Molgen Round 3

Describe the steps involved in performing a Northern analysis.

(1) RNA is extracted from tissue, cells etc. (2) Gel electrophoresis separates RNA molecules based on size (3) RNA is "blotted" (transferred) from the gel onto a membrane. (4) RNA is fixed to the membrane and hybridized with a probe (probe is labeled radioactively or with enzymes for chemiluminesence) (5) Visualization of RNA using X-ray film or phosphorimager screen.

Plasmid components

-Antibiotic resistance gene -Polylinker (AKA multiple cloning site) found within lacZ gene which contains a large number of unique restrictions sites, allowing easy insertion of foreign DNA -lacZ gene causes colonies to turn blue when grown within a certain medium; when a gene is inserted in the polylinker, the lacZ gene is disrupted and colonies grow as white rather than blue

Which of the following statements are NOT true? a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.

-Antibodies are NOT used for Northern blot analysis. -VNTRs are NOT highly conserved in human populations.

List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.

-Cell-free cloning -Screening for genetic disorders -Forensics -Paleobiology

List two especially useful characteristics of cloning vectors.

-High copy number -Antibiotic resistance genes

What advantages does pUC18 have in terms of recombinant DNA technology? List 3 such advantages.

-polylinker in lacZ, making it a good marker -small in size -high copy number

Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.

-small size to allow large inserts -high copy number -large numbers of unique restriction sites (polylinkers) -variety of selection schemes (pigmented colonies, antibiotic resistance)

A number of generalizations can be made about the organization of protein-coding genes in bacterial chromosomes. First, the gene density is very high, averaging about

1 gene per 1 kbp

A typical prokaryotic genome has ______ base pairs, containing _________ genes

1 million base pairs of DNA, containing 1000 genes

Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced?

1. Denaturation: Temperature is raised to ~94C. Strands of DNA separate. 2. Annealing: The temperature is is lowered to 50-65C. Primer strands anneal to the template strand. 3. Extension/Elongation: The temperature is raised to ~72C. Taq polymerase synthesizes a complementary DNA strand from dNTPs.

Most of the bacterial genomes described in the text have fewer than

10,000 genes

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.

300, 700, 1000, 1200

What appears to be the range of number of protein-coding genes per genome in eukaryotes?

5,000-45,000

The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?

50% credit: There was likely a duplication of this gene in pigs. 25% credit: After duplication, the gene has diverged. 25% credit: Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product). 25% credit: Alternatively, humans may have lost one copy of this gene. However, this possibility should be ruled out by the fact that pigs seem to be unique in possessing two genomic copies.

Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cuj cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000. Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected?

500,1500,2000 (I think this is incorrect)

In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?

A map unit is the amount of measured recombination between two linked points in a genome. Because one map unit in humans is many more base pairs than in yeast, the amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.

What is bioinformatics?

A method that uses very large national and international databases to access and work with sequence information

PCR

A technique for amplifying DNA sequences in vitro

Vectors

Agents that transfer DNA fragments from one organism to another

Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common?

All are derived from a single ancestor

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common?

All produce DNA chains as a product

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that

Bacteria cannot remove eukaryotic introns

For a physical map of a chromosome, distances are measured in units of

Base pairs

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? -DNA polymerase -Restriction enzymes specific for the target genes -DNA ligase

Both DNA polymerase and DNA ligase

Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

CGATATATATATATATACGAT

Match with the best choice: in situ hybridization

Chromosome spread

What are dideoxynucleotide triphosphates? For what are they used? How do they work?

Comparative genomics is a relatively new field involved in identifying similarities and differences in organization and gene content among the genomes of different organisms. Such studies are important for studying the genetic relatedness of species and for identifying gene families.

The Human Genome Project, which got under way in 1990, is an international effort to do what?

Construct a physical map of the 3.3 billion base pairs in the human genome

A bacterial polycistronic transcription unit is one that...

Contains information for more than one protein product

Restriction endonucleases... -are used to randomly digest DNA molecules. -are human enzymes. -are all genetically engineered. -cut DNA at specific sequences.

Cut DNA at specific sequences

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions?

DNA sequencing

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? -Information about bacterial orthologs of the gene -An EST database of the human genome -Microarray data of tissues in which the gene is expressed -Data about the inheritance of SNP markers in families with the disease -Whole-genome-shotgun clones of the human genome

Data about the inheritance of SNP markers in families with the disease

What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?

Degradation of bacteriophage DNA

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides?

Different fluorochromes attached to the four different ddNTPs

The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR?

Each cycle includes a "hot" denaturation phase (95C), which separates the hydrogen bonds that hold the strands of the template DNA together.

The most multipotent stem cells are

Embryonic stem cells

Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes

Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes. -or- Genes are more densely spaced in prokaryotes versus eukaryotes -or- prokaryotic genomes typically encode fewer genes than eukaryotic genomes

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? -Prokaryotic: presence of plasmids -Prokaryotic: repetitive DNA -Eukaryotic: repetitive DNA -Eukaryotic: ESTs -Eukaryotic: circular DNA

Eukaryotic: repetitive DNA

A BLAST search is done in order to accomplish what?

Find similar gene or protein sequences

This is the study of "genes in their entirety."

Genomics

Closely related genes based on sequence and function

Homolog

This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.

Human genome project

Explain why the greatest diversity of human SNPs is found among African people

Humans are thought to have first evolved in Africa. This means that any distinct population of humans (however defined) arose from a subset of the African population that became geographically isolated. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendants is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally

Hybridizes filter-bound DNA with a DNA probe

Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and Northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots

In a Southern blot the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA. Learn this more better

All of the following are characteristics of the genomics revolution EXCEPT -Large scale acquisition of DNA sequences -Ability to conduct discovery-based research -Enabled reverse genetics approach to genetics research -Facilitated collaborative research networks -Inability to understand single genes

Inability to understand single genes

The first commercial production of what human enzyme led to the explosion of the biotechnology industry?

Insulin

What two factors contribute significantly to the wide ranges of genome size among eukaryotes?

Introns, number of genes

Which of the below are not steps in the production of genome sequence maps: -Read the sequence of individual piece of the genome. -Isolate whole chromosomes. -When sequences are obtained, assemble and organize the sequences in order. -Identify molecular markers on specific chromosomes. -All of these are steps you would use.

Isolate whole chromosomes

The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number?

It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing

What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?

It provides a selectable marker

Mycoplasma genitalium has a 580 kb genome. What is significant about the size of its genome?

It's extremely small

Typically, bacterial DNA contains_____ (more/less) repetitive DNA than eukaryotic DNA.

Less

When propagating a clone in the lambda phage, would you have more immediate success if the phage enters the lysogenic or the lytic cycle?

Lytic cycle

A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.

Multigene

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites?

Multiple cloning site OR polylinker

Plasmid

Naturally occurring extrachromosomal double stranded DNA molecules that replicate autonomously within a bacterial cells

What are Northern analyses used for?

Northern blots are used to detect/compare/study RNA in a sample.

A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons

OH, 2',3'

In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called

Operons

List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.

Origin of replication for propagation in the host; Selectable marker like Amp resistance; Polylinker or unique restriction enzyme sites to facilitate cloning

Homologous genes of the same locus inherited from a common ancestor

Ortholog

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called

Orthologs

Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words?

Palindromic

Genes related by gene duplication in the genome

Paralog

A map of the order, overlap, and orientation of physically isolated pieces of the genome.

Physical map

Match with best choice: cloning vector

Plasmid

A PCR technique that fills in small gaps by using the end of a cloned sequence as a primer to amplify into adjacent uncloned fragments.

Primer walking

The set of all proteins encoded by the genome is called the

Proteome

describe how levels of gene expression are determined in Northern blot analysis

RNA levels can be determined and quantified by the darkness of the bands in the image.

Name 2 methods that are used to produce mutations in a forward genetics approach.

Radiation and chemical mutations

Restriction Endonucleases

Recognize a specific nucleotide sequence and both strands at that sequence

What is recombinant DNA technology? What are the safety issues related to recombinant DNA technology?

Recombinant DNA technology refers to the creation of new combinations of DNA molecules that are not normally found in nature. Safety issues generally center around the creation and release (accidental or intentional) of genetically engineered organisms that are a threat to human health or animals and plants in the environment. Many organisms that are "genetically engineered" carry genes for antibiotic resistance.

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by

Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP).

Reporter gene

What is the specific application of reverse transcriptase in the preparation of cDNA?

Reverse transcription (RNA -> cDNA)

Compared with eukaryotic chromosomes, bacterial chromosomes are

Small, with high gene density

PCR Ingredients

Source DNA DNTPs Primer Taq polymerase

What is the difference between Southern blots, Northern blots, and Western Blots?

Southern for DNA, Northern for RNA, Western for Protein

Some restriction enzymes leave what are referred to as "sticky ends". What does this term mean? How can sticky ends be useful in making recombinant DNA?

Sticky ends are 5' or 3' overhangs from staggered cuts. They are useful in recombinant DNA because the overhang of a fragment to be cloned can anneal through complementarity to the overhang of a vector fragment if cut by the same enzyme.

Conservation of the same groups of genes in the chromosomes of two or more species

Synteny

What is Taq polymerase? In which kind of analysis is it used? Why is it so important?

Taq is a thermostable polymerase from Thermus aquaticus. It is used in PCR because it can survive the boiling temperatures needed for denaturation. When Taq is used, polymerase need not be added in every cycle, allowing automation of the PCR reaction.

What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme.

Taq polymerase

How does this system (PCR) work to amplify DNA?

The amount of DNA is doubled in each reaction because in each cycle the DNA is denatured and both strands are replicated.

Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?

The entire yeast genome has only about 240 introns, whereas some single genes in humans may contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.

What is a concise definition of proteomics?

The process of defining the complete set of proteins encoded by a genome

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that

The two proteins share a common ancestry

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?

Three

What is the enzymatic function of restriction enzymes?

To cleave nucleic acids at specific sites

Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?

Transcriptome has all RNA transcripts, coding and non coding. Proteome only has the proteins that result from those transcripts. Some genes encode non-coding RNAs that are not translated into proteins.

What term is used to refer to the process in which DNA can be introduced into host bacterial cells?

Transformation

Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules.

Two primers and one template strand The primer sequences must be complementary to either end of the sequence to be amplified.

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms.

Visual examination, eliminate

Plasmids are important in biotechnology because they are

a vehicle for the insertion of foreign genes into bacteria

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a

contig

Name this molecule. How is it used in genetic research? [image of molecule]

dideoxyribose. Inhibits chain elongation so that the genome may be sequenced.

Describe, in order, the steps usually followed in producing recombinant DNA molecules in a plasmid vector.

isolation of DNA (foreign and plasmid) digestion of DNAs with an appropriate restriction endonuclease ligation of fragments transformation of host cells

Match with best choice: beta-galactosidase

lacZ

A map of the distribution of cloned genomic DNA from genomic clone libraries.

physical map

Describe the relationship between introns (size and number) and organismic complexity in eukaryotes.

size and number increase in more complex eukaryotes