mutations

silent mutations

have no effect on the amino acid produced by a codon because of redundancy in the genetic code - functional but the same

Examine your genetic code chart. Name one amino acid that has more than one codon. Name an amino acid that has only one codon.

AUG is an amino acid that only codes for MET where as GCA, GCT, GCC, and GCG all code for ALA.

Which type of mutation is responsible for new variations (alleles) of a trait?

All mutations beside from silent mutations will result in a new variation of a trait.

You have a DNA sequence that codes for a protein and is 105 nucleotides long. A frameshift mutation occurs at the 85th base - how many amino acids will be correct in this protein? SHOW YOUR WORK.

Because there are 35 codons within the 105 nucleotides, the codon containing the frameshift mutation at the 85th base there will be 28 correct amino acids in this protein.

Describe how it would be possible for a single point mutation in DNA to result in early termination during translation.

By adding the stop codon-could happen by either addition or substitution

Which type of mutation stops the translation of the mRNA?

Frameshift mutation or missense mutations that results in a stop codon

Which type of mutation results in abnormal amino acid sequence?

Frameshift, missense, and nonsense

A geneticist found that a particular mutation had no effect on the protein coded by a gene. What do you think is the most likely type of mutation in this gene? Why?

Point mutation because it had no effect on the protein coded and therefore it codes for the same amino acid

List the names and functions of the major proteins involved in transcription.

RNA polymerase-brings RNA nucleotides to a DNA strand to create a complementary RNA strand (mRNA)-uses enzyme properties to create phosphodiester bonds to hold nucleotides together

a gene is mutated but the codons code for the same amino acids to build a polypeptide chain-what is the result Original sequence: AUG UUU UAU UGU Mutated sequence: AUG UUU UAC UGC

Since both UAU and UAC code for the same amino acid and UGU and UGC code for the same amino acid it will result in a silent mutation

Look at the following sequence: THE FAT CAT ATE THE RAT. Delete the first H and regroup the letters in groups of three- write out the new groups of three. Does the sentence still make sense? What type of mutation is this an example of?

TEF ATC ATA TET HER AT - the sentence no longer make sense due to the deletion resulting in a frameshift mutation.

What is a possible consequence of a single nucleotide addition to the DNA used to generate a protein?

a frameshift mutation would occur and affect all codons after it as a new protein is created and mutation occurs

insertions/deletions

additions or losses of nucleotide pairs in a gene -disastrous results more often than substitutions - may alter the reading frame producing a frameshift mutation

nonsense mutations

change in amino acid codon into a stop codon nearly always leading to a nonfunctional protein

mutations

changes in the genetic material of a cell or virus

point mutations

chemical changes in just one base pair of a gene

What is central dogma?

concept that cells are governed by a cellular chain of command DNA->RNA->protein

axons

expressed regions that are typically translated into amino acid sequences

Transcribe and translate the portion of the gene for both mRNA sequence and the polypeptide chain: ACGAGACCTCTTATACTTAAACATAAA

mRNA-UGCUCUGGAGAAUAUGAAUUUGUAUUU polypeptide chain-ACGAGACCUCUUAUACUUAAACAUAAA

Transcribe and translate the portion of the gene for both mRNA sequence and the polypeptide chain: ACGAGACCTCTTACACTTAAACATAAA

mRNA-UGCUCUGGAGAAUGUGAAUUUGUAUUU polypeptide chain-ACGAGACCUCUUACACUUAAACAUAAA

List and describe the roles of the three different types of RNA involved in transcription and translation.

mRNA-produced during transcription to go to the ribosome for protein synthesis tRNA-brings correct amino acid to ribosome during translation rRNA-organelles that are the site of protein synthesis

introns

noncoding regions of mRNA

translation

occurs in the ribosome-is the synthesis of a polypeptide using information in the mRNA

frameshift mutation

occurs when reading frame is altered and continues to affect the coding of the gene until the stop codon

nucleotide pair substitution

replaces one nucleotide and its partner with another pair of nucleotides

missense mutations

still code for an amino acid, but not the correct amino acid-functional but different

gene expression

the process by which DNA directs protein synthesis including two stages: transcription and translation

transcription

the synthesis of RNA using information in the DNA-produces mRNA

RNA polymerase

unzips DNA strands apart and joins together there RNA nucleotides during transcription