Molecular basis of life

What is a clone? How is it created?

A. A group of identical cells that share a common ancestry B. Taking a cell and an egg and extracting the DNA from the cell and taking the DNA out of he egg inserting cells DNA into egg then placing they egg with the Cells DNA into a surrogate mothers womb.

What is a gene mutation? How do they occur? What is he mutation that involves a single nucleotide?

A. A permanent alteration in the DNA sequence that makes up a gene B. A mistake is made as DNA copies itself during cell division C. Point mutation

What are the functions of gel electrophoresis? What is the purpose of gel electrophoresis with analyzing DNA?

A. Separate lengths of DNA samples by using different changes. B. If you break apart a cell in order to acquire the protein, expressed by cells, you can use it in order to see the different size of a protein this is present inside the cell

change TACCGCTAGCAATCGATGATC into RNA form

AUGGCGAUCGUUAGCUACUAG

What is base pairing in DNA? What are the rules?

Any of the pairs of nucleotides connecting the complementary strand of a molecule of DNA or RNA, consisting of a purine linked to a pyrimidine by hydrogen bonds A-T C-G

On a gel electrophoresis, band B is closer to the positive end of the gel then band A. What does this mean?

Band B has smaller pieces of DNA. That traveled farther

Compare and contrast DNA and RNA

DNA has bases such as Adenine, Guanine, Thymine, and Cytosine, long, uses sugar deoxyribose. RNA has bases such as Adenine, Guanine, Cytosine, and Uracil, short, uses the sugar ribose.

What is an alteration or change in DNA? What are the possible results?

Mutation; the mutation occurs in a tretch of DNA with no function or the mutation occurs in a protein- coding region, but ends up not affecting the amino acid sequence of protein.

What is a main source of genetic variability?

Mutations and recombinations

What happens during each step

Step 1- restriction of enzymes Step 2- gel electrophoresis Step 3- polymerase chain reaction Step 4- DNA sequence

Describe a nucleotide found in DNA, list main parts.

The sugar in DNA is deoxyribos nucleotide, contains Thymine, cytosine, Adenine and guanine

Why is it possible for an amino acid to be specified by more than one kind of codon?

There are many more codons and only 20 amino acids

what does that chart show?

A chart to find the amino acid that corresponds to a codon.

What happens during translation?

A factory for the synthesis of the protein translation of an mRNA molecule.

What is the outcome of DNA replication?

A new identical DNA strand

What is selective breeding? Give example.

A process used by humans to develop new organisms with desirable characteristics, hens that lay eggs of a particular color

What happens during transcription?

A strand of mRNA is made that is complementary to DNA and nucleus.

How many bases are needed to specify three amino acids?

4