Bio Exam 3- Evolution

Kaibab squirrels live on the north side of the Grand Canyon and are a subspecies of Abert's squirrel, a species found only on the south side of the Grand Canyon. Presumably, Kaibab squirrels were prevented from breeding with Abert's squirrels when the Grand Canyon became an uncrossable barrier. If correct, this would be an example of

Allopatric Speciation (answers: Ambipatric Speciation Allopatric Speciation Schizopatric speciation No Speciation)

Which of the following radioactive isotopes is used to date organic remains?

Carbon-14

Comparative anatomy

Comparative anatomy is the study of similarities and differences in the anatomy of different species. It is closely related to evolutionary biology and phylogeny (the evolution of species). Comparative anatomy has long served as evidence for evolution; it indicates that various organisms share a common ancestor.

Early in development, vertebrate embryos develop a characteristic series of pouches in the "throat" region; these pouches are called pharyngeal arches. In the early 1800s, an embryologist named Karl Reichert determined that two of the three mammalian inner ear bones (the "hammer" and the "anvil") arose from one of the pharyngeal arches. The same part of the same arch gives rise to the bones that form the jaw joint in reptiles. Which of the following best describes this finding?

This is an example of a developmental homology from which we can infer that reptiles and mammals are evolutionarily related.

Kangaroo rats (actually mice) from the deserts of the southwestern United States look nearly identical to jerboas (also mice) from the deserts of Africa. You sequence one gene present in both species as well as the same gene in the U.S. pocket mouse and the African jumping mouse. You obtain the following results. Based on the data, which species are most closely related to each other? U.S. kangaroo rat: GGACCCAGATCAGTAGGACT U.S. pocket mouse: GGACGCAGATCATTAGGACT African jerboa: GGATCCAAATTTGTCGGAGT African jumping mouse: GGATCGAAATTTGTCGAAGT

US kangaroo rats are most related to US pocket mice. African jerboas are most related to African jumping mice.

Hybrid infertility

Viable hybrid offspring cannot reproduce (zebras and horses offspring, zebroid, cannot produce offspring of their own.)

A number of mosquito populations today are resistant to specific insecticides, even though those insecticides were highly effective when they were first introduced. Biologists believe that insecticide resistance evolved in mosquitoes because

a few mosquitoes in a diverse mosquito population were probably resistant to the insecticide before it was ever used. These survived to reproduce, and passed that trait on to their offspring.

The correlation between vitamin D, folate, sunlight exposure, and the resulting variations of skin tones is an example of

a genetic strategy to increase fitness natural selection human evolution descent with modification all of the above

Founder effect causes

a loss of genetic diversity

Vestigal Structure

a structure inherited from an ancestor that no longer serves a clear function in the organism that possesses it.

Founder Effect

a type of genetic drive where a small number of individuals leaves one population and establishes a new population. by chance the newly established population may have lower genetic diversity than the original population.

8) Which will evolve faster: a bacterial population whose cells divide every 20 minutes, or a deer population whose females give birth to 2 fawns once a year? Why?

a) Bacteria. Each generation has a chance to have evolved. The faster you reproduce, the faster you could evolve.

12) A population of grasshoppers in the Kansas prairie has two color phenotypes, green and brown. Typically the prairie receives adequate water to maintain healthy green grass. Assume a bird that eats grasshoppers moves into the prairie. How will this affect the natural selection of grasshoppers? How might this change in a drought year?

a) Brown will be eaten more often, so they will not reproduce with as great a frequency. In a drought, the grass is brown and green grasshoppers will be eaten more often.

5) Why is the survival of small populations more difficult than that of larger populations?

a) Changes in the population can easily cause alleles to disappear from the gene pool because there are so few individuals that carry each allele.

16) How has our ability to sequence DNA influenced the field of Evolutionary Biology? How has isotope chemistry influenced it? What role does Geology play in Evolutionary Biology? What other disciplines are important to study evolution?

a) DNA is the basis for the traits we have that allow our survival and reproduction. So, knowing how organisms have changed genetically allows us to study evolution from its root. DNA sequence homology has helped us verify what we already knew from fossil and comparative evidence. It has also helped us solve some of the puzzles that comparative evidence couldn't sort out for us.

Assume that it is possible to remove cores of rock from the earth 6 inches in diameter and 3000 feet deep into the earth. Evolution would predict what about the fossils in such cores as they are examined from the top soil layer to bottom?

a) Fossils further down into the earth are older, from organisms that lived a longer time ago.

17) Why don't we have a complete fossil record?

a) Fossils only form under specific circumstances - usually when an organism is buried quickly.

3) Explain what Evolution is in your own words. Be specific and careful with your terminology.

a) Genetic change in populations

14) Two species of garter snakes live in the same geographic area. One mainly lives in water and the other mainly on land so that they rarely encounter each other and do not interbreed. This is an example of what type of Macroevolutionary separation?

a) Geographic - Environmental or habitat separation

15) There are currently many similar but different species on either side of the isthmus of panama. They probably resulted from what type of evolutionary processes?

a) Geographic separation

2) A dog that lives in Florida is moved to Alaska. It grows a thicker coat now than it did in Florida. Is this an example of evolution? Explain.

a) Individuals do not evolve. Populations do.

11) Almost no modern species (species alive today) are found as fossils in rocks below the glacial till (the sediment left from the last ice age). What does this have to do with our discussions of evolution?

a) Many of the species we see today evolved as a result of that environmental change. Many organisms died, and new species evolved to recolonize those habitats.

4) What is the only mechanism of evolution that introduces entirely new alleles into a population? Why is this mechanism different from the others?

a) Mutation. Entirely random introduction of brand new alleles. All other mechanisms just change the frequency of already existing alleles.

10) A population of deer was threatened with overpopulation until cheetahs were imported. After a couple of years there were fewer deer but the average running speed of the deer had increased. This is an example of which of the following: mutation, genetic drift, gene flow, natural selection?

a) Natural selection

6) Which process of evolution occurs in response to the environment?

a) Natural selection

1) Describe the process of Natural Selection. Give an example.

a) Populations are genetically diverse. If the environment changes, some will live and reproduce. Those who reproduce will pass their genes to the next generation. If the frequency of alleles is different in the new generations, evolution by natural selection has occurred.

21) Salamanders living on the northeast shore of South America and the southwest coast of Africa share 92% DNA sequences, but are considered different species. What can you hypothesize about this information?

a) These two species of salamander used to be members of the same population. b) When the continents of South America and Africa separated and drifted apart, two groups of the same species of salamander evolved independently from one another. c) One species of salamander became two species due to geographical separation.

7) Why might some species have very few changes in their populations, even over a large span of a million years?

a) They have a wide range of environments they can live in. They aren't as specific in what they eat or the temperature they can take, etc.

20) Modern whales lack hindlimbs (legs), but have structural remnants of pelvic and leg bones. Which of the following statements is true regarding this information?

a) modern whales most likely had an ancestor that possessed hindlimbs. b) The remnants of pelvic and leg bones in whales suggests that while whales don't use these bones, they are present due to evolution of this species from an ancestor that had legs. c) This comparative anatomy evidence suggests that in evolution, organisms evolve from species that already exist. d) Species that have a common ancestor have similar anatomical structures that are used for different functions.

The similarity between the forearm of a human and an alligator suggests that

alligators and humans share a common ancestor.

A radioactive isotope is

an element with an unstable nucleus that decays to a more stable form

Antibiotics should only be prescribed for

bacterial infections

13) The Theory of Natural Selection states that:

c) The best adapted individuals in a population survive and reproduce contributing the most genes to the next generation

18) We know that it is possible to take a gene from a human being, put it into bacteria, and have those bacteria produce the human protein. The human protein produced by the bacteria is indistinguishable from the protein produced in human cells. From this observation we can conclude:

c) The way proteins are produced from genes must be the same in humans and bacteria.

23) If, within a large population no mutations occur, no migration occurs, all matings are random and there is no change in the environment, what will happen?

d) no evolution will occur in that population

Ecological Isolation

Different environments (arctic vs desert fox)

It would be expected that a population geographically located where UVB exposure is maximal to have a skin tone that is

dark

Beahvioral isolation

different mating activities (chicken and pheasant).

Velociraptor, of Jurassic Park fame, was one of many genera in the group of animals called dromeosaurs. The organisms in this group share characteristics of both dinosaurs that lived before they did and of birds, which evolved later. As such, they are

excellent examples of fossil intermediates that both support the predictions of descent with modification and help us understand the evolution of birds from their dinosaur ancestors.

The four-toed ancestor of the modern horse would have been well suited to life in a

forest

Gametic isolation

gametes cannot unite. Dog and cat.

Based on the phylogenetic tree below, all of the following are TRUE statements EXCEPT

horses and dogs are most closely related to the opossum

Tiktaalik is an important fossil because it is a(n)

intermediate fossil

All of the following are TRUE of folate EXCEPT

it increases with increased exposure to the sun

All of the following are true of natural selection EXCEPT

it works best in genetically identical populations.

Anatomically modern humans

left Africa 150-< /span>200,000 years ago and arrived in both western Europe and Australia around 40,000 years ago—before they arrived in North or South America

Temporal isolation

mating behavior or fertility at different times. Leopard frog-spring, bullfrog, summer.

Skin color is determined by the amount of _______ a person has in their skin

melanin

Allele frequencies of a population can change by

natural selection genetic drift mutation gene flow all of the above

Diversifying selection

occurs in a "patchy" environment which extremes of the phenotypic range do better than middle range individuals.

The first organisms on land were

plants

Gene flow can be described as changes in allele frequency due to

populations mating with other populations

Evolution and natural selection can be witnessed in the human population by examining

the CF allele and cholera resistance lactase persistence and cattle farming the sickle-cell trait and malaria all of the above skin-tone variation and sunlight exposure

You have conducted a careful survey of tulgey wood habitats and found two different types of Jabberwocks. Where the toves are slithy, most Jabberwocks have eyes of flame. Where the toves are not slithy, most Jabberwocks have normal brown eyes. Based on these results, you hypothesize that

the flame-eyed Jabberwock phenotype has higher evolutionary fitness in an environment of slithy toves, while the normal phenotype has higher evolutionary fitness in environments where toves are not slithy.

The field of biogeography provides information about

the geographic location of a species the distribution or range of a species the adaptations of a species over time the evolutionary history of a species

An island has a population of 100,000 moths that has 98% grey individuals and 2% black individuals. Generation after generation, this ratio and population size remains basically the same. After a hurricane, 15,000 black moths are blown onto the island. After 2 years,

the percentage of black moths will increase

Directional selection

when a single phenotype predominates in a particular environment

Stabilizing selection

when phenotypes at each end of the spectrum are less suited to the environment than organisms in the middle of the phenotype range

A species of lizard is found on the eastern and western sides of part of a mountain range. On both sides, individual populations are small. On the western side, individual populations are relatively close together and males move extensively among populations to breed. On the eastern side, however, populations are farther apart and males seldom move among more than one or two adjacent populations to breed. If you were to study the genetic diversity of western and eastern populations, which pattern would you expect to find?

Each western population would be genetically diverse, although the allele frequencies might differ from one population to the next. Eastern populations would be less diverse, and some populations will have only a limited number of the total alleles available in the species.

Embryonic Development

Embryonic homology/relatedness

Natural Selection

Environment, select who has reproductive success

Folate (vitamin B9) is important for reproductive health. Why?

Folate prevents spina bifida in babies and maintains high sperm count in men

Hybrid invaibility

Gametes unite but viable offspring cannot form. (goat and sheep)

Pollen from a tomato plant lands on a grapefruit flower. The pollen fails to grow a pollen tube. This is an example of

Gametic isolation (answers: Temporal Isolation Ecological Isolation Gametic isolation Behavioral Isolation)

Which of the following will result in diversifying selection?

In an environment with patches of black and white rocks, both black and white rabbits can hide, but gray rabbits are always visible and are eaten by predators.

Mechanisms of Genetic Change

Mutation, natural selection, gene flow, gene drift.

Fossil Evidence

Physical Structures, what time period lived, environment (sediment buried).

Frog species mate at different times of the year. This is an example of which type of reproductive isolation?

Temporal Isolation

You have four similar, apparently related fossils. The fossils are in labeled boxes, but there is a chance that another researcher working on your project mislabeled the boxes containing the specimens. You know the fossils were found at the following depths: 100 feet, 80 feet, 60 feet, and 35 feet. 1. Fossil 1 is similar to a lobe-finned fish, with a neck, flexible wrists, finger bones, and thick ribs. 2. Fossil 2 is similar to a lobe-finned fish, with a neck and flexible wrists. 3. Fossil 3 is similar to a lobe-finned fish, with a neck. 4. Fossil 4 is appears to be an amphibian lacking scales, with a neck, flexible wrists, finger bones, and thick ribs. Put these fossils in order based on depth, from deepest to most shallow

3,2,1,4

Animals first emerged from the water onto land about ____ million years ago.

375 to 385

If a flood causes the death of 50% of small mammals, which population would exhibit the most loss of genetic diversity in its future generations?

60 mammals (Answers: 60 mammals 6000 mammals 60000 mammals 600 mammals)

Which has made the biggest impact on future generations, and is therefore more evolutionarily "fit"?

A 500-year-old bristlecone pine tree that produced 100 offspring every year (A 500-year-old bristlecone pine tree that produced 100 offspring every year A 5000-year-old bristlecone pine tree that produced 3 offspring every 100 years A 5000-year-old bristlecone pine tree that produced 1 offspring every 100 years A 2000-year-old bristlecone pine tree that produced 100 offspring every 10 years)

Which bacterial phenotype would have the highest fitness if it was cultured in a medium containing antibiotics?

A highly antibiotic-resistant variant

Which of the following might explain why manatees do NOT occur in the Mediterranean ocean?

A physical barrier may exist that prevents manatees from getting to the Mediterranean Manatees that traveled to the Mediterranean may have encountered a predator for which they have no defense The waters may not be warm enough The waters may not have enough vegetation all of the above

Bottleneck effect

A type of genetic drift that occurs when population is suddenly reduced to a small number of individuals and alleles are lost form the population as a whole.

Which of the following BEST describes the current distribution of life on Earth?

The distribution of species is determined by the current habitat and climate The distribution of species is determined by the habitat and climate that prevailed millions of years ago The distribution of species is determined by where species occurred when the Earth's landmasses moved and separated from each other The distribution of species is determined by ancient and modern barriers to dispersal

Gene flow

The movement of alleles from one population to another, which may increase the genetic diversity of a population.

The unstable element _____ undergoes radioactive decay to the stable element _______. Which of the following correctly identifies the relationship between a rock sample's age, the decay process that formed it, and its isotopic composition?

The older the rock, the more particles it will have lost and the higher will be the ratio of (stable) to (unstable).

A population is described as

A. all the members of the same species living in the same area.

The severity of a bacterial infection is related to

A. the health of the patient. A. Whether or not the bacteria produce toxins. whether the bacteria have a way to avoid the immune system. all of the above

Some snakes have small remnants of legs that they now use for clasping during mating. These leg remnants are

A. vestigial characteristics.

DNA sequence homology

In the context of biology, homology is the existence of shared ancestry between a pair of structures, or genes, in different species. A common example of homologous structures in evolutionary biology are the wings of bats and the arms of primates.

Species

Individuals that reproduce are members of the same species. Viable offspring capable of reproduction as well.

Of the groups below, which has the greatest number of classified species?

Invertebrate animals

Mechanical Isolation

Mating organs are incompatible. (plants pollinated by hummingbird do not receive pollen from plants pollinated by black bee.

Scientists use genetics to trace the evolution and migration of humans. How do scientists know which populations are older than others?

Members of older populations have more genetic variability

Which of the following BEST describes the three domains of life and their evolutionary relationships?

Prokarya and archaea both consist of prokaryotic organisms, but archaea is more closely related to eukarya than it is to prokarya.

Mutation

Random event, introduces new alleles, increases diversity

Where are MOST fossils found?

Sedimentary rock

Speciation

Separation event, divergence in original population. Food. Geography.

Consider human populations living in equatorial South America, who arrived there via North America in a migration that took them from Africa, through Europe, across the Bering Land Bridge into North America, and south to their current location. How, if at all, would skin color have changed over the course of this long migration?

Skin color would have been dark in populations migrating out of Africa, lightened as populations were established in northern regions, then darkened again as populations were established in South America

A 100-nucleotide sequence of DNA from humans and five other vertebrates were analyzed, with the following results: Species A had 45 nucleotides that differed from the human DNA. Species B had 65 nucleotides that differed from the human DNA. Species C had 10 nucleotides that differed from the human DNA. Species D had 4 nucleotides that differed from the human DNA. Species E had 44 nucleotides that differed from the human DNA. Which of these species is least related to humans?

Species B

Both vitamin D and folate levels are affected by UV radiation from sunlight. Which of the following correctly explains the effects of sunlight on these vitamins?

Sunlight degrades folate but helps build vitamin D

22) Diverse organisms such as insects and mammals have very different body plans. For instance, fruit flies have mouth parts and antennae toward their anterior end (head end) and wings and specialized structures called halteres more toward their posterior end (tail end). Although humans have anterior and posterior ends of their body that are different from one another, they possess different structures on these ends than fruit flies. A group of genes called the Hox genes are necessary to set up the body plan of flies. Hox genes, with very similar sequences to those found in fruit flies, have been found in all multicellular organisms, including humans. The fruit fly Hox gene, called Hox-1, is important for development of the anterior end of fruit flies. Based on what you have learned about DNA evidence and how nature does not tend to reinvent the wheel, what would you predict about the human Hox-1 gene?

b) It is likely required for development of the anterior end of humans, even though the specific structures are different.

19) A small population of vignacious lizards (completely fictional) lives only on the southern coast of Aruba. A devastating hurricane wipes out 95% of these lizards. The surviving population no longer carries the allele that codes for rough skin. This genetic change in the population is due to which of the following mechanisms?

b. Bottleneck Effect