molecular genetics module 3 exam

The full-length (i.e., containing the entire protein coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. How would you explain the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? 8-3

- There was possibly a duplication of the gene in pigs. - Also the duplication of the gene was diverged. - Or humans lost one copy of the gene.

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment. Answer: 1

1

List four uses of PCR 10-3

1) Cell free cloning 2) Screening for genetic disorders 3) Forensics 4) Paleobiology

A typical prokaryotic genome has 2-20

1000 base pairs of DNA, containing a few thousand genes. 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few hundred genes. 1 million base pairs of DNA, containing 1000 genes.- ANSWER

You are doing an experiment to characterize a 3000bp clone using two different restriction enzymes. Enzyme 1 (E1) produces 2 fragments in a single digest of 1400 and 1600bp. Enzyme 2 (E2) also produces 2 fragments of 1400 and 1600bp. When a double digest using both of these enzymes is done, it results in 2 fragments of 1400bp and 200bp. Based on this data, choose the correct restriction map from the choices given below. 2-19

1400bp/E1&E2 1600 bp 1400bp/e1/200bp/e2/1400bp- ANSWER 1000bp/e1/800bp/e2/1200bp 1400bp/e1/1400bp/e2/200bp

Rank from "roughest" → "fine detail" the amount of resolution allowed by the following methods of mapping: 1-7

2_____ Cytogenetic map 4_____ Sequence map 1_____ Linkage map 3_____ Restriction map

The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave? 9-2

4 base cutter: (1/4)^4= 1/256 bp Gets cut (3e9)/256= 11,718,750. 6 base: (1/4)^6= 2.44e-4 (1/5000 bp) Gets cut (3e9)/5000= 6,000,000 cuts 8 base: (1/4)^8= 1e-5 (1/10,000 bp) Gets cut (3e9)/10,000= 30,000

A fragment of DNA is cloned into a plasmid with a sequencing primer binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 2-17

5' ACGATCG 3' 5' GCTAGCA 3'-ANSWER 5' CGATCGT 3' 5' TGCTAGC 3'

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? 1-35

A 10-kb, an 8-kb, and a 2-kb fragment A 10-kb and a 2-kb fragment A 12-kb fragment An 8-kb and a 2-kb fragment An 8-kb fragment- ANSWER

In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms? 7-1

A map unit is the amount of recombination between two linked points in the genome because one map unit in humans is much more bps than in yeast. The amount of homologous recombination per DNA must be lower in humans than in yeast. So there is less recombination per unit length in humans than yeast.

In the context of recombinant DNA technology, what is meant by the term vector?

A vector is a vehicle to carry recombinant DNA molecules into the host cells where independent replication can occur. Most common vectors are plasmids, bacteriophages, and cosmids.

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? 1-23

A) DNA polymerase B) restriction enzymes specific for the target genes C) DNA ligase D) Both B and C- ANSWER

PCR is 1-24

A) one of the control elements of the cell cycle B) None of the above C) necessary for efficient replication of cell's DNA in interphase D) a technique for amplifying DNA sequences in vitro- ANSWER

You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment? 5-2

Accept anywhere from 28 to 30 cycles as a correct answer or the following equation (3 times 2(n)= > than 1 billion)

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? 1-33

An EST database of the human genome Microarray data of tissues in which the gene is expressed Information about bacterial orthologs of the gene Data about the inheritance of SNP markers in families with the disease-ANSWER Whole-genome-shotgun clones of the human genome

One of the dominant features of the immune system is the capacity to generate new cells that contain different combinations of antibodies. Because there are billions of such combinations it is impossible that each combination is coded by a separate gene. Explain in as much detail as you can how such diversity is accomplished in the case of the light chain of a typical antibody. 3-2

An antibody is a Y-shaped molecule that contains 4 chains (2 heavy and 2 light). There are two types of light chains and 5 types of heavy chains. Different combinations of chains create different types of antibody classes. Each mature B cells makes one type of light chain and one type of heavy chain. The light chain genes have many different regions.

Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids? A

An insert of DNA in the polylinker inactivates the lacZ component and allows identification of recombinant plasmids under proper genetic and environmental conditions.

What is a transgenic organism? 2-11

An organism that stably carries a foreign gene within its genome.

Use the following list of markers found on a collection of cloned genomic fragments for question 14. 1-5 A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment. Answer: 1- only one site

Answer: 1- only one site

What appears to be the range of number of protein-coding genes per genome in eukaryotes? Answer: 5000 to about 45,000

Answer: 5000 to about 45,000

What is meant by the designation EcoRI?

Answer: EcoRI is an endonuclease from E coli. it is a restriction enzyme. 3/3 Feedback: one of the first restriction enzymes isolated from E. coli.

In the polymerase chain reaction, what is the purpose of the initial high temperature? What is the purpose of cooling in the second Step?

Answer: The initial high temperature will denature the double stranded DNA. The cooling allows for the primers to anneal. 3/3 Feedback: denature the target (template) DNA, annealing the primer to the target.

Name the two strategic methods that scientists are using to sequence genomes.

Answer: clone-by-clone method and shotgun cloning

What is a cDNA molecule?

Answer: complimentary DNA molecule - genes that are transcribed - found only in mature RNA, so introns are removed. 3/3 Feedback: A cDNA molecule is a DNA copy of an RNA molecule. Or complementary DNA.

What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?

Answer: to remove viral/pathogenic DNA. 3/3 Feedback: Isolated from bacteria, restriction endonucleases restrict or prevent viral infection by degrading the invading nucleic acid of the virus.

What are three key differences between a genomic and a cDNA library? 4-2

CDNA lib. Represent only transcribed regions of the genome All genes equally represented in genomic library while cDNA library reflects the level of expression of a gene in a particular cell type or tissue cDNA library contained only sequences found in the mature mRNA- introns are removed

Of the DNA sequences below, which would probably be the harder to determine? 1-26

CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA The repetitive region in "A" would make it harder to determine with certainty, even though it is shorter than "B."

In the previous list of cloned fragments, the fragments needed to make the longest possible contig, with the least amount of overlap, are . 1-9

Cloned fragment Markers present A M4 M5 B M1 M2 M3 C M6 M7 M8 D M3 M4 M5 M6 E M3 M4 M5 F M8 M9 M10 ANSWER: BCDF

As a model system, what are some of the advantages of the mouse as a model system? 1-3

Easy to grow, short generation tim,e readily matagenized and crossed Mice have similar body plans and stages of development as humans Similar genome size and number of chromosomes, as humans Many genes have homologs in humans

Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse. 2-1

Embryonic stem (ES) cells heterozygous for a knock-out mutation in a gene of interest (x) and homozygous for a marker gene (here, black coat color) are transplanted into the blasocel cavity of 4.5-day embryos that are homozygous for an alternate marker (here:white coat color). The early embryos then are implanted into a pseudo-pregnant female. Some of the resulting progeny are chimeras, indicated by their black and white coats. Chimeric mice then are backcrossed to white mice, black progeny from this mating have ES-derived cells in their germ line. By isolating DNA from a small amount of tail tissue, it is possible to identify black mice heterozygous for the knock-out allele. Interecrossing of these black mice produces individuals homozygous for the disrupted allele, that is, knockout mice. Inject ES cells into blastocoel cavity of early embryo surgically transfer embryo into psudopregnatn mouse homozygous white progeny/chimeric progeny male chimeric mice to homozygous white mice black progeny develop from germ-line cells derived from ES cells and are heterozygous for disrupted gene x

All of the following are characteristics of the genomics revolution EXCEPT_____________ 2-23

Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Ability to conduct discovery-based research Large scale acquisition of DNA sequences Inability to understand single genes- ANSWER

Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes. 4-1

Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes or Genes are more densely spaced in prokaryotes verses eukaryotes or Prokaryotic genomes typically encode fewer genes than eukaryotic genomes

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? 1-17

Eukaryotic: repetitive DNA Eukaryotic: circular DNA Prokaryotic: presence of plasmids Eukaryotic: ESTs Prokaryotic: repetitive DNA

Describe the standard PCR method (in sufficient detail) and how this process is able to produce clones in a "cell-free" system. 4-3

First, the DNA sequences of the desired target region must be known so that single stranded DNA primers flanking the DNA region of interest. Next, template target DNA is mixed with the single stranded primers, a novel heat tolerant polymerase (Taq polymerase), free nucleotides, and salts, in an in-vitro system. The temp. Is raised to 95 degrees to denature the double stranded DNA molecules. The solution is then cooled to 35-60 degrees to allow the single stranded primers to anneal to their targets. The temp is then raised to 68-72 degrees where the Taq polymerase functions, replicating the region, and the entire process is able to be done in an in-vitro system, resulting in up to million of copies (clones) from a single DNA template target

Before sequencing, the DNA fragment was cloned into a plasmid. On the strand that acted as the template in the sequencing reaction, what base of the cloned fragment was closest to the primer? 1-29

G A- ANSWER C T

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map? 3-1

Gene mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to their regions of the chromosomes

The_________________ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human genome.

Human Genome Project

cExplain why the greatest diversity of human SNPs is found among African peoplec 6-c

Humans are thought to have first evolved in Africa. These populations are the oldest with the greatest amount of time to accumulate polymorphisms

Figure A below shows a restriction map of a rare prokaryotic gene with its direction of transcription indicated by the arrow. Figure B shows the unique cloning region (i.e., multiple cloning site) contained within a plasmid-cloning vector. The blackened region in Figure A represents the amino acid coding sequence of a protein that can be used in humans as a vaccine. The stippled region in Figure B is a highly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate the cleavage sites for different restriction enzymes. Known gene sequences are indicated by short thick lines. Explain how you would isolate and fuse the coding region (Figure A) behind the indicated promoter in the cloning vector (Figure B) to produce large amounts of the protein in bacterial cells. Assume that the cloning vector carries the gene for tetracycline (an antibiotic) resistance. Letters represent different restriction enzymes 7-3

I would use restriction enzyme (RE) C with either RE D or RE B to clone the gene in the expression vector so that the beginning of this gene is directly 3' of the strong promoter.

Which of the below are not steps in the production of genome sequence maps: 2-18

Identify molecular markers on specific chromosomes. Isolate whole chromosomes.- Answer When sequences are obtained, assemble and organize the sequences in order. All of these are steps you would use. Read the sequence of individual piece of the genome.

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by 1-34

Identifying the molecular weights of the fragments in question Measuring the sizes of the bands on the gel None of the above Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest - ANSWER Knowing the isoelectric points of the piece in question.

What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined. 1-1

In a Northern you are examining RNA expression by probing the filter. The methodology is the same as a Southern, the difference being that you are examining RNA. The quantity of RNA expression can be determined by the intensity of the band, whether it is a radioactive or a fluorescent probe. Of course, you will have to have a control on the gel so that you have something to compare it to to determine relative expression, and by extension, the amount of RNA. (per Dr. Booton)

You are handling a paternity lawsuit brought against five potential fathers by a woman. You isolated DNA from the mother, the child, and all the potential fathers. After using PCR to amplify specific polymorphic loci from each individual, you fractionate the amplified products on an agarose gel and stain with ethidium bromide to visualize the DNA fingerprints (shown below). Mo = mother; Ch = child; M1-M5 = potential fathers. Do these results confirm that any of the men are the child's biological father? Explain your answer. 6-2

M4 could be the father. We can exclude all other males because the child has at least one band that is not present in the mother or any of the potential father except for M4.

Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression). 1-4

Microarray

We have looked at the cloning experiments involved in producing Snuppy. Describe the specific technique that was used and how the results demonstrated that Snuppy was in fact a clone of the donor Afghan hound. 7-2

Microsatellite analysis was used to show that snupppy was a clone. Microsatellite loci are highly variable loci that contain a large number of DNA repeats (eg. 2, 3, or 4 nucleotides in length) at the population level. However, an individual can only have 2 of these alleles at any one microsatellite locus. By comparing the alleles that snuppy had at 8 different dog microsatellite loci with those allele that the donor afghan hound and the surrogate mother had, it was shown that snuppy had exactly all of the same alleles as the afghan hound, providing that snuppy was a clone of the donor afghan

The smallest number of clones that represents the entirety of the genome are called what? 2-13

Minimum tiling path

Cloning reactions are done with DNA that has been cloned by restriction digestion and not by PCR. Using what you know about the way PCR works, why would you not want to use DNA from PCR to create DNA for cloning? 5-3

Normally in DNA replication, polymerase makes errors one out of every 1010 nucleotides inserted. (In addition, Taq polymerase used in PCR is less faithful because it does not have a proofreading subunit). Because PCR amplifies from previous sequences if an error is made early on it will be proliferated in the sequence.

List at least three different kinds of bacterial cloning vectors. 2-2

Plasmid Phage Cosmid bacterial artificial chromosome or BAC

A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP). 2-8

Reporter gene

Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome? 1-18

See if a SNP database contains sequences in the region.- answer Scan the region for intron splice sites. Scan the region for ORFs. Scan the region for promoter sequences. See if an EST database contains sequences in the region.

Compare the fields of structural, functional, and comparative genomics. What is the purpose of each? 9-1

Structural Genomics: Concerned with the organization and sequence of the genome. Functional genomics : concerned with what the sequence and genes do. Compartive genomics : comparing and contrasting the genomes of different organisms.

A pedigree and Southern blot results in humans are shown below. Filled-in figures represent individuals expressing a dominant trait (hypothetical) for blue tongue. What can you say about the potential linkage relationship between the allele responsible for the trait? Shaded regions within the homologs represent sequences that hybridize to the probe used for the Southern analysis. Arrows indicate cleavage sites used for the Southern analysis 6-1

The 1 kB RFLP (homologue B) is linked to the dominant blue tongue trait

You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful? 1-14

The RE must have complementary sticky ends so that they will anneal together

You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?

The restriction enzyme must have complementary sticky ends so that will anneal together.

Compare the transcriptome of an organism with the proteome. What is described by each? 8-2

The transcriptome of an organism has all RNA transcripts both coding and non coding. The proteome only has proteins that result from those transcripts. Transcriptomes are all the RNA molecules that are transcribed from the genome however proteomes are the proteins that are encoded by the genome.

Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.

The white colonies would most likely contain the recombinant pUC18 because they are not blue. If they were blue, then that would mean that the lacZ gene is functioning normally, and the lacZ gene didn't pick up the foreign gene. 4/4

Why are telomeres and centromeres particularly difficult to sequence? 9-3

They consist of highly repetitive DNA and strand slippage can confuse the determination of a consensus sequence.

Explain why genetic and physical map distances may differ in relative distances between two genes on a chromosome. 2-3

They have available to them two broad categories of maps: genetic maps and physical maps. Both genetic and physical maps provide the likely order of items along a chromosome. However, a genetic map, like an interstate highway map, provides an indirect estimate of the distance between two items and is limited to ordering certain items. Once could say that genetic maps serve to guide a scientist toward a gene, just like an interstate map guides a driver from city to city. On the other hand, physical maps mark an estimate of the true distance, in measurements called base pairs, between items of interest

What is the function of dideoxynucleotides in Sanger DNA sequencing? 1-20

They stop synthesis at a specific site, so the base at that site can be determined.-ANSWER They cut the sequenced DNA at specific sites. They allow only the specific sequencing of the RNAs of a genome. They act as primers for reverse transcriptase. They act as primers for DNA polymerase.

What is the purpose of the LacZ gene in a plasmid cloning vector? 2-12

To be able to distinguish those colonies with an insert using blue/white selection white have an insert

What is the purpose of an antibiotic resistance gene in a plasmid cloning vector? 2-7

To determine if the vector is present in host cell

What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?

To determine if the vector is present in the host cell.

The transcriptome of a genome contains more components than the proteome. Explain why this is true. 8-1

Transcriptome: all the RNA molecules transcribed from a genome Proteome: all the proteins encoded by the genome It takes 3 RNA codons to code for one protein, so it is natural to have more transcriptome (RNA molecules) than proteome (proteins).

What term is used to refer to the process in which DNA can be introduced into host bacterial cells?

Transformation

What methods are used to produce mutations in a forward genetics approach? 1-12

UV light EMS Nitrosoguandandine transposons

The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans? 3-3

You could generate cDNA libraries and compare the transcribed regions of the genome

Match each term with the best letter choice:

_____3 Paralog _____2 Ortholog _____4 Synteny _____1 Homolog 1. Closely related genes based on sequence and function. 2. Homologus genes of the same locus inherited from a common ancestor. 3. Genes related by gene duplication in the genome. 4. Conservation of the same groups of genes in the chromosomes of 2 or more species.

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? 1-19

a) All produce lipid as a product. b) All produce RNA as a product. c) All produce DNA chains as a product. -ANSWER d) All produce RNA as a product.

What is the definition of a clone?

a) An identical organism, or a cell that has been derived from a single ancestor. answer b) A circular DNA molecule that is able to replicate by itself c) A new combination of DNA molecules that is not found naturally d) A non-identical organism produced by recombinant DNA technology

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? 1-36

a) DNAse b) gene cloning c) isolation of stem cells from a lamb embryo and production of a zygotic equivalent d) hydrogen sulfide e) reverse transcriptase- ANSWER

What is bioinformatics? 1-30

a) a technique using 3D images of genes in order to predict how and when they will be expressed b) a method that uses very large national and international databases to access and work with sequence information - ANSWER c) a series of search programs that allow a student to identify who in the world is trying to sequence a given species d) a software program available from NIH to design genes

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that 1-27

a) bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA b) bacterial RNA polymerase cannot make RNA complementary to mammalian DNA c) prokaryotes use a different genetic code from that of eukaryotes d) bacteria cannot remove eukaryotic introns.- ANSWER

Plasmids are important in biotechnology because they are 2-25

a) recognition sites on recombinant DNA strands b) surfaces for respiratory processes in bacteria c) surfaces for protein synthesis in eukaryotic recombinants d) a vehicle for the insertion of foreign genes into bacteria-ANSWER

What is the enzymatic function of restriction enzymes? 2-22

a) to cleave nucleic acids at specific sites- ANSWER b) to add new nucleotides to the growing strand of DNA c) to join nucleotides during transcription. d) to repair breaks in sugar-phosphate backbones

Write the letter all of the following statements that are NOT true. 1-6

a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. - ANSWER c. VNTRs are highly conserved in human populations. -ANSWER d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.

During gel electrophoresis, __ will migrate more rapidly than __. 2-10

a. cloning vectors b. ethidium bromide c. large DNA fragments - ANSWER d. DNA size markers e. small DNA fragments -ANSWER

List two especially useful characteristics of cloning vectors. 2-24

ability to integrate into the host chromosome and then cause a lytic cycle nonautonomous replication and transposition high copy number and antibiotic resistance gene(s) - ANSWER reverse transcriptase and ligase activities virulence and lysogenicity

For a physical map of a chromosome, distances are measured in units of 1-16

base pairs.- ANSWER contigs. percent recombination. centiMorgans. RFLPs.

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? 1-22

blunt ends poly-A sequences 5' cap single stranded complementary tails -ANSWER interference

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. 2-21

clone chromosome sequence contig- ANSWER map

One of the primary reasons for the necessity of generating a large number of clones in a eukaryotic genomic library is that 2-16

each ligation product is sequence specific. the host range of the vector is limited each cosmid replicates nonautomously. each vector can take up only a relatively small fraction of the eukaryotic DNA. - ANSWER lysogenic phage continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones.

A BLAST search is done to 2-26

find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find similar gene or protein sequences.-ANSWER find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed.

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? 1-32

five two three-ANSWER four six

This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism. 3-6

genome project

This is the study of "genes in their entirety." 1-11

genomics

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally 1-28

hybridizes filter-bound DNA with a DNA probe - ANSWER hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. cleaves RNA with restriction endonucleases ligates DNA with DNA ligase.

Match each term with the best letter choice:

in situ hybridization chromosome spread ß-galactosidase lacZ expression vector protein, OR Plasmid real-time PCR DNA quantification transgene foreign DNA PCR Taq polymerase YAC centromere shuttle vector Plasmid OR Multiple Hosts cloning vector plasmid cDNA library mRNA

Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.

less

A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene. 3-8

multigene

Describe the basic components for a typical plasmid cloning vector system and the reason/use for those plasmid vector components. 10-1

multiple restriction sites, an origin of replication site, and selectable markers Restriction sites: cut the plasmid and foreign DNA with the same enzyme and insert a gene. Origin of replication: new recombinant genes will be able to replicate and increase in #. Selectable markers: detect recombinant plasmids. Ex: lacZ gene produces B galactose but recombinant ones don't.

List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each. 1-2

multiple restriction sites, an origin of replication site, and selectable markers Restriction sites: cut the plasmid and foreign DNA with the same enzyme and insert a gene. Origin of replication: new recombinant genes will be able to replicate and increase in #. Selectable markers: detect recombinant plasmids. Ex: lacZ gene produces B galactose but recombinant ones don't.

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ . 2-14

orthologs

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? 1-25

palindrome β-galactosidase consensus sequence complementation polylinker - ANSWER

The set of all proteins encoded by the genome is called the _______ . 1-21

pharmacogenome proteome-ANSWER glycome genome metabolome transcriptome

A map of the distribution of cloned genomic DNA from genomic clone libraries. 3-10

physical map

A map of the order, overlap and orientation of physically isolated pieces of the genome. 3-5

physical map

Describe three different kinds of bacterial cloning vectors.

plasmid - circular, double-stranded DNA molecules that exist in bacteria and in the nuclei of some eukaryotic cells. They can replicate independently of the host cell. The size of plasmids ranges from a few kb to near 100 kb. phage - viruses that can infect bacteria, high transformation efficiency, about 1000 times more efficient than the plasmid vector, can hold 10-15 kb Cosmid - vector combination of the plasmid phage, which allows the target DNA to be inserted into the phage head. High transformation efficiency. Can carry up to 50 kb. bacterial artificial chromosome - can hold 300 kb, artificially made. yeast artificial chromosome, YAC, vector is capable of carrying a large DNA fragment, up to 2 Mb, but its transformation efficiency is very low.

A PCR technique that fills in small gaps by using the end of a cloned sequence as a primer to amplify into adjacent uncloned fragments. 3-7

primer walking

What is the specific application of reverse transcriptase in the preparation of cDNA?

synthesis of DNA to form an RNA-DNA duplex

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. 1-31

visual examination, eliminate - ANSWER temperature extremes, enhance epistasis analysis, enhance complementation analysis, enhance chemical removal, activate