McGraw Hill Biology Ch. 12

1. Why do eukaryotes require a 5' cap and a poly-A-tail but prokaryotes don't? 2. What changes would a scientist want to make a eukaryotic gene before they insert it into a bacterial chromosome to be expressed?

1. Prokaryotes don't need to transport their RNA out of the nucleus, so they don't need these features. 2. They should remove the introns.

1.New amino acids (other than the ignition f-Met) enter at which site? 2.At the E site____ 3.What is unusual about the initiator tRNA: 4.What stimulates the ribosome to move down one codon? 5.If an aminoacyl-tRNA synthetase added the wrong amino acid to a tRNA, what would happen?

1.A. 2.transfer RNA is released 3. It carries a modified amino acid. 4. The formation of a bond between the peptide in the P site and the amino acid in the A site. 5.The tRNA would carry the wrong amino acid, and it would be incorporated into the growing peptide.

The carboxyl terminus of a polypeptide will contain amino acids whose codons are close to the ______ end of the mRNA.

3'

There is only one codeon, 5'-UGG-3' for the amino acid tryptophan (trp), therefore the anticodon in the tRNA for tryptophan must have the sequence

3'-ACC-5'

Shortly after RNA polymerase begins to transcribe a pre-mRNA , a ______ is added.

5' cap

Transcription

Enzyme: RNA polymerase Template: DNA Initiation: Promoter Termination: Terminator Sequence

There is an error during translation of a gene, what will be the consequences?

The protein might not be functional.

There is only one start codon, AUG. This means that

all nearly-made-polypeptides have a methionine at their amino end.

In the nucleus, both 5' and 3' modifications to mRNA are important for____________.

export of the mRNA to the cytosol.

Where does the greatest variability among codons specifying the same amino acid occur?

in the third nucleotide of the triplet

Total nucleic acids are extracted from a culture of cells and are then mixed with resin beads to which the polynucleotide 5'-TTTTTTTTTTTTTTTTTTTTTT-3' has been covalently attached. After a short incubation, the beads are then extracted from the mixture. When you analyze the cellular nucleic acids that have stuck to the beads, which of the following molecules do you expect to be most abundant?

mRNA

During the process of translation in a eukaryote

mRNA interacts with ribosomes in the cytoplasm

A tRNA with anticodon 3'-UAC-5' would be attached to the amino acid

methionine (met)

A mature mRNA will have a _________ added.

poly A tail

A tRNA with anticodon 3'-GGG-5' would be attached to the amino acid

proline (pro)

The reason that the genetic code can correctly specify the order of amino acids in a polypeptide is

specific tRNAs become attached to specific amino acids.

In the cytosol, the poly A tail is important for _______ of the mRNA.

stability

In eukaryotes, transcription to produce an mRNA must occur in

the nucleus, where the chromosomal DNA is found.

In the cytosol, the 5' cap is recognized by proteins that enable the mRNA to be ________.

translated.

Spicing joins together____?

two exons

The template strand of a gene includes the sequence 3'-AGT-5'. The mRNA will therefore have the sequence _________ in the same position.

5'-UCA-3'

Which of the following does NOT occur during translation in eukaryotes?

Introns are removed by the ribosome.

Below is a segment of DNA. What two possible transcripts can this segment produce? 5' CTATGGGCCATTTTTTAACGGGAGGCCCATGAA 3' 3' GATACCCGGTAAAAAATTGCCCTCCGGGTACTT 5'

Met-Gly-His-Phe-Leu-Thr-Gly-Gly-Pro and Met-Gly-Leu-Pro-Leu-Lys-Asn-Gly-Pro

A difference between bacterial and eukaryotic translation is_____.

Modification to the 5' end of mRNA help to to bind to ribosomes only in eukaryotes.

The amino terminus of a polypeptide will contain amino acids whose codons are close to the ______ end of the mRNA.

5'

Part of a gene sequence on the DNA reads 5'-ATGCGC'3'. The mRNA will therefore read _________ in that region.

3'-UACGCG-f5'

Sickle cell anemia is a disease that causes difficulty breathing, circulatory problems, and can lead to death. This disease causes red blood cells to be misshapen, so they are sickle-shaped and ridged rather than round, plump, and highly elastic. Sickled cells die more rapidly than healthy cells and therefore lead to reduced oxygen to the tissues and the blockage of blood vessels. Below is the sequence of DNA of a healthy individual and the sequence of DNA that leads to sickle cell anemia. Normal:... CTG ACT CCT GAG GAG AAG TCT ... Mutant:... CTG ACT CCT GTG GAG AAG TCT ... 1. Using Table 3.14, characterize the amino acids that have been substituted in the normal and mutant proteins, glutamic acid to valine. 2. Which of the following statements below is TRUE?

1. Glutamic acid is acidic and polar, valine is non polar 2.A single point mutation in the DNA sequence leads to a change in the protein structure, which leads to a change in the protein's function and causes sickle cell anemia.

1.The segments of the DNA molecules where mRNA synthesis begins is called the ____? 2. The complimentary mRNA strand that would be synthesized from the DNA base sequence of 5' CTGAC 3' would be____? 3. The structure that causes the synthesis of RNA to cease is known as the ____? 4. What is the difference between DNA replication and RNA transcription. 5. How do you know that the gene being transcribed in the animation is a prokaryote?

1.promoter region 2.3' GACUG 5' 3.transcription terminator 4.In DNA replication the helix is never closed after it is opened by helices, but once RNA polymerase has finished transcribing a region the double helix closes 5.The initiation of transcription involves a sigma factor.

The genetic code is degenerate. This means

A particular amino acid can be specifies by more than one codon.

Gene expression is the process whereby genetic information in the cell is used to produce proteins. This is referred to as the central dogma. Match the descriptions of the components of gene expression with the correct terms. A.The molecule that carries information from the DNA specifying a polypeptide to ribosomes. B. The synthesis of an RNA copy of a gene. C. The synthesis of a specific sequence of amino acids on a ribosome. D. A molecule found in the nucleus of cell that contains the cell's genome. E. A molecule made of amino acids that correspond to the genetic information in a structural gene.

A. mRNA B.Transcription C.Translation D.DNA E.Polypeptide

Translation

Enzyme: Ribozyme Template: mRNA Initiation: Start Codon Termination: Stop Codon

Place the following events of transcription in the correct order. RNA polymerase binds to promoter. DNA is unwound, forming an open complex. RNA is synthesized in the 5'-->3' direction. The new mRNA is released. RNA polymerase reaches the terminator.

RNA polymerase binds to promoter. DNA is unwound, forming an open complex. RNA is synthesized in the 5'-->3' direction. RNA polymerase reaches the terminator. The new mRNA is released.

During the process of transcription in a eukaryote

RNA polymerase must synthesizes new nucleotide chain in the 5' to 3' direction.

A mutation occurred in the third codon position of a gene, but the protein still functions normally. How is this possible?

The genetic code is redundant, so that mutations in the third position of the codon often result in the same amino acid being specified.

Why are nucleotide triphosphates used to polymerize RNA?

The triphosphate is a high energy molecule so that polymerization is spontaneous.