HBS Midterm Review

Evaluate the following segment of DNA using the knowledge that HindIII recognizes the sequence 5' AAGCTT 3' and cuts between the two As, creating single-strand "sticky-ends." 5' GGATCCTAAGCTTGGATCCAAGCTTTATAAGAATTCGGGCGGATCCTTATGAATTCTG 3' 3' CCTAGGATTCGAACCTAGGTTCGAAATATTCTTAAGCCCGCCTAGGAATACTTAAGAC 5'

3

A forensic anthropologist finds a 440 mm femur and a 350 mm humerus buried in a shallow grave behind a convenience store. The storeowner (a male) has been missing for over a year. Using the equations below, determine which answer choice best represents his height, based on the length of his femur. Male: (2.97 x MLH) + 73.5 cm ± 3.94 cm Female: (3.14 x MLH) + 65 cm ± 3.72 cm Male: (2.32 x MLF) + 65.53 cm ± 3.94 cm Female: (2.47 x MLF) + 54.10 cm ± 3.72 cm

5' 7"

A forensic anthropologist finds a 440 mm femur and a 350 mm humerus buried in a shallow grave behind a convenience store. The storeowner (a male) has been missing for over a year. Using the equations below, determine which answer choice best represents his height, based on the length of his humerus. Male: (2.97 x MLH) + 73.5 cm ± 3.94 cm Female: (3.14 x MLH) + 65 cm ± 3.72 cm Male: (2.32 x MLF) + 65.53 cm ± 3.94 cm Female: (2.47 x MLF) + 54.10 cm ± 3.72 cm

5'11"

IVs are typically placed in which anatomical region (also the same place blood is usually drawn from)?

Antecubital

All humans (assuming they are relatively healthy) share all of the following processes in common, EXCEPT the need to:

Be exposed to adequate amounts of sunlight in order for their chloroplasts to produce glucose.

Tissues are made up of:

Cells

Most of the cells in this picture are _________ cells.

Columnar

Which of the following describes tissues?

Group of associated cells with similar structure and function.

Which biometric is the most accurate (according to PLTW and 12-year-old articles, though this may be debatable)?

Iris scan

You see your Valentine winking at you. Which muscle is the person using?

Orbicularis oculi

You were not able to make a gender determination. Which bone was most likely missing from the remains?

Pelvis

A 250 pound male and a 100 pound female (with equal physical activity levels and metabolic rates) likely: Base your answer only on the information provided, don't make any other assumptions about these two individuals.

Require significantly different lung sizes to maintain oxygen levels.

Anteriorly, all ribs connect to the ___________.

Sternum

The esophagus is anterior to the spine.

True

A small child falls out of bed and suffers a broken tarsal. The child has a broken

ankle

A patient complains of pain in her neck. What anatomical region of the body is painful?

cephalic

Which of the following tissue types can be described as smooth?

connective

The axillary region is superior to the buccal region.

false

The carpal region is distal to the digital region.

false

The lungs are inferior to the kidneys.

false

Which bone is attached to the proximal end of the tibia?

femur

The femur is the most useful in determining:

height

It feels like you broke your ankle, but the doctor says you tore a tendon instead. You tore the connective tissue that __________.

joins a muscle to a bone.

What characteristic separates DNA fragments during gel electrophoresis?

length of fragment

You see your Valentine blowing you a kiss. Which muscle are they using?

orbicularis oris

Connective tissue is unique from the other major tissue types because most of its cells:

secrete substances to form an extracellular matrix.

Which bone is most useful for determining ethnicity?

skull

A person suffers from a condition resulting in a lack of coordinated movement in the walls of the esophagus. Which tissue is most likely malfunctioning?

smooth muscle

Biometrics are a

technique used to provide positive identification of people for security purposes.

What property of DNA causes it to migrate to the opposite pole of the electrophoresis apparatus?

the negative charge of the phosphate groups

RFLP gel electrophoresis is used ________.

to create DNA fingerprints for identification.

The lumbar region is inferior to the cervical region.

true

The patellar region is on the ventral surface of the lower body.

true

The sternal region is medial to the scapular region.

true