Molecular Genetics and Biotechnology

Which of the following statements regarding RNA is false?

RNA uses the sugar dextrose

In eukaryotic cells, a terminator in mRNA synthesis is _____.

a specific nucleotide sequence in DNA that signals the RNA polymerase to stop

Chemically synthesized DNA molecules are used in the polymerase chain reaction (PCR). Which step are they involved in?

cooling of the target strands to allow the primers to anneal

Concerns have been raised as to the safety of genetically modified organisms (GMOs). Which of the following would be a concern when modifying a plant to be resistant to a broad-spectrum herbicide?

the production of herbicide-resistant weeds

Approximately what percentage of the human genome actually encodes proteins?

3%

A gene is a sequence of DNA nucleotide bases that codes for a single protein. Approximately how many nucleotide bases would be required to code for a protein chain that is 100 amino acids long?

300***?

What amount of thymine would be found in a double stranded of DNA composed of 15% cytosine?

35% (70% A & T in DNA so 35% T)

We would expect that a 15-nucleotide sequence ending with a stop codon will direct the production of a polypeptide that consists of

4 amino acids

When one DNA molecule is copied to make two DNA molecules, the new DNA contains

50% of the parent DNA.

________ marks the end of a gene and causes transcription to stop.

A terminator

Which of the following restriction enzymes cuts the following DNA? Assume that ^ determines the cut site. GCATTACGGGATCCACCCGTT

BamHI (G^GATCC)

In eukaryotes, the process of transcription is controlled by _____.

DNA

Which of the following occurs during DNA replication?

DNA polymerase elongates the daughter strand, adding new nucleotides to the 3' end of the molecule. The molecule grows 5' to 3' but is therefore read 3' to 5'. (DNA polymerase only adds to 3', which has OH group, molecule grows 5' to 3')

DNA carries out two basic functions in cells: (1) information storage and transfer (genes can be copied and passed to offspring) and (2) the "blueprint" function (genes provide instructions for building proteins). The key process for information storage and transfer to offspring cells is _____

DNA replication

The central dogma describes how the genes in the nucleus work to produce an organism's phenotype. Another way of putting it is that the central dogma follows the flow of information from _____.

DNA to protein

Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component?

DNA → RNA → protein

Gel electrophoresis separates DNA molecules on the basis of size. Which of the following would move the slowest?

F plasmid (100 kb)

If a biochemist were searching for the nucleic acid sequence CTAGTTATG, what sequence would the biochemist use to make a nucleic acid probe?

GATCAATAC

If one strand of DNA is CGGTAC, the corresponding strand would be

GCCATG.

Which of the following is true about double-stranded DNA?

Its width is about 2 nm. (Nitrogenous bases stacked 1/3 nm apart)

Plasmids are extrachromosomal pieces of DNA that are not necessary for the "housekeeping" activities of the cell. When constructing a recombinant molecule, genetic engineers frequently use plasmids that have at least one gene for antibiotic resistance. Antibiotics can then be applied to the media on which bacterial cells may be growing. What is the best explanation for this practice?

It allows detection of the bacteria that have been transformed with this plasmid and therefore the gene of interest.

Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation?

Prokaryotic DNA is much smaller than eukaryotic DNA

In transcription, _____.

RNA polymerase links nucleotides to form mRNA.

When are DNA molecules the least tightly coiled?

S phase of interphase (DNA must unwind in order for replication to occur)

What controls the way in which a zygote differentiates?

Selective genes are turned on and off, depending on the fate of the cell.

Anhidrotic ectodermal dysplasia is an X-linked disorder that results in the absence of sweat glands. How would this condition be manifested in a heterozygous female?

She would have a random pattern of tissue with and without sweat glands. (Bc one of female's two Xs inactivated in each cell, would have random)

Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins?

Sulfur (Proteins contain, but nucleic acids do not)

Which of the following statements regarding the structure of DNA is false?

The sequence of nucleotides along the length of a DNA strand is restricted by the base-pairing rules

A new treatment for cystic fibrosis (CF) is currently being tested. The treatment is sprayed into the noses of patients with CF. The spray contains a genetically engineered adenovirus that carries a (CFTR) gene, which codes for a normal protein involved in the function of chlorine channels. Cells that harbor the adenovirus express the gene, and patients experience relief from the debilitating respiratory symptoms of CF. What is the significant drawback of this treatment?

The treatment only lasts until the epithelial cells lining the nasal cavity are shed.

In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation?

Translation cannot occur until the RNA leaves the nucleus in eukaryotes.

A mistake during DNA replication prevents the trp repressor from binding to the operon operator. When these cells are placed in a solution containing chicken broth, what happens?

Tryptophan would bind to the repressor.

An anticodon is____

a set of triplet bases that is complementary to a codon triplet on mRNA

Proto-oncogenes have the potential to become oncogenes. Which of the following is most likely to lead to cancer? *********

a mutation that causes the proto-oncogene to become overactive (over active proto can become oncogene

Which of the following is found in RNA but not in DNA?

an additional hydroxyl group (2')

In prokaryotes, a group of genes with related functions is called _____.

an operan (group of structural genes with related functions)

A scientist wishes to prepare a genomic library, but the DNA to be cloned is large. Which of the following vectors should be used?

bacterial artificial chromosomes

In eukaryotic cells, several proteins are involved in the process of transcription. This process involves enhancers that are _____.

bound by activators, causing DNA to bend (can then interact with other transcription factor proteins and bind as complex at gene's promoter)

Lac operon regulatory genes are _____.

continually expressed (why E coli always has small supply of repressor molecules)

On one strand of DNA, one nucleotide is linked to the next through _____.

covalent bonds between the sugar of one nucleotide and the phosphate of the next (Bonding pattern creates sugar phosphate backbone of nucleic acids)

The production of multiple identical copies of gene-sized pieces of DNA defines

gene cloning.

In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____.

includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns

The promoter of an operon _____.

is where RNA polymerase binds (to DNA to initiate transcription)

The gene for human growth factor is inserted into the E. coli lactose operon so that it replaces the structural genes with the gene for human growth factor. What substance must be added to the bacterial culture so that it produces human growth factor?

lactose (removes repression of operon by inactivating repressor, permits transcription, human growth hormone produced)

A particular gene does NOT constantly churn out the same protein at all times in every cell. This is true for two reasons. First, _____ can allow one gene to produce several different proteins. Second, genes are constantly being turned on and off through the process of _____.

mRNA processing ... gene regulation

In some species of bacteria that are resistant to the antibiotic tetracycline, the antibiotic molecule attaches to a repressor protein. This prevents binding of the repressor to the bacterial DNA and allows a set of genes to be transcribed. The transcription of these genes is under the control of a(n) _____.

operon

One type of virus that infects bacteria is called a

phage

Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

prematurely stops the translation of the protein (mutation causes insertion of stop codon, prematurely terminate translation of protein)

When DNA from two sources is combined into one single piece of DNA, it is known as

recombinant DNA.

In prokaryotes, operons _____.

regulate the rate of transcription

Tryptophan is placed into a culture of E. coli cells. As a result, the bacterial cells switch off transcription of tryptophan because the amino acid binds to the _____.

repressor (T binds to repressor, which activates and binds to operator. Switches off gene transcription and tryptophan no longer made)

During replication, the original "parent" DNA _____.

serves as the template for the creation of two complete sets of DNA

The type of mutation represented below is a(n) _____. The big red fly had one eye (wild type) The fbi gre dfl yha don eey (mutant)

shift in reading frame (addition of one nucleotide shifts reading frame, known as frameshift)

Multiple origins of replication on the DNA molecules of eukaryotic cells serve to

shorten the time necessary for DNA replication.

After translation is complete, the insulin polypeptide is activated by _____.

the cutting of the initial translation product to yield two shorter chains joined together by sulfur linkages (active form of insulin protein)

At the start of translation, where does the initiator tRNA bind?

start codon on the mRNA molecule

What genetic information does cDNA contain?

the DNA sequence of expressed genes (prod fr strands of mRNA)

If protein production were an assembly line, a ribosome would be _____.

the worker who puts all of the pieces together

The translation process in eukaryotes requires all of the following: _____.

transfer RNA, ribosomes, AUG codons

tRNA molecules work to _____

translate mRNA to produce a specific amino acid sequence

MicroRNA (miRNA) controls _____.

translation (binds to complementary regions on mRNA molecules. Either degrades mRNA or blocks translation)

A new organism is discovered that has six different nucleotides that encode 30 different amino acids. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?

two-nucleotide sequence (would encode max 36 amino acids 6^2)***?