA is replicated c. are separated during mitosis d. are attached at the centromere prior to division

a. all of the above

DNA fragments migrate in an electric field because DNA molecules a. are negatively charged b. are positively charged c. are neutral in charged. are double stranded e. contain numerous covalent bonds

a. are negatively charged

If an organism is diploid and a certain gene found in the organism has 18 known alleles (variants), then any given organism of that species can/must have which of the following?Select one: a. at most, 2 alleles for that gene b. up to 18 chromosomes with that gene c. a haploid number of 9 chromosomes d. up to, but not more than, 18 different traits e. up to 18 genes for that trait

a. at most, 2 alleles for that gene

The Chi Square test does which of the following? a. determines if the null hypothesis is true for the observation b. produces values that ensure scientific studies are irrefutable to everyone in the world c. are a math thing that we never need to worry about d. have the same cutoff value regardless of what the degrees of freedom are

a. determines if the null hypothesis is true for the observation

The pyrimidine bases are a. thymine and cytosine b. thymine and guanine c. adenine and guanine d. cytosine and adenine e. cytosine and guanine

a. thymine and cytosine

Why did Mendel continue some of his experiments to the F2 or F3 generation?Select one: a. to observe whether or not a recessive trait would reappear b. to obtain a larger number of offspring on which to base statistics c. to distinguish which alleles were segregating d. to be able to describe the frequency of recombination e. to observe whether or not the dominant trait would reappear

a. to observe whether or not a recessive trait would reappea

The products of crossing-over within the pericentric inversion (i.e., A B C o D E & A D C o B E) include (o designates centromere) a. two monocentric chromatids with one each having a deletion or duplication b. two normal chromosomes c. dicentric and acentric chromatids d. two chromosomes with inversions

a. two monocentric chromatids with one each having a deletion or duplication

A wrinkled seed has genotype of

aa

Conditional mutations

affect the phenotype only under a defined set of conditions

The various forms of a given gene are called

alleles

Homologous chromosomes migrate to opposite poles during

anaphase 1

Missense mutations

are those base substitutions in which an amino acid change does occur• Example: sickle-cell anemia• If the substituted amino acids have similar chemistry, the mutation is said to be neutral

What is the highest probability that a single gamete from a human will have 23 chromosomes that all arose from a singe parent assuming no crossover (i.e., all mom's chromosomes)? a. 1/2 b. (1/2)^23 c. 23^1/2 d. 1/64 e. 0.000023

b. (1/2)^23

In a cross Aa Bb cc Dd x Aa Bb cc Dd, in which all genes undergo independent assortment, what proportion of offspring are expected to be homozygous recessive for all four genes? a. (1/2)^3 b. (1/4)^3 c. (1/2)^4 d. (1/4)^4 e. 0

b. (1/4)^3

In families where both parents are heterozygous for two different unlinked recessive traits (Trait A and B), what is the probability of having a child heterozygous for both traits? a. 1/32 b. 1/4 c. 1/16 d. 3/16 e. 1/8

b. 1/4

In the absence of recombination (i.e., complete linkage), what ratio of phenotypes is expected in the progeny of the cross aB/Ab x AB/ab? a. 3 A- B- :1 aabb b. 2 aaB- :2 A- B- : 1A- bb c. 9 A- B- : 3 A- bb : 3 aaB- : 1 aabb

b. 2 aaB- :2 A- B- : 1A- bb

When the base composition of double-stranded DNA from a new species of bacteria was determined, 30% of the bases were found to be adenine. What is the percentage of cytosine in the DNA of this organism? a. 10% b. 20% c. 30% d. 35% e. 40%

b. 20%

The sequence of an RNAtranscript is 5'-GGUUACAUUC-3'. The sequence of the corresponding DNA template would be a. 5'-GGUUACAUUC-3'. b. 5'-GAATGTAACC-3'. c. 5'-CCAATGTAAG-3'. d.5'-CUUACAUUGG-3'

b. 5'-GAATGTAACC-3'.

Which of the following statements best describes an anti-codon: a. It has a clover-leaf shape, carries the amino acid to the ribosome so the amino acid can be added to the appropriate part of a growing polypeptide b. A sequence of 3 adjacent nucleotides in a transfer RNA, contributes to the specification of an amino acid or a stop signal in protein synthesis c. A sequence of 3 adjacent nucleotides in a messenger RNA, contributes to the specification of an amino acid or a stop signal in protein synthesis d.A part of the ribosome, responsible for moving the mRNA e.None of the above

b. A sequence of 3 adjacent nucleotides in a transfer RNA, contributes to the specification of an amino acid or a stop signal in protein synthesis

What would the most likely genotype be for a person exhibiting a rare single gene Autosomal Dominant disease? a. AA b. Aa c. aa d. AB e. None of the above

b. Aa

In a cross between 2 black Labrador retrievers a phenotypic ration of 9 black puppies, 3 chocolate puppies, and 4 yellow puppies likely results from what phenomena. a. Codominance b. Epistasis c. Independent assortment d. Intermediate dominance e. three alleles for each trait

b. Epistasis

The base Cytosine pairs with a. Uracil b. Guanine c. Thymine d. Uracil in DNA and Guanine in RNA e. Uracil in RNA and Guanine in DNA

b. Guanine

A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. Which of the following is a possible genotype for the mother?Select one: a. ii b. IAi c. IAIA d. IBIB e. IAIB

b. IAi

Why did the F1 offspring of Mendel's classic pea cross always look like one of the two parental varieties? Select one: a. No genes interacted to produce the parental phenotype. b. One phenotype was completely dominant over another. c. Each allele affected phenotypic expression. d. The traits blended together during fertilization. e. Different genes interacted to produce the parental phenotype.

b. One phenotype was completely dominant over another.

The chromosome at right has a centromere that makes it what type of chromosome? a. submetacentric b. acrocentric c. dicentric d. holocentric e. metacentric

b. acrocentric

S strain of S. pneumoniae can cause pneumonia because bacterial cells a. are unable to synthesize a polysaccharide capsule b. are surrounded by a polysaccharide capsule c. are detectable by the immune system d. are unable to form colonies

b. are surrounded by a polysaccharide capsule

A male with a disease that equally effects half his daughters and sons, what is the most likely type of inheritance observed? a. autosomal recessive b. autosomal dominant c. y-linked d. x-linked recessive e. x-linked dominant

b. autosomal dominant

A chromosome in which the telomeric end has been removed is referred to have undergone a what? a. duplication b. deletion c. inversion d. translocation e. position effect variegation

b. deletion

Which of the following best describes gamete viability and fertility for an individual that a reciprocal translocation? (other chromosome normal) a. all (100%) normal gametes and normal offspring b. half as many normal gametes and offspring as would be expected c. one fourth as many normal gametes and offspring as would be expected d. one tenth as many normal gametes as expected e. no offspring

b. half as many normal gametes and offspring as would be expected

Which chemical group is at the 3' end of single polynucleotide strand? a. phosphate group b. hydroxyl group c. purine base d. nitrogen group e. methyl group

b. hydroxyl group

Which chemical group is at the 5' end of a single polynucleotide strand? a. hydroxyl group b. phosphate group c. diester group d. purine base e. nitrogen group

b. phosphate group

A 9:3:3:1 ratio refers to a. the genotypic ratio in the F2 progeny of a dihybrid cross b. the phenotypic ratio in the F2 progeny of a dihybrid cross c. the phenotypic ratio in the F2 of a test cross d. both a and b e. an extension of Mendelian inheritance

b. the phenotypic ratio in the F2 progeny of a dihybrid cross

A solution contains double stranded DNA fragments of size 4 kb, 8 kb, 10 kb, and 13 kb that are separated in an electrophoresis gel. In the accompanying diagram of the gel, which band is the 8kb fragment?

c

In testcross experiments, the frequency of recombination between genes a and b is 0.2; between b and c, 0.3; between c and d, 0.4; and between a and c, 0.5. What is the order of the 4 genes?

c-b-d-a

The genomic DNA of an organism has a base composition of 40% C-G base pairs and 60% A-T base pairs. Assuming a random sequence of bases, what is the expected frequency of the TSP E1 restriction sites 5'-CCGG-3'? (Think carefully) a. (0.1)^4 b. (0.2)^2 c. (0.2)^4 d. (0.4)^4 e. (0.25)^4

c. (0.2)^4

In certain plants, tall is dominant to short. If a heterozygous plant is crossed with a homozygous tall plant, what is the probability that the offspring will be short?Select one: a. 1/4 b. 1/6 c. 0 d. 1/2e. 1

c. 0

Common red-green color blindness is an X-linked trait. A woman whose father is color blind married a normal man and they have one son. What is the probability that he is color blind?a. 0 b. 1/4 c. 1/2 d. 3/4 e. 1

c. 1/2

A family has 4 girls and the wife is pregnant with the 5th child. What is the probability of the 5th child being a girl and what is the probability that the father's sister, who is now starting a family (i.e., no children yet), with have 5 boys if she has 5 children? a. 1/2; (1/2)^2 b. 1/4; (1/2)^4 c. 1/2; (1/2)^5 d. 1/2; (1/2)^6 e. 1/2; 1/2

c. 1/2; (1/2)^5

tarting with a Parental cross (P1) between AA and aa, what will the proportion of homozygous recessives genotypes in the F2 progeny be? a. 1/16 b. 1/8 c. 1/4 d. 1/3 e. 1/2

c. 1/4

The sequence of one strand of DNA is 5'-GCTTTAG-3'. The sequence of the complementary strand would be a. 5'- GCTTTAG-3' b. 5'- GATTTCG-3' c. 5'- CTAAAGC-3' d. 5'- ATGGGVA-3' e. 5'- CTUUUGC-3'

c. 5'- CTAAAGC-3'

What is the base sequence of a DNA strand that is complementary to 5'-ATCGGATTC-3' sequence? a. 5'- ATCGGATTC-3' b. 5'- CTTAGGCTA-3' c. 5'- GAATCCGAT-3' d. 5'- TAGCCTAAG-3'

c. 5'- GAATCCGAT-3'

Okazaki fragments are found during a. RNA synthesis b. protein synthesis c. DNA replication d. southern blot e. cDNA cloning

c. DNA replication

The Griffith Experiment, where S and R strains of pneumonia were injected live, dead, or in combination, is determined which of the following? a. DNA is the molecule of inheritance b. RNA is the molecule of inheritance c. Factors of inheritance (as yet unknown) can be transmitted between pneumonia strains d. Dead S strain pneumonia can still be lethal e. None of the above

c. Factors of inheritance (as yet unknown) can be transmitted between pneumonia strains

Mutations that occur in body cells which do not go on to generate gametes can be classified as: a. Morphological mutations b. Conditional mutations c. Somatic mutations d. Pleiotropic mutations e. Nonsense mutations

c. Somatic mutations

A paternity case involves an infant with type AB blood. Four men could be the father. You be the judge, as far as the blood type evidence allows: a. The man with type A blood could not be the father. b. The man with type AB blood could not be the father. c. The man with type O blood could not be the father. d. The man with type B blood could not be the father. e. All four men could be the fathe

c. The man with type O blood could not be the father.

A paternity case involves an infant with type AB blood. Four men could be the father. You be the judge, as far as the blood type evidence allows: a. The man with type A blood could not be the father. b. The man with type AB blood could not be the father. c. The man with type O blood could not be the father. d. The man with type B blood could not be the father. e. All four men could be the father

c. The man with type O blood could not be the father.

When DNA fragments are separated in an agarose gel under an electric field a. They are separated according to charge; positive fragments move faster b. They are separated according to charge; negative fragments move faster c. They are separated according to size; shorter fragments move faster d. They are separated according to size; longer fragments move faster

c. They are separated according to size; shorter fragments move faster

A stop codon is not a. UAA b. UAG c. UGC d. UGA

c. UGC

the purine bases are a. thymine and cytosine b. thymine and guanine c. adenine and guanine d. cytosine and adenine e. cytosine and guanine

c. adenine and guanine

Genes can be found in the a. cytoplasm b. endoplasmic reticulum c. chromosomes d. cellular membrane

c. chromosomes

If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)? a. cross it to a known homozygous dominant mouse b. cross it to a mouse with a dominant trait but similarly unknown genotype c. cross it to a mouse with the recessive trait d. cross it to a potentially heterozygous dominant mouse e. it cannot be determined

c. cross it to a mouse with the recessive trait

Homologous chromosomes separate during ___; sister chromatids separate during ____. a. mitosis; meiosis b. meiosis II; mitosis c. meiosis I; meiosis II d. meiosis II; meiosis I e. meiosis II; meitosis

c. meiosis I; meiosis II

Which enzyme is not present during DNA replication? a. gyrase b. RNA primase c. restriction enzyme d. helicase e. DNA polymerase

c. restriction enzyme

What is the purpose of meiosis?a. to produce identical sister cells b. to produce unreduced gamete cells c. to keep the number of chromosomes from generation to generation d. all of the above e. none of the above

c. to keep the number of chromosomes from generation

The process of making an RNA strand from a DNA template is called a. translation b. transfection c. transcription d. transmutatione. replication

c. transcription

Which of the following is not a base found in DNA? a. adenine b. guanine c. uracil d. thymine

c. uracil

The human X and Y chromosomes are-

called "sex chromosomes" because they determine an individual's sex

Parents heterozygous for a recessive allele are called A) Carriers B) Codominant C) Hybrids D) True-breeding E) pleiotropic

carriers

The chromatids in a pair of chromosomes are held together at a specific region of the chromosome called what?

centromere

What is the name for the special region on a duplicated chromosome that holds the sister chromatids together?-

centromere

telocentric

centromere at end

acrocentric

centromere close to end

metacentric

centromere in middle

submetacentric

centromere slightly off center

Highest level of chromatin organization

chromsome

rolling circle replication

circular mode of replication without theta shaped intermediates

AB blood type person containing IA and IB alleles demonstrates

codominance

mRNA contain a triple base sequence called _______.

codon

Transcription is a production of an RNA strand that is _________ in the base sequence to a DNA strand.

complementary

In genetic analysis, the ____ test is used to determine whether two recessive mutations that cause similar phenotype are alleles of the same gene

complementation

The physical exchange of segments between homologous chromosomes is called

crossing over

Which of the following terms belongs with the words synapsis, tetrads, and chiasmata?-

crossing over

While exploring a planet in a nearby solar system you discover a new type of life. This new life has genetic material of inheritance (i.e., DNA in us) similar to ours with four kinds of nucleotides W,X, Y, and Z that code for only 15 different amino acids. Which of the following statements would be correct descriptions about the minimum number of nucleotides necessary for this new life's genetic code? a. 1 b. 2, provided that chain termination does not require a special codon c. 3, provided that chain termination does require a special codon d. 2, no matter how chain termination is accomplished e. Both b and c

d. 2, no matter how chain termination is accomplished

Achondroplasia is a type of dwarfism (short stature) caused by an autosomal dominant allele. The allele causing achondroplasia is lethal when homozygous (early death from breathing failure and neurological problems). When both parents are affected by achondroplasia, the probability of a child with achondroplastic short stature among the children that survive can be estimated as a. 1/4 b.1/2 c. 1/3 d. 2/3 e.4/9

d. 2/3

If guanine make up 23% of the nucleotides in a sample of DNA then thymine would make up what percent of the bases? a. 22% b. 30% c. 40% d. 27% e. 15%

d. 27%

What are the dimensions of a Punnet square for the cross AaBb x AaBB? a. 2 x 1 b. 2 x 2 c. 4 x 1 d. 4 x 2 e. 4 x 4

d. 4 x 2

The coding region of a messenger RNA (from initiation codon to termination codon) is 300 nucleotides. The initiation codon is located closer to the ________end of the mRNA. The polypeptide encoded by this mRNA will be approximately ____________ amino acids long. a. 3' ; 900 b. 5' ; 900 c. 3' ; 100 d. 5' ; 100 e. 5' ; 300

d. 5' ; 100

If a single gene has three alleles, how many different genotypes are possible in a diploid organism? a. 2 b. 3 c. 4 d. 6 e. 8

d. 6

The diseases PKU and Alkaptonuria represent what about genes? a. proteins are the direct products of DNA b. changes to DNA sequences can change proteins and cause disease c. genes affect organisms through the actions of proteins d. B and C e. All of the above

d. B and C

The frequency of heterozygosity for the sickle-cell anemia allele is unusually high, presumably because this reduces the frequency of malaria. Such a relationship is related to which of the following?Select one: a. Darwin's observations of competition b. Mendel's law of independent assortmentc. Mendel's law of segregation d. Darwin's explanation of natural selection e. the malarial parasite changing the allele

d. Darwin's explanation of natural selection

Siamese cats with the same Genotypes for coat color can have differences in appearance (i.e., phenotype. What explains these differences in appearance? a. Epistasis b. Incomplete dominance c. Co-Dominance d. Environmental Influence e. None of the above

d. Environmental Influence

The chemical group at the 3' end of a single polynucleotide chain is a. Base b. Phosphate group c. Nitrogen group d. Hydroxyl group e. Phosphodiester group

d. Hydroxyl group

The "start" codon for polypeptide synthesis, also specifies amino acid a. Phe b. Gly c. Trp d. Met e. Asn

d. Met

Each new DNA strand replication is initiated by a a. Restriction fragment b. Single-stranded DNA-binding protein c. Precursor fragment d. Short RNA primer e. Specific DNA primer

d. Short RNA primer

A newly discovered species is found to have three alleles C^o, C^n, C^f) for the "cuteness" gene but among the 6 genotypes 4 phenotypes are expressed "Cute", "Super Cute Nose", and "Super, Duper Cute" with both Super Cute Face and Super Cute Nose expressed. Given these observations, what can you conclude about the allele interactions? a. The gene is controlled by Epistasis b. Epigenetics is altering the gene expression c. Simple gene dominance is at work d. Super cute nose and cute face exhibit codominance over cute e. incomplete dominance creates a blending of all genotypes

d. Super cute nose and cute face exhibit codominance over cute

Restriction enzymes a. remove amino acids from the carboxyl end of a polypeptide chain b. connect two DNA fragments together c. remove terminal nucleotides from the 3'-end of a polynucleotide chain d. connect two oligopeptides together e. cleave DNA molecules into smaller fragments

d. connect two oligopeptides together

"Cytokinesis" refers to _____.Select one: a. division of the nucleus b. movement of a cell from one place to another c. reduction in the number of chromosomes d. division of the cytoplasm

d. division of the cytoplasm

XYY syndrome (XYY) results from a. primary non-disjunction b. haploid gametes from both parents c. secondary non-disjunction d. either A or C e. all of the above

d. either A or C

In the telophase of mitosis, the mitotic spindle breaks down and the chromatin uncoils. This is essentially the opposite of what happens in _____.Select one: a. metaphase b. interphase c. S phase d. prophase e e. anaphase

d. prophas

The base Adenine is always paired with a. adenine b. guanine c. cytosine d. thymine e. is never paired with another base in a DNA molecule

d. thymine

Mendel accounted for the observation that traits which had disappeared in the F1 generation reappeared in the F2 generation by proposing thatSelect one: a. new mutations were frequently generated in the F2 progeny, "reinventing" traits that had been lost in the F1. b. the traits were lost in the F1 due to dominance of the parental traits. c. members of the F1 generation had only one allele for each trait, but members of the F2 had two alleles for each trait. d. traits can be dominant or recessive, and the recessive traits were obscured by the dominant ones in the F1. e. the mechanism controlling the appearance of traits was different between the F1 and the F2 plants.

d. traits can be dominant or recessive, and the recessive traits were obscured by the dominant ones in the F1.

Deleterious mutations

decrease the chances of survival and reproduction• The most extreme are lethal mutations

Human somatic cells are

diploid

DNA is usually _______ stranded.

double

If cells examined during the G2 phase of the cell cycle contained 200 units of DNA. What would be the amount of DNA at G1 of the cell cycle of the daughter cells?Select one: a. 50 units b. between 50 and 100 units c. 200 units d. 400 units e. 100 units

e. 100 units

Somatic cells of the red fox, Vulpes vulpes, normally have 38 chromosomes. What is the number of chromosomes present in the nucleus following telophase I of meiosis? a. 95 b. 76 c. 57 d. 38 e. 19

e. 19

What codon would pair with the anticodon of tRNA^met 5'-CAU-3' a. 5'-CAU-3' b. 5'-GUA-3' c. 5'-UAC-3' d. 5'-ATG-3' e. 5'-AUG-3'

e. 5'-AUG-3'

The sequence of one strand of DNA is 5'- GCTTTAG-3'. The sequence of the RNA, transcribed using this strand as a template, would be a. 5'-GCTTTAG-3' b. 5'-CTAAAGC-3' c. 5'-CTUUUGC-3' d. 5'-CUAAACC-3' e. 5'-GCUUUAG-3'

e. 5'-GCUUUAG-3'

The fact that all seven of the pea plant traits studied by Mendel obeyed the principle of independent assortment most probably indicates which of the following? Select one: a. The formation of gametes in plants occurs by mitosis only. b. All of the genes controlling the traits were located on the same chromosome. c. The diploid number of chromosomes in the pea plants was 7. d. None of the traits obeyed the law of segregation. e. All of the genes controlling the traits behaved as if they were on different chromosomes.

e. All of the genes controlling the traits behaved as if they were on different chromosomes.

A cross between two true breeding lines (one with dark blue flowers and one with white flowers) produces F1 offspring that are light blue. When the F1 progeny are self-fertilized, a 1:2:1 ratio of dark blue:light blue:white flowers is observed. What genetic phenomenon is consistent with these results? a. Complementation b. Pleiotropy c. Lethality d. Co-dominance e. Incomplete dominance

e. Incomplete dominance

Which of the following statements about PCR is false? a. PCR stands for polymerase chain reaction b. PCR uses short synthetic oligonuclotide primers c. PCR uses a DNA polymerase to synthesize DNA d. PCR can be used to obtain large quantities of a particular DNA sequence e. PCR does not require knowledge of the DNA sequence at the ends of the region to be amplified

e. PCR does not require knowledge of the DNA sequence at the ends of the region to be amplified

Which of the steps takes place in both mitosis and meiosis?Select one: a. Alignment of tetrads at the metaphase plate, separation of sister chromatids, and synapsis; chromosomes moving to the middle of the cell in pairs b. Alignment of tetrads at the metaphase plate and separation of sister chromatids only c. Synapsis; chromosomes moving to the middle of the cell in pairs d. Alignment of tetrads at the metaphase plate e. Separation of sister chromatids

e. Separation of sister chromatids

Independent assortment of chromosomes occurs. Select one: a. The statement is true for mitosis and meiosis I. b. The statement is true for meiosis II only. c. The statement is true for mitosis and meiosis II. d. The statement is true for mitosis only. e. The statement is true for meiosis I only.

e. The statement is true for meiosis I only.

How do cells at the completion of meiosis compare with cells that have replicated their DNA and are just about to begin meiosis? Select one: a. They have twice the amount of cytoplasm and half the amount of DNA. b. They have half the number of chromosomes and half the amount of DNA. c. They have half the amount of cytoplasm and twice the amount of DNA. d. They have the same number of chromosomes and half the amount of DNA. e. They have half the number of chromosomes and one-fourth the amount of DNA.

e. They have half the number of chromosomes and one-fourth the amount of DNA.

Mendel's observation of the segregation of alleles in gamete formation has its basis in which of the following phases of cell division?Select one: a. anaphase of mitosis b. metaphase I of meiosis c. anaphase II of meiosis d. prophase I of meiosis e. anaphase I of meiosis

e. anaphase I of meiosis

The function of the cell cycle is to produce daughter cells that _____.Select one a. have the same number of chromatids as the parent cell had chromosomes b. have a random assortment of maternal and paternal chromosomes c. none of the above d. have the same number of chromosomes as the parent cell but not the same genetic content e. are genetically identical to the parent cell (assuming no mutation has occurred)

e. are genetically identical to the parent cell (assuming no mutation has occurred)

The quantity of DNA in a cell doublesSelect one: a. between prophase and anaphase b. between the G2 phase and prophase c. during the M phase of the cell cycle d. between anaphase and telophase e. between the G1 and G2 phases

e. between the G1 and G2 phases

In animal cell mitosis, the cleavage furrow forms during _____.Select one: a. prophase b. Anaphase c. metaphase d. G1 phase e. cytokinesis

e. cytokinesis

During interphase the genetic material of a typical eukaryotic cell is _____.Select one: a. transported through the nuclear pores b. dispersed in the cytoplasm as long strands of chromatin c. condensed and the chromosomes are often visible under the light microscope d. attached to microtubule spindle fibers e. dispersed in the nucleus as long strands of chromatin

e. dispersed in the nucleus as long strands of chromatin

The human X and Y chromosomesSelect one: a. are of approximately equal size and number of genes. b. include only genes that govern sex determination. c. are almost entirely homologous, despite their different names. d. are both present in every somatic cell of males and females alike. e. include genes that determine an individual's sex

e. include genes that determine an individual's sex

You would know a dividing cell was a plant cell rather than an animal cell if you saw thatSelect one: a. it had microtubules b. it had formed a cleavage furrow c. the nucleolus was visible during metaphase d. it had two pairs of centrioles during prophase e. it had formed a cell plate

e. it had formed a cell plate

Transcription can produce what type of RNA? a. mRNA only b. tRNA only c. rRNA onlyd. mRNA and tRNA only e. mRNA, tRNA and rRNA

e. mRNA, tRNA and rRNA

At which stage of mitosis are chromosomes lined up in one plane in preparation for their separation to opposite poles of the cell?Select one: a. interphase b. anaphase c. telophase d. prophase e. metaphase

e. metaphase

A term ____ refers to an interaction between nonallelic genes in their effects on a trait which alters Mendelian 9:3:3:1 phenotypic ratios

epistasis

A term _____ refers to an interaction between nonallelic genes in their effects on a trait

epistasis

In dihybrid crosses, the ratio 10:6 indicates

epistasis

In dihybrid crosses, the ration 12:3:1 indicates

epistasis

In human cells, genes are usually found in

euchromatins

In the above electron micrograph, the transcription proceeds _______

from left to right

In animals, somatic cells are produced by mitosis and ________ are produced by meiosis.-

gametes

A ________ is defined as any difference in DNA, no matter how it is detected, whose pattern of transmission from generation to generation can be tracked

genetic marker

After telophase I of meiosis, the chromosomal makeup of each daughter cell is-

haploid, and the chromosomes are composed of two chromatids

Unwinding the double helix to separate the parental strands requires a

helices

An organism produses 2 different alleles for a gene; that organism is what with respect to that gene?

heterozygous

Chromosomes that pair in meiosis and have the same genetic loci and structure are said to be

homologous

Genes which do not undergo independent assortment but are transmitted together are said to be

homologous

Heterokaryon

hybrid filament formed by the combination of 2 filaments from 2 mutant organisms on contact, new fused filament contains multiple nuclei from both participating partners

What chemical group is at the 3' end of a single polynucleotide strand?

hydroxyl

polynucleotide chain

in nucleic acids, nucleotides are joined by the 5' carbon of one sugar is linked to hydroxyl group attached to 3' carbon of next sugar in line

Heterozygous phenotype is intermediate between dominant and recessive phenotypes is called

incomplete dominance

A chromosome in which the linear order of a group of genes is the reverse of the normal order, has a (n)

inversion

Frameshift mutations

involve the addition or deletion of nucleotides in multiples of one or two• This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation

A ____ refers to the physical position of a particular gene on a chromosome

locus

Shine-Dalgarno sequence is required for binding of ________ to the prokaryotic ribosome

mRNA

Transcription produces what type of RNA?

mRNA

minimal medium

medium that contains only the nutrients essential for growth of an organism

Seperation of homologous chromosomes occurs in the

meiosis 1

Who first suggested the existence of genes?

mendel

At which stage of mitosis are chromosomes photographed in the preparation of a karyotype?-

metaphase

The branch of genetics concerned with analyzing the structure and function of genes is what?

molecular genetics

Replication of the eukaryotic chromosome is initiated at

multiple sites

A heritable change in a gene is called _______.

mutation

Lowest level of chromatin organization

naked DNA (2nm)

codons

non overlapping groups of three bases translated from mRNA

Which of the following statements about PCR is false

none

Which of the following is NOT true?Wrong answers: ➢ Supercoiling occurs when two DNA double helices are twisted around each other ➢ DNA that is not supercoiled is considered to be relaxed ➢ Negative supercoiling involves right-handed twisting of the DNA ➢ Negative supercoiling compensates for underwinding of DNA

none of the above

also called "beads on a string"

nucleosome

template

original strand of DNA or RNA used in the production of new strand

Transcription

process of making an RNA strand from a DNA template

Spindle fibers attach to kinetochores during-

prometaphase

Chromosomes become visible during -

prophase

The mitotic stage in which the chromosomes condense, the nuclei disappear, and the mitotic spindle forms is known as what?

prophase

Crossing over occurs during which phase of meiosis?-

prophase I

an individual having the same allele of a given gene on homologous chromosomes is said to be

recessive

In a replicating DNA molecule, the region in which parental strands are separating and new strands are being synthesized is called a

replication fork

The enzyme that can digest or cut a circular DNA molecule is a

restriction enzyme

In eukaryotes, chromosomes are duplicated during which stage of the cell cycle?

s

Replication of the genome occurs in which phase of the cell cycle?

s

α-helix is the _______ structure of protein

secondary

pleotropic effects

seemingly unrelated effects of a mutant gene

pleiotropic effects

seemingly unrelated effects of a mutant gener

prokaryotes

single cell organism with no nucleus

Replication of the E. coli chromosome is initiated at

single site

nucleotides

subunits of each strand of DNA consisting of 4 bases

Ribose

sugar present in RNA

A genetic cross in which the organisms are crosses with the recessive parent "aa" to determine whether observed dominant phenotype is associated with a "AA" or "Aa" genotype is called a

test cross

complementation test

test in which two mutations are brought together into the same cells to check for defects in the same gene

phosphodiester bond

the chemical bonds by which sugar components of adjacent nucleotides are liked through the phosphate group

mutant screen

the isolation of a set of mutants affecting any biological process

complementation

the mutations are in different genes

non-complementation

the mutations are in the same gene

replication fork

the region in which parental strands are separating and new strands are being synthesized

Nucleotides

the subunits of each DNA strand consisting of 4 bases

Nonsense mutations

those base substitutions that change a normal codon to a termination codon

Silent mutations

those base substitutions that do not alter the amino acid sequence of the polypeptide• Due to the degeneracy of the genetic code

Why did Mendel continue some of his experiments to the F2 generation? A) to obtain a larger number of offspring on which to base statistics B) to observe whether or not a recessive trait would reappear C) to observe whether or not the dominant trait would reappear D) to distinguish which alleles were segregating

to observe whether or not a recessive trait would reappear

During prophase a homologous pair of chromosomes consists of

two chromosomes and four chromatids

Synapsis of homologous chromosomes occurs in..

zygotene

In ρ-dependent termination, rut site in RNA acts as the binding site for ________

ρ-protein

(UCAG table is given) The coding strand of a DNA sequence reads 5' - CCAGCATGTCCACTGCGGTCCTG -3'. What is the amino acid sequence if the polypeptide coded for by the RNA if translation occur in vivo?

➢ It's not Pro-Ala-Cys-Pro-Leu-Arg-Ser➢ It's not Met-Leu