ASCP Technologist in Molecular Biology board exam prep

Ace your homework & exams now with Quizwiz!

Optimization of PCR methods

1. Check the Tm 2. Mg2+ concentration - too little can result in no PCR product, and too much may produce noise 3. PCR cycles 4. Add, extend, or increase the temp of the initial template denaturation step 5. Concentrations of other buffer components 6. GC Content

Pre-transplant evaluation

1. Determine HLA type: Serology 2. Determine serum Ab status: CDC, sequencing 3. Crossmatch: MLC, CDC, ELISA, flow cytometery

NASBA steps

1. Hybridize oligo-T7P primer to target seq 2. RT/RNase H 3. Hybridize with target-specific oligo primer (P2) 4. RNA transcript of T7 RNA pol

Thermal Cycling steps in conventional PCR

1. Initialization (94-96 C) 2. Denaturation (94-98 C) 3. Annealing (50-65 C) 4. Extension (70-80 C) 5. Repeat 2-4 ~30x 6. Final Elongation (70-74 C) 6. Final hold

What are the steps in DNA replication?

1. Initiate 2. Elongate 3. Terminate

Line Probe Assay steps

1. Isolate nucleic acid (RNA) 2. Amplify 3. Hybridization 4. Strigent wash 5. Incubate with conjugate 6. Incubate with substrate 7. Detect

Solid phase isolation

1. Lyse 2. Acidify (low pH) 3. Transfer to column (adsorption) 4. Wash 5. Elute

Inorganic isolation

1. Lyse 2. Add low pH/high salt soln (NaOAc ppt's proteins) > vortex/spin 3. Transfer soln to new tube 4. EtOH ppt 5. Resuspend

Organic isolation method

1. Lyse 2. Add phenol/ chloroform > vortex/spin 3. Transfer aqueous layer (top) to new tube 4. Add chloroform:IAA (removes phenol) > vortex/spin 5. Transfer aqueous layer to new tube 6. Add NaOAc and EtOH > vortex/spin 7. Decant 8. Resuspend

Heterduplex Analysis steps

1. PCR 2. Mix sample and CTR DNA together 3. Denature PCR using heat 4. Cool slowly to rt 5. Add denaturing loading buffer 6. Run on MDE gel

PCR process

1. Prep MMx: buffer, taq, primers, dNTPs 2. Add target 3. Place in thermocycler 4. Denature dsDNA 5. Anneal: allows primers to hyb 6. Extend: pol adds dNTPs to 3' 7. Repeat steps 4-6

Bisulfite DNA sequencing/Methylation specific

1. RE digest 2. Electrophorese and purify fragment of interest 3. Denature and incubate w/ sodium bisulfate (turns C>U, methylated C is unchanged) 4. clean, ppt, and resuspend 5. PCR --> sequence 6. Compare treated vs untreated, note where CG are not changed to TA

Southern Blotting Procedure

1. RE digest DNA 2. Gel electrophoresis 3. Soak in HCl (depurinates, weakens H-bonds) 4. Soak in NaOH (denatures) 5. DNA transferred to a membrane 6. Immobilize (UV or bake) 7. Pre hyb to block 8. Hyb with probe

Southern Blot steps

1. RE digest to fragment DNA 2. Run on gel to separate 3. Soak gel in alkali/NaOH to denature dsDNA 4. Transfer ssDNA fragments to positively charged membrane (blot) 5. Fix to filter by heat (80C) or UV crosslink 6. Incubate (hybridize) blot w/ radioactively labeled ssDNA comp probe 7. Autoradiograph

Pulse Field Gel Electrophoresis steps

1. culture 2. embed pellet in agarose plug 3. treat w/ lysozyme (cell lysis) 4. proteinase K 5. gel

Microarray steps

1. isolate mRNA from cells 2. RT to get labeled cDNA copies of mRNA 3. cDNA washed over slide. cDNA sticks to comp sequence 4. use laser to read fluorescent tags

Describe the steps of reverse transctiption

1. tRNA acts as a primer and hybridizes to virus genome 2. Complementary DNA then binds to the U5 (non-coding region) and R region 3. RNAse H degrades the 5' end of the RNA which removes the U5 and R region. 4. The primer then "jumps" to the 3' end of the viral genome and the newly synthesized DNA strands hybrid

Calculate the RNA concentration from the following: 260=0.307 (DF 1:100)

1228 ug/mL = 0.307 abs * 40 ug/mL * 100 DF

Von Willebrand dz (vWD)

12p13, Von Willebrand's factor (vWF) vWF promotes platelet clumping Mutations effect bloods ability to clot

Breast cancer, Brca2

13q 6174delT TS; interacts w/ RAD51

Nucleosome

147 bp of DNA wrapped around histone octamer plus a H1 linker

Tay Sachs disease

15q, HEXA gene; AR 1278insTATC, exon 11 Insufficient hexoaminidase A activity; GM2-gangliosides cannot be broken down and accumulate in the brain; causes cerbral degeneration and blindness

Breast cancer, Brca1

17q 185delAG/187delAG 5382insC/5385insC TS; interacts w/ RAD51 (DNA damage repair)

Breast cancer, Her2/Neu/ErbB2

17q, ErbB2; proto-oncogene, Tyr kinase Mutations cause overexpression -> proliferation Dx: IHC, FISH, qPCR Treatment: Transtuzumab (Herceptin), gefitinib (Iressa)

Methylenetetrahydrofolate reductase

1p36.3, MTHFR gene; C677T (A222V), A1298C (E429A) Methylenetetrahydrofolate reductase catalyzes conversion of MTHF--> 5-MTHF which is converted to Met Thromboembolism, homocysteine builds up, Met is depleted

Gaucher's disease

1q21 GBA; AR N370S or L444P Lipid, glucosylceramide, accumulates in WBCs, liver, spleen, lungs, bone marrow and, less commonly, brain, caused by a deficiency of the enzyme glucocerebrosidase, which helps the body process the fatty substance glucocerebroside. Dx: PCR ->seq coding region

Factor V Leiden

1q25, F5 gene 1691G>A, R506Q Causes deep vein thrombosis Treated with anticoagulants (warfarin/Coumadin)

Strand Displacement Amplification (SDA)

1st stage: target generated w/ RE site 2nd stage: probe amp; HincII nicks at RE site, DNApol extends/regenerates RE site and displaces strand high throughput high sensitivity

Hybridization

2 ssDNA molecules of comp base sequence can form a ds hybrid (duplex)

Human genome

2.9 billion bp ~30k - 40k genes 46 chr, diploid

How do you inactivate RNases?

200C for 2 hrs 30 min in 1M NaOH or quanidinum isothiocyanate

At what wavelength does DNA and RNA absorb?

260 nm

At what wavelength does protein absorb?

280 nm

What is the wavelength for background in spectrophotometery?

320 nm

[DNA] = 767.5 ug/mL. You have 0.5 mL What is the total yield.

383.75 ug = 767.5 ug/mL * 0.5 mL

Quaternary protein structure

3D structure of a multi sub unit protein

Tertiary protein structure

3D structure of a single protein

Bart's hydrops fetalis

4 α genes deleted, --/-- γ4 present, fatal in utero

[DNA] = 860 ug/mL. You have 0.5 mL. What is the total yield.

430 ug = 860 ug/mL * 0.5mL

How do you determine quality of DNA/RNA using a spectrophotometer?

A260/A280

Start codon

AUG (Met)

What is the path of a tRNA in a ribosome?

Acceptor > Peptidyl > Exit

DNA Polymerase β (Euk)

Base excision repair (BER)

Single-strand conformation polymorphism (SSCP)

Based on the preference of DNA to exist as DS rather than SS; Forms 3D conformers - a SNP can cause the conformer to fold differently (kinks, loops, bubbles, and tails)

Telomeric probes

Best for cryptic translocations or small abnormalities

Break apart probes

Bind to the chr flanking the t breakpoint region WT will emit a combination signal (next to each other) and t will emit separated signals.

single-strand DNA binding proteins (SSBPs)

Binds ssDNA and prevents it from re-annealing during TXN, replication, repair, and recombination

Hazard label

Blue: Health hazard Red: Fire hazard Yellow: Reactivity White: specific hazard 0 no hazard - 4 severe hazard

Helicase

Breaks H-bonds of double helix at the replication fork

DNA Polymerase IV (Prok)

Bypass replication SOS response

DNA Polymerase V (Prok)

Bypass replication SOS response Translesion synthesis DNA repair

PCR DNA Array

DNA array is a collection of spots attached to a solid support (such as a microscope slide) where each spot contains one or more ssDNA oligo fragments. Arrays make it possible to put down large quantities of very small spots on a single slide. Each spot has a DNA fragment that is complementary to a single DNA sequence.

RNA polymerase

DNA dependent RNApol Transcribes DNA template to RNA (3'-->5'; anti-parallel)

Southern Blotting

DNA is isolated and cut with REs. This allows investigators to determine the molecular weight of a restriction fragment and to measure relative amount in different samples.

After an extraction/isolation, what should you elute with?

DNA - TE or water RNA - DEPC water

FRET probes

Fluorescence Resonance energy transfer - Distance dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule without emission of a photon.

Calculate the Tm of the following primers: Forward: GGAGCTTTGTTTCAACCAAG Reverse: ATTAAATGCGGAATTGCCCA

Forward: Tm=(4C x 9GC)+(2C x 11AT) = 58C Reverse Tm=(4C x 8GC)+(2C x 12AT) = 56C

Dye primer

Four different fluorescent dyes are added to the primers. Cycling is done to attach the primer and that is what the instrument sees. Each nucleotide is amplified a different color.

DNA Polymerase III (Prok)

Primary enzyme involved in replication Exonuclease activity

DNA Polymerase α (Euk)

Primase DNA dependent DNA & RNA pol

What are some causes of too many bands on a gel after PCR?

Primers not specific Annealing temp too low Too many cycles Too much Mg++

A small portion of chr 2 has been found on the end of chr 15 and a small portion of chr 15 was found on the end of chr 2. This mutation is called a:

Reciprocal translocation

How can Tween 20 affect PCR?

Stabilizes Taq Suppress formation of 2* structures Increase yield Increase non-specific amplification

Why is the lectin, phytohemagglutinin (PHA), added to a cell culture when preparing cells for karyotyping?

Stimulates mitosis in the cells

For long term storage, what should you store DNA in?

TE or DNase free H2O

Microarrays

Used for unknown gene and mutation cDNA libraries can be used for gene expression, tumors, genetic mapping, mutations and polymorphism large scale, high throughput analysis

Sequence Based Nucleic Acid Amplification (NASBA)

Used to amplify RNA sequences; Primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature; works at 41 C

Reverse Transcriptase PCR

Used to detect RNA expression levels. RT-PCR is used to qualitatively detect gene expression through creation cDNA transcripts from RNA.

In-situ hybridization

Used to detect protein, RNA, and DNA within the cell. Probes bind to the DNA and can be visualized under the microscope. Depending on the mutation, different signals can be seen - deletions and duplications. Sensitivity can be increased by using dual fusion probes, break apart probes, centromeric probes, and telomeric probes.

Restriction fragment length polymorphism (RFLP)

Used to detect sequence alteration in retriction enzyme fragments; The region surrounding the mutation is amplified and the mutation is detected by cutting the amplicon with the correct restriction enzyme

Interphase FISH

Used to study prenatal samples, tumors, and hematological malignancies Cells do not have to be cultured Fix cells Hyb to probe (dual fusion, break-apart, CEN, telomere)

Metaphase FISH

Used to study smaller abnormalities Culture cells for 72 hrs Add colcemid to arrest cells in metaphase Fix Hyb to probe (chr paint)

Fluorescent in situ hybridization (FISH)

Uses fluorescent probes to detect DNA sequences on chr

IonTorrent sequencing (NextGen)

Uses standard sequencing chemistry, but a semiconductor based detection system. Based on the detection of hydrogen ions that are released during the polymerization of DNA as opposed to the optical methods. A microwell containing a template DNA is flooded with a single type of nucleotide (A,T,G,C) and if the nucleotide is complementary to the template it is incorporated into the growing strand of DNA. This causes the release of hydrogen ions that triggers the sensor.

Dual fusion probes

Uses two pairs of probes with different fluor dye Bind regions that span the breakpoint of both t partners If t is present, signal from both dyes should be present

lab developed tests (LDT)

a term used to refer to a certain class of in vitro diagnostics (IVDs). In the United States, the Food and Drug Administration has determined that while such tests qualify as medical devices, FDA will allow these products to enter the market without prior approval from the Agency.

Blocking Proteins (Hybridization)

minimize nonspecific binding of probe to membrane ie casein (milk), Denhardt's sol

Blocking DNA (Hybridization)

minimizes probe binding to nonspecific sequence ie salmon sperm DNA, Human LINE-1

Splicing

modification of the nascent pre-messenger RNA (pre-mRNA) transcript in which introns are removed and exons are joined.

DNA Polymerase γ (Euk)

mtDNA replication and repair Exonuclease activity

Haemophilia

X, XR Blood does not clot due to a deficiency in a coag factor Haemophilia A: most common, factor VIII deficiency

Muscular dystrophy (DMD/BMD)

Xp21, dystrophin gene; XR Causes muscle weakness and muscle loss DMD: non-functional protein made BMD: some function of protein is retained

Fragile X syndrome

Xq27 FMR1, CGG repeat 5' UTR causes methylation Mental retardation WT repeats 5-55, carrier 56-200, mutation 200-2000+ Dx: PCR, S. blot for full mutation

Should you lyse RBCs before freezing?

YES

What some causes of DNA damage?

mutagens carcinogens cell death age-related decreases in DNA repair genetic disease

What would the autoradiogram show if the stringency was to high?

no bands

Eupliod

normal complement of chromosomes

ORI sites

nt sequence where replication is initiated

Clinical sensitivity and specificity is based on _________.

outcome

What is the function of rRNA?

part of ribosome structure most abundant RNA coordinated coupling of tRNA to mRNA codons

An RNA preparation has the following readings: 260=0.208 280=0.096 Is this RNA suitable for use?

Yes, 2.17 is suitable for RNA analysis A260/A280 = 0.208/0.096

Do you have to know the gene sequence in order to do DNA sequencing?

Yes, in order to design primers You do NOT need to know the mutation

Polymorphism

a change in the DNA sequence that is present in at least 1-2% of the population (ex. Sickle cell anemia)

Solenoid

a coil of six nucleosomes wound into a tightly packed helix

Pleiotrophy

a single gene controls the expression of many phenotypic traits ie Sickle Cell Anemia

Huntington disease (HD)

4p16.3 HD/HTT; CAG repeat CAG repeat in HD/HTT causes multiple Q's at 5' of Huntingtin protein. Protein aggregates in plaques (especially in nervous tissue) slowing down brain function; symptoms appear at 30+ yo; impaired judgement, slurred speech, difficulty swallowing, intoxicated appearance WT repeats 9-37, HD 38-86 repeats Dx: PCR, S.blot to resolve full mut

5' cap

5'-5' pyrophosphate bridge to a methylated G added to 5' end of a mRNA Protects against degradation and as a recognition signal for TLN apparatus

Hereditary hemochromatosis

6p21.3 HFE; C282Y, G>A; AR a genetic disease that causes the body to absorb and store too much iron Treatment: phlebotomy

[DNA] = 1535 ug/mL. You have 0.5 mL. What is the total yield.

767.5 ug = 1535 ug/mL * 0.5mL

Cystic fibrosis (CF)

7q31.2 CFTR gene; F508del; AR Cl channel membrane protein Affects cells that produce mucus, sweat, saliva, and digestive juices; causes thick secretions Dx: RFLP, PCR-RFLP, HD, Invader, SSP-PCR

Calculate the DNA concentration from the following: 260=0.172 (D.F. 1:100)

860 ug/mL = .172 abs * 50 ug/mL * 100 DF

What is considered poor quality RNA/DNA from spectrophotometry?

<1.7 Protein contamination

Acrocentric

A chr where the with a centromere not in the middle, but closer to one end or the other

Hemoglobinopathies

A group of inherited disorders in which there is abnormal production or structure of the Hb molecule. Such disorders include hemoglobin C disease, hemoglobin S-C disease, sickle cell anemia, and various types of thalassemia.

Histocompatibility

A state or condition in which the absence of immunological interference permits the grafting of tissue or the transfusion of blood without rejection.

Bisulfate DNA sequencing

A type of chain termination sequencing designed to detect methylated nucleotides. Methylation of cytosine residues in DNA is an important part of gene regulation and expression - this is important for detecting different types of cancer. During the incubation C is converted to U and 5-methylated C is unchanged. A PCR reaction is then performed using normal chain termination methods.

research use only (RUO)

According to FDA, manufacturer-initiated studies of RUO products are typically intended to evaluate design, limited-scale performance, and issues such as usability of the test. The agency acknowledges that RUO products may be used for non-clinical laboratory research for goals other than developing a commercial IVD product. According to FDA, these uses may include developing novel and fundamental medical knowledge related to human disease and conditions.

Chromosome mutations

Affects the structures of the entire chr, requires the movement of large chr regions

What does the incubation step in hybridization do?

Allows formation of ds molecules

Secondary protein structure

Amino acids are linked by H bonds to form sub structures; eg a helixes, B sheets

The Joint Commission

An independent, not-for-profit organization, The Joint Commission accredits and certifies more than 20,000 health care organizations and programs in the United States. Joint Commission accreditation and certification is recognized nationwide as a symbol of quality that reflects an organization's commitment to meeting certain performance standards.

Sickle cell anemia

An inherited blood disorder where RBCs form a rigid disc or crescent shape HbS: β6Glu>Val HbSS: sickle cell anemia

Thalassemias

An inherited blood disorder where the body makes an abnormal form of Hb, the protein in RBCs that carries O. The disorder results in excessive destruction of RBCs --> anemia. Mutations or del of the α or β genes

Denaturing High-performance Liquid Chromatography (HPLC)

Analysis for PCR products 150-450 bp. The heteroduplexes elute ahead of the homoduplexes as the conditions intensify. The migrating homoduplexes are detected by absorbance at 260nm or fluorescence.

Warfarin (Coumadin)

Anticoagulant, prevents thrombosis thromboembolism VCORC1: -Group 1: fast metabolizers/high dose -Group 2: slow metabolizers/low dose CYP2C9: SNPs cause slow metabolism/low dose

Clopidogrel (Plavix)

Antiplatelet agent Activated by CYP2C19 CYP2C19 poor metabolizers at high risk of treatment failure, death, heart attack, and stroke

Post transplant lymphoproliferative disorder (PTLD)

B-cell proliferation due to therapeutic immunosuppression after organ transplantation following infection with Epstein Barr Virus. Patients may develop infectious mononucleosis-like lesions or polyclonal polymorphic B-cell hyperplasia.

Crossmatching

CDC is used to crossmatch potential donor and recipient Recipient serum is the source of Ab tested against donor lymphocytes

What is the function of tRNA?

Carries aa to ribosome Anticodon pairs with codon on mRNA strand

What is the function of mRNA?

Carries genetic info out of nucleus Transcript translated to protein

DNA polymerase

Catalyzes phosphodiester bond between nt's Uses ssDNA as a template to determine which nt's to add

BK virus nephritis (BKVN)

Caused by BK virus (BKV) in renal transplant recipients Use of immunosupressent drugs allows BKV to replicate w/i graft, causing BKVN resulting in graft failure for many

Genome mutations

Change in the number of chr's

Multilocus sequence typing (MLST)

Characterizes bacterial isolates by using sequences of internal fragments of housekeeping genes (6-7, 450-500 bp)

Which pathogens can LCR be used to detect?

Chlamydia Gonorrhea Listeria HPV Sickle cell dz

Endonucleases (Euk)

Cleaves phoshpodiester bonds w/i poly-nt chain DNase I: induces DSBs AP endonuclease: BER

CLSI

Clinical Laboratory and Standards Institute; A not-for-profit membership organization, the Clinical and Laboratory Standards Institute (CLSI) brings together the global laboratory community for a common cause: fostering excellence in laboratory medicine. We do so by facilitating a unique process of developing clinical laboratory testing standards based on input from and consensus among industry, government, and health care professionals.

Ligase

Closes gaps in DNA Catalyzes phosphodiester bond between 3'OH and 5'P

Nucleic Acid labeling

Common labels used to generate nucleic acid probes include radioactive phosphates, biotin, fluorophores and enzymes. In addition, the bioconjugation methods used for nucleic acid probe generation may be adapted for attaching nucleic acids to other molecules or surfaces to facilitate targeted delivery or immobilization, respectively.

HLA class III

Complement C2, C4, B Expressed on plasma proteins

Splicesomes

Complex of snRNPs Removes introns from pre-mRNA and splices exons together

How are nucleotides joined together?

Condensation to form phosphodiester bond

CLIA

Congress passed the Clinical Laboratory Improvement Amendments (CLIA) in 1988 establishing quality standards for all laboratory testing to ensure the accuracy, reliability and timeliness of patient test results regardless of where the test was performed.

Illumina sequencing (NextGen)

DNA molecules and primers are attached on a slide and amplified with polymerase to form DNA clusters. Four types of reversible terminator bases (RT-bases) are added an the non-incorporated nucleotides are washed away. Images are taken of the fluorescently labeled nucleotides as the sequence extends, then the dye, along with the terminal 3' blocker allowing for the next cycle to begin.

DNA Polymerase II (Prok)

DNA repair, exonuclease activity

Mutation

DNA sequence change that is present in a relatively small proportion of the population <1%, somatic changes

Components of PCR

DNA template Two primers that are complementary to the 3' Taq polymerase dNTPs Buffer solution Mg2+ (divalent cations) - higher Mn2+ concentration can increase the error rate during DNA synthesis

What is considered good quality DNA/RNA from spectrophotometry?

DNA: 1.7-2.0 RNA: 2.0-2.3

Terminal transferase

DNApol synthesizes poly-nt chain at 3' end w/o a template

Primase

DNApol α (DNA dep RNA pol) adds short segments of complementary RNA to ssDNA template (primers), serves as starting points for replication

Exonucleases

Degrades nucleic acids by removing one terminal nt at a time Cleaves phosphodiester bond at end of chain 5' --> 3' and 3' --> 5'

Exonuclease I

Degrades ssDNA from 3'-->5'

Exonuclease VII

Degrades ssDNA from either the 5' or 3' ends One of the few enzymes with 5' exonuclease activity.

What is the genetic abnormality of: 46, XX, del(22q11.2)

Deletion in region 1, band 1, sub-band 2 of the long arm of chr 22 (diGeorge's syndrome)

What is the genetic abnormality of: 46,XY,del(16p14)

Deletion in region 1, band 4 of the short arm of chr 16

What can Southern Blots be used to detect?

Deletions/insertions Point mutations Polymorphisms Structural rearrangements

What are the 3 steps of PCR and their temperatures?

Denature 90-96C Anneal 50-70C Extension 68-75C

Southern Blot

Detect a large DNA fragment among many Target: DNA, probe: DNA

What can inhibit PCR amplification?

Detergent (SDS) Phenol (left over from DNA isolation) Heparin (specimen tube) Heme Dyes CSF, urine, sputum, parafilm

Mixed leukocyte culture (MLC)

Determines T-cell cross-reactivity donor and recipient lymphocytes are mixed in culture; the degree of incompatibility is indicated by the number of cells that have undergone transformation and mitosis, or by the uptake of radioactive isotope-labeled thymidine.

Maxam-Gilbert Sequencing

Differing concentrations of salt are used in four different tubes - A, T, C, G - Usually DMS (dimethylsulphate), FA (formic acid), H (hydrazine), and H+S (hydrazine + salt) --> read on a gel

Coagulopathies

Disorder of blood coag caused by inherited or acquired defects in coag proteins, platelets, or vasculature e.g. Von Willebrand's dz, hemophilia, Factor V Leiden

Sanger sequencing method

Divided into 4 samples (ddA, T, G, C) Label with radioactive/dye oligo at 3' end Mix with taq, dNTPs, ddNTP and incubate run on gel --> frags will terminate at different lengths

What is one way you can increase the yield/quality of DNA/RNA after running gel?

Do an EtOH ppt

Base Excision repair (BER)

Done by DNA glycosylase, AP endonuclease Cleaves glycosidic bond of a single base base, leaving apurinic/apyrimidinc site

Nucleotide Excision repair (NER)

Done by endonucleases Removes a span of nt's by cleaving phosphodiester bond

Graft versus host disease (GVHD)

Donor cells recognize host (recipient) cells as foreign and attack and destroy

What types of probes are used for FISH?

Dual fusion: 2 probes flank the breakpoint at both t locations CEN probes: centromeric probes bind to repetitive alpha satellite sequences Telomeric probes Whole chr paints

Which specimen tubes are the best for use with molecular assay?

EDTA (lavender/purple) ACD (yellow)

Breast cancer, Her1/ErbB1

EGFR, estrogen receptor (ER), is overexpressed Estrogen binds, ER dimerizes -> TXN of genes that promote proliferation Dx: IHC, FISH, qPCR Treatment: Tamoxifen, raloxifene, faslodex

Analyte specific reagent (ASR)

FDA defines analyte specific reagents (ASRs) in 21 CFR 864.4020 as "antibodies, both polyclonal and monoclonal, specific receptor proteins,ligands, nucleic acid sequences, and similar reagents which, through specific binding or chemical reaction with substances in a specimen, are intended to use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological specimens.

FDA

FDA is responsible for protecting the public health by assuring the safety, efficacy and security of human and veterinary drugs, biological products, medical devices, our nation's food supply, cosmetics, and products that emit radiation. also responsible for advancing the public health by helping to speed innovations that make medicines more effective, safer, and more affordable and by helping the public get the accurate, science-based information they need to use medicines and foods to maintain and improve their health.

Deoxyribonuclease I

From bovine pancrease, digests ss and dsDNA at pyrimidines. Typically used to remove DNA from RNA preparations.

Prothrombin

G20210A A bleeding disorder that slows the blood clotting process. Mutations in the FII gene cause prothrombin deficiency.

Exons

Gene sequences that represent codons used in TLN to protein

How can you tell if you have good RNA using gel electrophoresis?

Good RNA will have a 2:1 intensity (28S : 18S) if 18S is more, RNA degradation is possible

Major histocompatibility complex (MHC)

Group of genes located on 6p MHC gene products are called human leukocyte antigens (HLA)

What is bDNA used to detect?

HIV Hepatitis

What pathogens can you detect using NASBA?

HIV Hepatitis HTLV CMV

Z-DNA conformation

Left-handed caused by stress or torsion (e.g. during transcription)

Serological Analysis of the MHC

HLA Typing - known anti sera + recipient's lymphocytes Cytotoxicity reading > 6 ( 51 - 80% dead cells), recipient has an Ag matching the panel antibody Screening - recipient Ab + ref lymphocytes % PRA >50% = recipient highly sensitized Cross matching - recipient Ab + donor lymphocytes If donor cells are killed by recipient's sera, it's a positive cross match and donor cannot be used

HLA class I

HLA-A, HLA-B, HLA-C Expressed on all nucleated cells Composed of an α and β-2 chain (Domains:α1, α2, α3) Polymorphisms located on chr 6, exon 2 and 3

HLA class II

HLA-DP, HLA-DQ, HLA-DR Expressed on Ag presenting cells Composed of an α (α1 & α2) and β (β1 & β2) Polymorphisms located on chr 6, exon 2

Which specimen tubes are not good for use with molecular assays?

Heparin (brown/green) inhibits several enzymes used in molecular assays

If fragments are dissolved in 50% formamide will the stringency be higher or lower?

Higher

What are two biological exceptions to positive identification by autosomal STR?

Identical twins and clones have identical nuclear DNA profiles

Aneuploid

Increased number of chr's (eg. Down's syndrome)

Topoisomerase I

Induces ss breaks Remove DNA supercoils during TXN and DNA replication; for strand breakage during recombination; for chr condensation; and to disentangle intertwined DNA during mitosis

How does EtBr cause DNA to fluoresce?

Intercalates into the double helix Absorbs UV ~300 nm, emits ~600 nm

Cleavase/Invader

Invader & signal probe added to target Cleavable substrate is formed if mutation is present Signal probe is cleaved to form invader in the next step FRET probe is added; if invader hybridizes, cleavase cuts flap, separating R and Q

What is the genetic abnormality of: iso(X)(q10)

Isochormosome comprised of the long arms of the X chr

Nucleic Acid Sequence Based Amplification (NASBA)

Isothermal, single tube rxn High sensitivity Enzymatic rxns take place concurrently

Loop-mediated isothermal amplification (LAMP)

Isothermal, single tube technique for the amplification of DNA Uses 4 different primers that recognize 6 regions on target gene Stem-loop structure forms which is used as a template for lamp cycling (SDA)

Sanger Sequencing

Known as deoxy chain terminating sequencing; A primer complementary to the 5' region of DNA is used. The primer is typically labeled with P32 (internal labeling) or a fluorescent dye. Here, modified ddNTPs derivatives are added which lack the OH group found on the 3' carbon of the dNTPs. DNA synthesis will stop upon incorporation of a ddNTP because the bond between the phosphodiester bond cannot be established.

DNA Polymerase δ (Euk)

Lagging strand synthesis DNA repair, exonuclease, replaces primers as it encounters Okazaki fragments

What are some of the benifits of FISH?

Large number of cells may be scored Dual color --> multiple targets Many sample types

DNA Polymerase ε (Euk)

Leading strand synthesis exonuclease

Pyrimidine

One carbon ring Cytosine, Thymine, Uracil

Ligase Chain Reaction (LCR)

Ligation of 2 adjacent primers, which uniquely hyb to one strand of the target Upstream 3' end coincides w/a potential single bp diff in the target sequence If the ends match -> ligated by ligase -> act as a template for the next step 2nd set of primers that are complementary to 1st set -> amplification via pcr probe amp = mutation no probe amp = no mutation

What are the two types of isolation/extraction methods?

Liquid phase (organic & inorganic) Solid phase (Qiagen)

What is the best temperature to store DNA?

Long term = -70C short term = -20C

What is the best temperature to store RNA?

Long term = -70C short term = -20C

If fragments are dissolved in a high concentration of NaCl will the stringency be higher or lower?

Lower

Histone methylation

Lysine (K) and arginine (R) can be methylated Common on K residues of H3 and H4 tails Methylated = silenced Heterochromatin

Histone acetylation and deacetylation

Lysine (K) residue on N-termini Acetylation = active, removes + charge Deacetylation = inactive Euchromatin

Molecular beacons

Measures accumulation of product at the annealing step Contains target specific seq and inverted repeat that forms stem-loop At annealing step probe hyb's to target, separating R and Q

Spectrophotometer

Measures amount of light absorbed Quantitative measurement of [DNA/RNA]

In-vitro diagnostics (IVD)

Medical devices intended to perform diagnoses from assays in a test tube, or more generally in a controlled environment outside a living organism.

Retrotransposons

Mobile genetic elements which can increase genome size and insert itself within coding/noncoding regions

What is the genetic abnormality of: 45, X

Monosomy X, Turner's syndrome

Real-Time PCR/qPCR

PCR based method which is used to amplify and quantify a targeted DNA molecule. Enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when noramalized to the DNA input.

Scorpion probes

PCR prod is covalently bound to dye; primer is bound to molc beacon type seq After extension, target specific seq will unfold w/ the newly synthesized target seq, separating R and Q

What are some disadvantages of PCR?

Must know the sequence first Prone to contamination May not be 100% specific Specificity dependent on temp and [Mg]

What are the clinical uses for DNA sequencing?

Mutation detection Confirm mutation by other method Resistance testing HLA genotyping

What is SDA used to detect?

Mycobacterium tuberculosis Chlamydia trachomatis

Should you freeze blood or bone marrow if you are going to use it in a molecular assay?

NO Room temp 22-25C Neutrophils will degranulate if frozen

Pyrosequencing

No gels, fluorescent dyes, sequencing ladder, or ddNTPS; Pyrophosphate (PPi) is released when the phosphodiester bond forms between the dNTP and the primer and is converted to ATP. The ATP then generates a luminescent signal by luciferase-catalysed conversion of luciferin to oxyluciferin. This is repeated with each of the nucleotides - the generation of a signal indicates which nucleotide is the correct base in the sequence. GTTAC (dG peak, dT peak (double that of dG), dA peak, dC peak. Most useful for short to moderate sequencing analysis, or SNPs. Used in HLA

Is 47;XXY a normal karyotype?

No, this is XXY syndrome

Introns

Non-coding sequences that are spliced out before TLN

SyBr green

Non-specific intercalation into the minor groove of dsDNA, can be used in qPCR

How is translation terminated?

Occurs when stop codon enters A site Release factor recognizes stop codon, hydrolyzes ester bond with P site, releasing aa chain

What makes DNA negatively charged?

Phosphate groups of the phosphate:ribose backbone

Irinotecan

Prevents DNA from unwinding by inhibition of topoisomerase 1 Inactivated by glucuronidation to uridine diphosphate glucoronosyltransferase 1A1 (UGT1A1)

What is the use of uracil-N-glycosylase (UNG) in PCR?

Prevents contamination by destroying amplicons containing dUTPs

Poly-A tail

Prevents mRNA from being degraded in cytoplasm 100-250 A's at 3' end

CMS

Previously known as the Health Care Financing Administration (HCFA), is a federal agency within the United States Department of Health and Human Services (DHHS) that administers the Medicare program and works in partnership with state governments to administer Medicaid, the State Children's Health Insurance Program (SCHIP), and health insurance portability standards. In addition to these programs, CMS has other responsibilities, including the administrative simplification standards from the Health Insurance Portability and Accountability Act of 1996 (HIPAA), quality standards in long-term care facilities (more commonly referred to as nursing homes) through its survey and certification process, and clinical laboratory quality standards under the Clinical Laboratory Improvement Amendments.

Qβ replicase

Probe amplification Target (ssDNA/RNA) and to tube w/ reporter probe (has QB reporter Target:reporter hyb to capture probes > complex is hyb to capture probe with magnetic bead > complex is bound to well and washed Target:reporter released > QBpol is added > probe is amplified and detected via colorimetric or flurogenic methods Detects: mycobacteria, Chlamydia, HIV, CMV

Ligase Chain Reaction (LCR)

Probe amplification Two adjacent primers are ligated and amplified by a 2nd set of primers if mutation is present at 3' end of upstream primer Can detect a 1 bp mis-match

Multiplex Ligation-dependent Probe Amplification (MLPA)

Probe amplification; multiple targets amplified in a single rxn 2 oligos: both contain sequence specific probe and universal primer Oligos hybridize adjacent to each other > ligase closes gap > PCR with primers that are specific to universal primer sites on the oligos

DNA Polymerase I (Prok)

Processes Okazaki fragments Replaces RNA primers with DNA (exonuclease activity) Excision repair & proof reading

Feedback inhibition

Product of pathway is noncompetitive inhibitor Binds to allosteric site to slow down rxn b/c too much product

Exonuclease II

Proofreading function of the pol Degrades ssDNA from 3'-->5'

Histones

Proteins that DNA tightly coils around to form chromosomes Octamer, 2 ea of: H2A, H2B, H3, and H4 Histones are hydrophobic (basic K & R,+) DNA is hydrophilic (P backbone, -) +/- interaction keeps them bound

What some indirect analysis methods?

RFLP linkage analysis

RT-PCR

RNA --> cDNA first strand synthesis

The three biochemical activities of reverse transcription

RNA-dependent DNApol, Ribonuclease H, and DNA-dependent DNApol --> all used to create ds cDNA from RNA

Complement-dependent cytotoxicity test (CDC)

Receipient alleles determined by using a panel of Ab against known HLA types Cross-reactive: leukocyte being tested has Ag matching Ab in well

TaqMan

Relies on the 5' exonuclease cleavage activity of Taq pol to cleave a dual labeled probe during hybridization to the complementary target sequence. Only emits a signal once separated from quencher.

Exonuclease III

Removes 5' mono-nt's from the 3' end of the dsDNA in the presence of Mg2+ and Mn2+. Removes nucleotides from blunt ends, recessed ends, and nicks, but NOT overhangs!

Telomeres

Repeat sequence (TTAGGG) at the ends of chr, protect chr from degradation

How does PFGE separate larger fragments more efficiently than standard electrophoresis?

Repeated reorientation forces larger fragments through the gel matrix more efficiently

Endonucleases (Prok)

Restriction enzymes Cleaves phoshpodiester bonds w/i poly-nt chain Recognition site is palindromic sequence Types I-V

What method would you use if you knew the gene sequence and the mutation?

Reverse Dot Blot

A-DNA conformation

Right-handed Deep narrow major groove, wide shallow minor groove Dehydrated DNA takes this form

B-DNA conformation

Right-handed Wide major groove, narrow minor groove Common form found in cells

What does smearing on a gel indicate?

Sample degradation Loaded too much

Name 3 assays by which Factor V Leiden R506Q mutation can be detected:

Sequence specific PCR, PCR-RFLP, Invader Assay

SOLiD Sequencing (NextGen)

Sequencing by ligation. A pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. The oligonucleotides are annealed and ligated, the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR and the resulting beads (each containing single copies of the same DNA) are deposited on the glass slide for sequencing.

Drug metabolism

Several genes are responsible for variances in drug metabolism and response, CYP450 is the most well known CYP metabolism phenotypes: extensive metabolizer (EM), intermediate, ultra-rapid, and poor

Okazaki fragments

Short fragments of DNA synthesized by DNApol δ using the lagging strand (3'->5') as a template

Enhancers

Short regions of DNA that bind proteins (TXN factors) that enhance TXN of a gene

Hybrid capture assays (HCA)

Signal amplification Target DNA is released from the cell, denatured, and binds RNA probe DNA:RNA is recognized and binds Ab on solid support DNA:RNA are detected by adding Abs that bind w/ AP, substrate is added

Branched DNA (bDNA)

Signal amplification Target captured by probes on a solid support Extender, pre-amp, and amp probes hybridized Amp bind alkaline phosphatase Dioxetane is added as a substrate for chemiluminescence Measured with a luminometer

Haploid

Single copy of each chr (humans have 23)

What are primer dimers?

Size is sum of two primers Primers hyb and are extended by Taq

CAP

The College of American Pathologists (CAP), is a medical society serving more than 18,000 physician members and the global laboratory community. It is the world's largest association composed exclusively of board-certified pathologists and pathologists in training and is the worldwide leader in laboratory quality assurance. The College advocates accountable, high-quality, and cost-effective patient care.

Describe the growth of the nucleic acid chain

The chain grows by the attachment of the 5' phosphate group of an incoming nucleotide to the 3' hydroxyl group of the last nucleotide on the growing chain

Pharmocogenomics

The study of genetic factors that influence how a drug works. The goal is to understand how a person's genotype affects an individual's response to drugs. It deals with the influence of genetic variation on drug response in patients by correlating gene expression or snp's with a drug's efficacy or toxicity

Carbemazepine (Tegretol)

Treat bipolar disorder, seizures, neuropathic pain Dangerous/fatel skin rxns w/ HLA alleles: HLA-B*1502 HLA-B58

Gefitinib (Iressa)

Treats EGFR+ (Her1, Her2) breast cancer Tyr kinase antagonist Metabolized by CYP3A4 to its active form

Tamoxifen

Treats ER+ breast cancer ER antagonist Metabolized by CYP2D6 and 3A4 to its active form

Trastuzumab (Herceptin)

Treats Her2/Neu/ErbB2+ (17q12 over expression) breast cancer. mAb binds extracellular domain of EGFR receptors, blocking mitogen binding

What is the genetic abnormality of: 47,XY,+18

Trisomy 18: Edwards Syndrome

A CEN probe is used to visualize chr 21. Three fluorescent signals are observed in the patient's cells when they are stained. These results are consistent with what chr disorder?

Trisomy 21, Down's syndrome

Purine

Two carbon rings Adenine, Guanine

Diploid

Two copies of each chr (humans have 46)

Transcription-Mediated Amplification (TMA)

Two enzymes: RT and RNApol Isothermal RNA or DNA

Human papillomavirus (HPV)

Types 16 and 18 cause most cervical cancers

Stop codons

UAG UAA UGA

Gyrase (topoisomerase II)

Unwinds supercoiling caused by unwinding at the rep fork by introducing DSBs

Melt Curve Analysis

Used for SNPs; Specimens with identical sequences should yield the same peak at the expected Tm and specimens containing different sequences will yield two or more peaks. (FRET Probes - dissociation curves)

Single-Stranded Conformational Polymorphism Ananlysis (SSCP)

Used for known gene, unknown mut Mutation screening Short PCR products form 3D conformation when cooled --> muts have different conformation than WT Non-denaturing PAGE, muts migrate different than WT

Ribosomes

Where TLN occurs Prok: 30s and 50s Euk: 40s and 60s Catalyzes peptide bond between a.a.'s

Gene mutations

affect single genes and are often small changes in the DNA sequence

Strand Displacement Amplification (SDA)

after the initial denaturation step the reaction proceeds at one temperature. Normally used for M. tuberculosis, C.trachomatis, and N. gonorrhoeae.

What can cause primer dimers?

annealing temp too low too much primer

Stringency

conditions of hybridization that control the specificity of binding of the probe to the target sequence

topoisomerase II

cuts both strands of one DNA double helix, passes another unbroken DNA helix through it, and then reanneals the cut strands

Dye terminator

ddNTPs are used and fluorescently labeled instead of the primer. All four reactions are performed in the same tube. Terminated nucleotides are amplified.

Why does Sanger sequencing use ddNTPs instead of dNTPs?

ddNTPs lack of a 3' OH which makes it impossible for pol to add more nucleotides --> chain termination

Methylation of cytosine bases 5' to the gene will increase or decrease expression?

decrease

siRNAs complementary to the gene transcript will increase or decrease expression?

decrease

How can you increase strigency in a hybridization?

decrease [salt] increase [formamide] increase temp

Angelman syndrome

del(15)(q11q13) maternal; paternal is imprinted Ataxia, seizures, inappropriate laughter

Prader-Will syndrome

del(15)(q11q13) paternal; maternal is imprinted Congenital dz, mental retardation, short stature, obesity, hypogonadism

Chronic lymphoid leukemia (CLL)

del(17)(p913) TP53 del(11)(q22) ATM del(13q) long arm clonal b-call malignancy, progressive accumulation of mature lymphocytes Most common leukemia Dx: Flow cytometry; 'basket' or 'smudge' lymphocytes Treatment: chemo., BM transplant

Formamide acts as a __________ in a hybridization.

denaturing agent

Centromeric probes (CEN)

designed to hybridize to the high alpha satellite sequences surrounding centromeres. Region specific to detect aneuploidy of chromosomes

ddNTP

dideoxyribonucleoside triphosphate lack a hydroxyl group (OH) at 2' and 3'

Chaotropic agents

disrupts the structure and denatures the DNA by increasing the entropy and non-covalent forces like hydrogen bonds (ex. chemicals like - sodium iodide, or sodium perchlorate)

Restriction enzymes

endonucleases that recognize specific sequences and break the phosphodiester bond of dsDNA

Diagnostic specificity

likelihood of negatives

Diagnostic sensitivity

likelihood of positives

Reverse transcriptase

enzyme that transcribes RNA to cDNA (lacks introns) RNA --> RNA:DNA --> cDNA (dsDNA)

Denaturing agents

formamide, urea, mercaptoethanol

Type I restriction enzymes

have both nuclease and methylase activity in a single enzyme. Bind to host-specific DNA that contains methylated adenines

Vector

helps carry DNA into cell ie plasmids, virus

What is direct analysis?

identifying a specific gene or mutation that caues disease. gene must be known, might need to know mut

Analytical sensitivity is based on _____ and specificity is based on _______.

limit of detection target specificity

Histone acetylation close to the gene will increase or decrease expression?

increase

What is indirect analysis?

inherited marker near gene associated with disease unknown gene and /or mut

Variant

inherited sequence alterations

Transcription

initiation --> elongation --> termination

cDNA

intron free complementary DNA can be inserted into a plasmid

How does PCR work with methylated DNA?

primers are designed to recognize methylated and unmethylated sense strands at gene promoter the methylated bases inhibit enzyme activity at recognition sites

Does heating a solution from 65C to 75C during hybridization raise or lower stringency?

raises

Type III restriction enzymes

resemble type I enzymes in their ability to methylate and restrict (cut) DNA. - adenine methylation occurs on only one strand.

Colicinogenic factors

resistance to bacteriocins, toxic proteins manufactured by bacteria.

R-factors

resistance transfer factors. Carry antibiotic resistance to common antibiotics.

Line Probe Assay (LiPA)

reverse hybridization assay using sequence-specific oligonucleotide probes (reverse SSOP) multi-parameter testing --> single strip

Open Reading Frame (ORF)

sections of DNA that begin with start codons and end with stop codons DNA: 5' --> 3' transcription: 3' --> 5' DNA --> RNA (promoter) translation: 5' --> 3' mRNA

Primary protein structure

sequence of a chain of amino acids

α thalassemia

α genes on chr 16, two from each parent, wt: αα/αα α thalassemia when 1+ of these genes are affected Severity increases with number of genes affected

β thalassemia

β genes on chr 11, one from each parent, wt: β/β β thalassemia when 1+ of these genes are affected Severity increases with number of genes affected

How is translation initiated?

small rRNA (40S) subunit binds mRNA and scans for start codon (AUG) Met-tRNA is brought to the P site Large rRNA (60S) subunit binds

What are some direct analysis methods?

southern PCR - ASO blot, restriction digest SSCP HA

Mantle cell lymphoma (MCL)

t(11;14)(q13;q32), Cyclin D1;IgH Cyclin D1: needed for cell cycle t causes overexpression of cyclin D1 > clonal expansion of B lymphocytes Dx: FISH, CT/PET scan for high glucose metabolism spots

Acute lymphoblastic leukemia (ALL)

t(12;21) TEL-AML1 fusion t(9;22)(q34;q11) BCR-ABL fusion (Philly chr) Abl is a Tyr kinase; t causes Abl to be constitutively expressed > unregulated lymphoblast proliferation Common in children Dx: karyotyping, IHC, S.blot, RT-PCR, q-PCR Treatment: Imatinib (Gleevec), Tyr kinase inhibitor

Follicular lymphoma

t(14;18), IgH;Bcl-2 WT Bcl2 regulates apoptosis t causes overexpression of Bcl2 > immortal cell (clonal B cell expansion) Most common indolent N.H.L. Dx: PCR w/ primers for MBR/MCR & J regions

Burkitt's lymphoma

t(8;14)(q24;q32), c-myc;IgH t causes c-myc to be constitutively expressed > unregulated proliferation (clonal B cell expansion)

Acute myeloid leukemia (AML) Promyelocytic (APL)

t(8;21) RUNX1/RUNX1T1 Common in adults; myeloblasts 'freeze' in current state (don't differentiate) & proliferates forming a clonal population Dx: Flow cytometry, FISH Treatment: Chemo., BM transplant APL t(15;17) PML;RARα, Promyelocytic leukemia protein;Retinoic acid receptor alpha

Chronic myelogenous leukemias (CMLs)

t(9;22) Abl;Bcr (Philly chr) BCR-ABL constitutively active > activates Jak/Stat; inhibits apoptosis > unregulated proliferation of myeloid cells Clonal expansion of myeloid cells in BM Dx:Karyotype, FISH, RT-PCR Treatment: Imatinib (Gleevec)

aminoacyl tRNA

tRNAs that carry amino acids

What is the purpose of primers in PCR?

to intiate replication

Too many and too few ddNTPs result in:

too many ddNTPS will result in many short sequence reads, too little will result in loss of sequencing data but will give a longer read.

TAE Buffer

tris-acetate w/ EDTA good for DNA recovery good for lrg fragments low buffering capacity increases migration of DNA thru gel

TBE Buffer

tris-borate w/ EDTA good for small DNA fragments high buffering capacity decreases migration thru gel

Heterduplex Analysis (HA)

use for known gene, unknown mutation mutation screening bands on gel --> retarded migration from WT due to seq differences

Branched DNA Technololgy (bDNA)

used for DNA or RNA; short probes are used to capture the target nucleic acid and then to multiple reporter molecules, loading the target nucleic acid with signal.

Type II restriction enzymes

used most frequently in the laboratory - do not have inherent methylation activity in the same molecule as the nuclease activity

Transcription Mediated Technology (TMA)

uses RNase H which degrades RNA from the intermediate hybride so denaturing is no longer required; Isothermal process - negates the requirement for thermal cycling to drive rxns. Targeting RNA allows for the direct detection of RNA viruses (HCV, HIV).


Related study sets

Topic 5: Digestion and Nutrition PREPU

View Set

Maternal and Newborn Exam 2/Final

View Set

A pénzügyi szektor alapvetései

View Set

Compensation Administration - Chapter 11

View Set

Comp Sci Principles Semester 1 Final

View Set

Pharm Ch. 8 tetracyclines, macrolides, lincosamides (prep u, vocab + quizletA)

View Set

California Real Estate Chapter 10

View Set

what are two types of planets in our solar system

View Set

Neuropsychological disorders of self-awareness 6B

View Set