PLTW - PBS Semester 1 FINALS REVIEW!!!

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

List the following in order of complexity: cells (1), organs (2), organelles (3), organism (4), tissues (5), organ systems (6)

3 1 5 2 6 4

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of nucleotides in the sample will be guanine?

38

A person is found dead by a neighbor. What career is involved in notifying the police and calling an ambulance?

911 Operator

A component of nucleic acids, energy-carrying molecules such as ATP, and certain coenzymes. Chemically, it is a purine base.

Adenine

A compound composed of adenosine and three phosphate groups that supplies energy for many biochemical cellular processes by undergoing enzymatic hydrolysis.

Adenosine Tri-Phosphate (ATP)

An organic monomer which serves as a building block of proteins.

Amino Acid

The application of the principles of the natural sciences, especially biology and physiology, to clinical medicine.

Biomedical Science

Given the DNA strand GAATTCCTCGAG, what would be the complementary strand to make the double-stranded DNA?

CTTAAGGAGCTC

The amount of heat energy required to raise the temperature of 1 g of water by 1°C; also the amount of heat energy that 1 g of water releases when it cools by 1°C. The Calorie (with a capital C), usually used to indicate the energy content of food, is a kilocalorie.

Calorie

A sugar in the form of a monosaccharide, disaccharide or polysaccharide.

Carbohydrate

Which body system is most closely associated with transport and delivery?

Cardiovascular

An attractive force that holds together the atoms, ions, or groups of atoms in a molecule or compound.

Chemical Bond

A substance (as a dye) used to show visually usually by its capacity for color change, the condition of a solution with respect to the presence of free acid or alkali or some other substance.

Chemical Indicator

Chemical transformation or change; the interaction of chemical entities.

Chemical Reaction

Any of the usually linear bodies in the cell nucleus that contain the genetic material.

Chromosome

A substance consisting of two or more elements in a fixed ratio.

Compound

The group in an experiment where the independent variable being tested is not applied so that it may serve as a standard for comparison against the experimental group where the independent variable is applied.

Control Group

A type of strong chemical bond in which two atoms share one or more pairs of valence electrons.

Covalent Bond

A component of nucleic acids that carries hereditary information in DNA and RNA in cells. Chemically, it is a pyrimidine base.

Cytosine

A chemical reaction in which two molecules are bonded together with the removal of a water molecule.

Dehydration Synthesis

A double-stranded, helical nucleic acid molecule capable of replicating and determining the inherited structure of a cell's proteins.

Deoxyribonucleic Acid (DNA)

The measurable effect, outcome, or response in which the research is interested.

Dependent variable

A double sugar molecule made of two monosaccharides bonded together through dehydration synthesis.

Disaccharide

What person is responsible for providing short-term care for people being transported to the hospital?

EMT

The smallest particle of a substance that retains all the properties of the substance and is composed of one or more atoms.

Element

A research study conducted to determine the effect that one variable has upon another variable.

Experiment

The application of scientific knowledge to questions of civil and criminal law.

Forensic Science

According to Chargaff's rule, what are the base pair matches?

G and C; A and T

Scientists are able to separate DNA sequence through what?

Gel Electrophoresis

The separation of nucleic acids or proteins, on the basis of their size and electrical charge, by measuring their rate of movement through an electrical field in a gel.

Gel Electrophoresis

A discrete unit of hereditary information consisting of a specific nucleotide sequence in DNA (or RNA, in some viruses).

Gene

A protein hormone secreted by pancreatic endocrine cells that raises blood glucose levels; an antagonistic hormone to insulin.

Glucagon

A monomer of carbohydrate, simple sugar.

Glucose

A test of the body's ability to metabolize glucose that involves the administration of a measured dose of glucose to the fasting stomach and the determination of blood glucose levels in the blood or urine at intervals thereafter and that is used especially to detect diabetes.

Glucose Tolerance Test

A component of nucleic acids that carries hereditary information in DNA and RNA in cells. Chemically, it is a purine base.

Guanine

What law allows healthcare professionals to reveal private patient information under specific circumstances?

HIPAA

Something spiral in form.

Helix

The maintenance of relatively stable internal physiological conditions (as body temperature or the pH of blood) in higher animals under fluctuating environmental conditions.

Homeostasis

A product of living cells that circulates in blood and produces a specific, often stimulatory, effect on the activity of cells that are often far from the source of the hormone.

Hormone

A chemical process that splits a molecule by adding water.

Hydrosis

Clear prediction of the anticipated results of an experiment.

Hypothesis

The variable that is varied or manipulated by the researcher.

Independent Variable

A protein hormone secreted by the pancreas that is essential for the metabolism of carbohydrates and the regulation of glucose levels in the blood.

Insulin

A chemical bond resulting from the attraction between oppositely charged ions.

Ionic Bond

Why do scientists load DNA of known sizes into the agarose gel?

It makes it easier to determine the size of unknowns using comparison techniques

One of a family of compounds including fats, phospholipids, and steroids that is insoluble in water.

Lipid

A type of giant molecule formed by joining smaller molecules which includes proteins, polysaccharides, lipids, and nucleic acids.

Macromolecule

A simplified version of something complex used, for example, to analyze and solve problems or make predictions.

Model

Two or more atoms held together by covalent bonds.

Molecule

The subunit that serves as the building block of a polymer.

Monomer

A single sugar molecule such as glucose or fructose, the simplest type of sugar.

Monosaccharide

Control group where conditions produce a negative outcome. This helps identify outside influences which may be present that were not accounted for when the procedure was created.

Negative Control

A primary mechanism of homeostasis, whereby a change in a physiological variable that is being monitored triggers a response that counteracts the initial fluctuation.

Negative Feedback

The bodily system that in vertebrates receives and interprets stimuli and transmits impulses to the effector organs is called...

Nervous (system)

A nurse suspects that her neighbor is leaving her 7-year-old daughter home alone in the evening while working and contacts Child Protective Services. Is this a violation of HIPAA?

No

A patient arrives in the ER and is suspected of having tuberculosis, the physician contacts the health department with the information. Is this a violation of HIPAA?

No

A receptionist faxes the result of a patient's blood work to their private office as per patient request. Is this a violation of HIPAA?

No

The hospital contacts the police department about a patient with a gunshot wound. Is this a violation of HIPAA?

No

What ridge pattern is this fingerprint?

None of the above(*)

What is the basic structural unit of DNA called?

Nucleotide

A building block of DNA, consisting of a five-carbon sugar covalently bonded to a nitrogenous base and a phosphate group.

Nucleotide(s)

A substance that is needed by the body to maintain life and health.

Nutrient

Specialized clothing or equipment, worn by an employee for protection against infectious materials (as defined OSHA).

Personal Protective Equipment

A polymer of thousands of simple sugars formed by dehydration synthesis.

Polyaccharide

A large molecule consisting of many repeating chemical units or molecules linked together.

Polymer

Group expected to have a positive result, allowing the researcher to show that the experimental set up was capable of producing results.

Positive Control

Feedback that tends to magnify a process or increase its output.

Positive Feedback

A three dimensional polymer made of monomers of amino acids.

Protein

A degradative enzyme that recognizes specific nucleotide sequences and cuts up DNA.

Restriction Enzyme

Differences in DNA sequence on homologous chromosomes that can result in different patterns of restriction fragment lengths (DNA segments resulting from treatment with restriction enzymes).

Restriction Fragment Length Polymorphisms (RFLPs)

What body system is most closely associated with the support and protection of the body organs?

Skeletal

The sequence of one strand of DNA is AATTGCTAT. What would its complementary strand read?

TTAACGATA

A component of nucleic acid that carries hereditary information in DNA in cells. Chemically, it is a pyrimidine base.

Thymine

In experimental design, why is data collection important?

To support your conclusion

Diabetes of a form that usually develops during childhood or adolescence and is characterized by a severe deficiency of insulin, leading to high blood glucose levels.

Type 1 Diabetes

Diabetes of a form that develops especially in adults and most often obese individuals and that is characterized by high blood glucose resulting from impaired insulin utilization coupled with the body's inability to compensate with increased insulin production.

Type 2 Diabetes

What is the shape of an incision made in the chest during an autopsy?

Y (shape)

A doctor calls a patient at home to give her the results of a cancer screening. The patient's brother is staying with the family for a week and answers the phone. The doctor gives him the test results to pass on to the patient. Is this a violation of HIPAA?

Yes

A doctor texts his wife about seeing one of their neighbors as a patient. Is this a violation of HIPAA?

Yes

A nurse tweets about her celebrity patient. Is this a violation of HIPAA?

Yes

After a tornado disaster, the medical facility notifies the media on the condition of the mayor's daughter, who was a victim. Is this a violation of HIPAA?

Yes

The hospital contacts the media about a patient with a gunshot wound. Is this a violation of HIPAA?

Yes

A person was texting while driving and ran into the side of an overpass on the highway. What is the manner of death?

accidental

What two nitrogenous bases are purines?

adenine; guanine

An examination of the body after death that includes a dissection of vital organs to determine cause of death is a(n)

autopsy

What evidence found at the crime scene would contain DNA?

blood

A person was texting while driving and ran into the side of an overpass on the highway. What is the cause of death?

blunt force trauma (to the body)

The transport system of the body responsible for carrying oxygen and nutrients to the body cells and carrying away carbon dioxide and other wastes is called...

cardiovascular (system)

How can the time of death be determined?

core body temperature

Name the three parts of a nucleotide.

deoxyribose molecule, phosphate group, nitrogenous base

The sides of the DNA ladder are composed of:

deoxyribose sugar, phosphate

What step would directly follow making a hypothesis in experimental design?

design and carry out an experiment

The group of organs that break down foods into chemical components that the body can absorb and use for energy, and for building and repairing cells and tissues is called...

digestive (system)

In the DNA isolation lab, what was the purpose of the detergent?

dissolve the cell and nuclear membrane

If the following DNA sequence were cut using the restriction enzyme KB502, how many pieces of DNA would be made? (KB502 restricts (cuts) at the end of the sequence TCCT). ATAACGTCCTAAACTATCTCCTATCCGAATCCTACCGATTCA

four

The diameter of a blood drop can be used to estimate the...

height from which the drop fell

What type of chemical bond is found between paired bases of the DNA double helix?

hydrogen

The one factor in an experiment that the scientist changes in each trial is the...

independent variable

Who would be responsible for performing an autopsy on a cadaver (dead body)?

medical examiner

Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel __________ than the smaller fragments through the gel.

more slowly

Which body system is most closely associated with information assessment?

nervous

DNA is a very large molecule (a polymer) made up of a long chain of repeating sub-units called what?

nucleotide

When running a gel electrophoresis, DNA will migrate towards the ______ end because DNA has a ______ charge.

positive negative

A system of organs, functioning in the process of gas exchange between the body and the environment is called...

respiratory (system)

DNA is cut at specific nucleotide sequences by what?

restriction enzymes

The shape of a DNA molecule is:

spiral staircase

What characteristic separates DNA fragments during gel electrophoresis?

the length of the DNA fragment

What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?

the negative change of DNA

If every human's DNA is made up of the same four nucleotide bases, why do we have differences?

the order of the bases

An experiment was conducted to test the effectiveness of a blood pressure drug. Before the trial, all of the patients' blood sugar was recorded. One hundred patients were given the drug for six months and one hundred different patients were given a placebo. After six months, all the patients' blood pressures were measured. What is the DEPENDENT VARIABLE in this experiment?

the patients' blood sugar

Which career involves the study of symptoms, mechanisms, treatments, and detection of poisonings, drugs, and other toxins, especially in people?

toxicologist

What body system's main role is waste removal?

urinary

A body system that is responsible for disposing of waste in the body and fluid levels is called...

urinary (system)


Set pelajaran terkait

CompTIA Linux+ Exam Post-Assessment

View Set

(Basic Res) Wilkin's - Chapter 8 - Interpretation of ABGs Extra Workbook content [NOT STUDY GUIDE]

View Set

Chapter 10 - Economic Development and Change: pages 314-329 (Knox)

View Set