Biochem Exam 4 (new stuff only)

When does the Cell media Switch?

** Cell media switches in (High Lactose / High Glucose) conditions • Allolactose binds repressor protein, causing it to release DNA • RNA polymerase (RNAP) transcribes the Beta-Galactosidase gene (low levels of transcription activity)

When do cells begin growing?

** Cells start growing in (No Lactose / High Glucose) conditions • Repressor Protein Bound: gene expression is actively inhibited • RNA Polymerase (RNAP) cannot bind the promoter

What is Homologous Recombination of DNA?

** Homologous Recombination: Exchange of DNA segments that have sequence similarity • Mechanism to repair DNA as well as to trade DNA between chromosomes

Describe Mismatch Repair?

** Methyl-directed mismatch repair • Occurs shortly after DNA replication is complete • Mechanism in bacteria has been mapped but not in eukaryotes • In bacteria, DNA is methylated on adenine in the sequence GATC, which distinguishes the old strand from the new strand • MutS binds to the mismatch • MutH and MutL recognize unmethylated DNA • MutS, MutH, and MutL form a complex & MuTH nicks the unmethylated strand • An exonuclease excises a section of the DNA

Describe the new cell media conditions?

** New cell media conditions (High Lactose / Low Glucose * High cAMP) • As glucose decreases, cyclic AMP (cAMP) increases • cAMP binds CAP (a.k.a CRP, [cAMP receptor protein]) • cAMP + CRP interact with RNAP to stimulate gene expression

Describe the enzymatic activity in forming the leading / lagging strands starting from the single strand and then being unwound into 2 separate strands?

**Topoisomerase acts before these at the Parental DNA strand. 1) Helicase (acts first) - unwinds the helix 2) DNA polymerase III -- adds nucleotides to the growing strands and proofreads 3) Primase -- adds an RNA primer 4) DNA pol I -- removes RNA primer; adds DNA in place of the primer (on the lagging strand) 5) DNA ligase -- catalyzes phosphoryl-transfer reaction to join the 3' -OH and 5' -phosphate together

Describe the synthesis of the Lagging Strand in detail?

...

What are the 5 major stages of protein synthesis in E. Coli?

1) Activation of amino acids (amino acids, tRNA, Mg2+, ATP, aminoacyl-tRNA synthetases) 2) Initiation (mRNA, AUG codon, 30s / 50s ribosomal subunits, initiation factors (IF-1, 2,3) GTP, Mg 2+, N-formylmethionine-tRNA) 3) Elongation (functional 70s ribosome - initiation complex), aminoacyl-tRNAs, elongation factors (Ef-Tu, EF-Ts, EF-G, GTP, Mg2+) 4) Termination and Release -- termination codon in mRNA, release factors (RF-1,2,3) 5) Folding and Posttranslational Processing -- specific enzymes, co-factors and other components for removal of initiating residues and signal sequences, additional proteolytic processing, modification of terminal residues and attachment of phosphate...

How do proteins recognize specific DNA sequences?

1) Amino acid side chains contact functional groups in nucleotide bases 2) Proteins for hydrogen bonds with nucleotide bases [Nucleoside + Protein]... E.g. Amino Acid + Nitrogenous base 3) Most proteins bind the DNA major groove (A-T, T-A, C-G) all bind to major groove... G-C binds to minor groove 4) Proteins have polypeptide motifs that recognize specific nucleotide sequences (recognize helix)

Describe the types of DNA Repairs and what they act on?

1) Base-Excision Repair -Single-strand break, single-base damage 2) Nucleotide Excision Repair -Bulky lesions, crosslinks 3) Direct Repair -O6MeG 4) Mismatch Repair -Mismatch 5) Homologous Recombination or Non-Homologous End-Joining -Double-strand break

What are some specific Telomere Sequences?

1) Ciliates: TTGGGG 2) Flagellates: TTAGGG 3) Fungi: TG(1-3) 4 Nematodes: TTAGGC 5) Plants: TTTAGGG 6) Vertebrates (Human): TTAGGG • Telomere sequences are repeated between 50-30,000 times.

Review: Describe promoters in Eukaryotes?

1) Core Promoter 2) Promoter Proximal elements • Core Promoter: typically within 50 base pairs upstream of the start site... Contains the initiator sequence (spans the transcription initiation site) and the TATA box. The TATA box is located at around -30... • Promoter Proximal Elements: upstream of the TATA box, ~50-200 base pairs upstream of the initiation site. Activators are regulatory proteins that control transcription initiation.

Describe the promoters in Eukaryotes?

1) Core promoter (directly upstream) 2) Promoter Proximal Elements - (further upstream of start site) • Core promoter: Typically within 50 base pairs upstream of the start site... Contains the initiator sequence (spans the transcription initiation site) and the TATA box. The TATA box is located at about (-30) • Promoter-proximal elements: Upstream of the TATA box, ~50-200 base pairs upstream of the initiation site. **Activators** are regulatory proteins that control transcription initiation. (Transcription Factors)

Describe the steps involved in DNA Transcription?

1) DNA ---> RNA Polymerase 2) RNA Polymerase ---> non-coding RNA OR 2) RNA Polymerase ---> mRNA 3) mRNA -----> Ribosome 4) Ribosome ----> Protein ** DNA transcription makes proteins

** Genome instability leads to disease; cells have mechanisms to deal with Genome Instability (describe)?

1) DNA Polymerase I -- fill in small gaps of DNA E.g. Disease = BRCA 1 - potentially lead to breast cancer

Describe the synthesis of the leading strand?

1) DNA is opened, unwound, and primed • Primase synthesizes RNA primer • Topoisomerase relieves twisting forces, • Helicase opens double helix • Single-strand DNA binding proteins (SSBP) stabilize single strands) 2) Synthesis of leading strand begins • Sliding clamp holds DNA polymerase in place • DNA polymerase works in 5' ---> 3' direction, synthesizing leading strand ** Leading strand synthesis is continuous; much more simple than synthesizing the lagging strand.

Describe the chemically induced mutation (Nucleotide Base Alkylation)?

1) DNA methylation: only a methyl group is added 2) DNA alkylation: either a methyl or ethyl group is added 3) The position of at which the methyl (or ethyl) group is added is CRITICAL! • DNA methylation: nucleotide base pairing is unaffected • DNA alkylation: can disrupt nucleotide base pairing; causing mutations **Base pair hydrogen bonding can be disrupted by DNA alkylation and lead to mutations (incorrectly paired DNA)

How fast is the speed of DNA replication (examples)?

1) E. Coli -- Fork Speed (30 kb/min) -- S-Phase (40 min) -- Origins (1) -- S-phase is longer than doubling time 2) Yeast -- Fork Speed (3 kb/min) -- S-Phase (20 min)--- Origins (330) -- S would last 80 hours if only 1 origin 3) Human -- Fork Speed (3 kb/min) -- S-Phase (7 hours) -- Origins (> 10,000) -- S-phase would last 1 year if 1 origin

Describe the 3 steps of regulation through Activation?

1) General Transcription Factors 2) Activators 3) Coactivators

Describe the lecture summary large scale genome dynamics?

1) Genome variation through genetic recombination a. Sequence specific ("site-directed") recombination tyrosine recombinases and serine recombinases b. Genetic transposition -DNA transposons, as well as retrotansposons and retroviruses 2) Recombination at work -Biotechnology, immune response, diseases (e.g. cancer, AIDS), evolution E.g. V (D) J recombination

What are the key enzymes that initiate replication?

1) Helicase: bind to origin and disrupt hydrogen bonds, denaturing DNA 2) Primase: synthesize short RNAs that prime DNA polymerase 3) Relieves strain caused by denaturing DNA

Describe the 2 types of Transcription Termination?

1) Intrinsic • Relies on the nucleotide sequence only • RNA "hairpin" followed by a string of UUU's (uracil string) • The hairpin is when the base pairs hydrogen bond to themselves creating a loop and a "kink" in the strand 2) Rho-Dependent • Relies on the nucleotide sequence an Rho, an ATP-dependent RNA/DNA Helicase • If the Rho site on RNA is exposed, Rho helicase will bind and move the nacent RNA toward RNA polymerase. Rho will melt the DNA-RNA hybrid. (RNA and DNA form a hybrid at the site of new RNA synthesis)

Describe Avery's Transformation Experiment (Simplified)?

1) Lyse IIIS Cells... Obtain a mixture of DNA, RNA, and protein 2) Add DNase 3) RNA & protein remain 4) Add to IIR bacteria 5) Plate on growth medium 6) No IIIS colonies observed 7) IIR Present

What are some chemically induced mutations?

1) Nucleotide Base Alkylation 2) Nucleotide base deamination 3) Depurination 4) Pyrimidine Dimers

Describe the step of Initiating DNA replication?

1) Parent / Template strands separate by Topoisomerase, which utilizes a tyrosine kinase and breaks the covalent bond of the sugar backbone ** Begin with DNA primase + Helicase enzymes... • Helicase: Bind to origin; denature and "unwind" DNA • Primase: Synthesize short RNAs that initiate "prime" replication • Prokaryote: Single origin • Eukaryote: Multiple origins

Describe the synthesis of the Lagging Strand?

1) Primer added 2) First fragment is synthesized 3) Second fragment is synthesized 4) Primer replaced 5) Gap closed ** Lagging strand synthesis is discontinuous; requires a few more players and steps.

What are the general chemical components of a Nucleotide? (3)

1) Purine or Pyrimidine base (1' end) 2) Phosphate (5' end) 3) Pentose Sugar

Describe more information in regards to RNA polyermase?

1) RNA polyermase synthesizes RNA polynucleotides using a single-stranded DNA template 2) RNA polymerase is capable of initiating RNA synthesis de Novo, and the DNA sequences required for transcription initiation are called (PROMOTERS)

Describe the steps in binding and initiation in transcription? (prokaryotic RNA synthesis overview)

1) RNA polymerase binds DNA promotor (specific sequences for RNA polymerase to recognize along the strands) -- (promoters are "A/T rich") -Local denaturation at promotor 2) Polymerase synthesizes RNA based on DNA sequence [DNA serves as the template] -RNA synthesis 3) DNA sequence signals the END of RNA transcription -Sigma is released and RNA polymerase moves off the promotor

What are the 2 "flavors" that Nucleic Acids come in?

1) Ribonucleic Acid -- has [OH] hydroxyl group on 2' carbon 2) Deoxyribonucleic Acid -- has [H] group on the 2' carbon

How can we use the genetic code to decipher single nucleotide mutations (3 mutations)?

1) Silent Mutations: change the mRNA sequence to a synonymous codon and therefore have no affect on the resulting polypeptide E.g. (UUA ---> UUG) both code for Leucine 2) Missense Mutations: change the mRNA sequence from a codon for one amino acid to a codon for a different amino acid, changing the polypeptide sequence... E.g (UUA ---> UCA) converts Leucine ---> Serine 3) Nonsense Mutations: change the mRNA sequence from a codon for an amino acid to a stop codon, terminating translation and resulting in a truncated polypeptide... E.g. (UUA ---> UAA) converts Leucine ---> stop codon

Match the biochemical technique with the statement?

1) Size Exclusion Chromatography -In this purification technique, the largest protein are eluted first 2) Polyacrylamide Gel Electrophoresis -This technique is used to visualize proteins 3) Ion Exchange Chromatography -In this purification technique, positively charged amino acids will bind to a negatively charged column, and NaCl is used to elute the bound proteins 4) Affinity Chromatography -Antibodies are often utilized in this purification method

Describe sequential phosphoryl-transfer reactions mediated by Tyrosine Recombinase?

1) Synaptic complex (with catalytic tyrosine (Y) in enzyme -STEP 1: Tyrosine OH attacks Phosphoryl group 2) Transesterification step 3) Holliday Junction ("cleave of bottom strands) --> 5' OH from opposite strand attacks the Phosphoryl group 4) Transesterification step to yield final rearranged product in step 5 [bottom strand exchanged to finish recombination, strands are joined] **Recombinase catalyzes phosphoryl-transfer reactions during homologous recombination

Describe the lecture summary of Translation? (Overview of Translation)

1) Translating genetic information to synthesize proteins a. Genes encode polypeptides b. Genes and mRNAs code for the order in which amino acids are assembled into a polypeptide chain. •3 nucleotides comprise a codon •Codon defines the polynucleotide "reading frame" •Codons are universal, but codon frequency varies b/w organisms •Translation initiation codon: AUG •Translation termination codon: UAG, UAA, UGA c. Role of tRNA in polypeptide synthesis... •tRNA adapter molecules are "charged" by amino acyl synthetases, which attaches an amino acid to a tRNA d. Nucleoprotein ribosome complex coordinates translation... • Initiation complex: 30S ribosome, mRNA and (f)Met-tRNA • Elongation: enzymatic rRNA catalyzes peptide bond formation • Termination: stop codon recruits release factors

What are the different patterns of DNA exchanged mediated by Serine and Tyrosine Recombinases?

1) Tyrosine Recombinase -- 2 sequential single strand breaks 2) Serine Recombinase -- 2 simultaneous double strand breaks

Describes Transcription in bacteria; what are the 3 regions of a gene?

3 Regions of Gene 1) Promoter -- (+1), transcription initiation site 2) RNA coding sequence (middle segment in positive region) 3) Terminator -- transcription termination site (most positive value) **Upstream is to the left of promotor; downstream is to the right of promotor ** From left to right the Non-template strand reads 5' ----> 3' and the Template strand reads 3' ---> 5'

Which of the following would be most likely found exposed on the outside of a cytosolic protein?

Ala-Lys-Arg-Glu-IIe-His (The protonated and negatively charged side chains; not the neutral ones)

What is the Central Dogma?

DNA -----> RNA ----> Protein

Describe DNA polymerase in details?

DNA Polymerase • Requires a short polynucleotide "primer" to initiate synthesis • Uses deoxyribonucleotide 5' triphosphates (dNTPs) as substrates... (dNTPs): dATP (adenosine), dTTP (thymidine), dCTP (cytosine), dGTP (guanine) • Adds dNTPs that base pair with nucleotides in the original, "template" DNA strand • Only adds dNTPs to the 3' end of the last nucleotide in the polynucleotide strand • 3' -OH (hydroxyl group) is essential for the phosphoryl-transfer reaction that adds the new dNTP

Describe the different features (template, initiation site, 3'--->5' exonuclease and product) of DNA & RNA?

DNA polyermase (no primer) • Template: DNA • Initiation Site: RNA or DNA "primer" • 3'-->5' exonuclease: Yes • Product: the product is DNA -- replicates entire genome... Both DNA strands replicated simultaneously RNA polyermase (has a primer) • Template: DNA • Initiation Site: DNA promoter • 3'-->5' exonuclease: No • Product: the product is RNA -- transcribes subset of genome... Both DNA strands can serve as a template, but only one strand at a time is transcribed

True or False: Methylation of cytosine at the 5' position results in a mutation...?

FALSE ** It will not interfere with the bonding at the 5' position... *The interference in bonding occurs in the Anti-Anti bonding pattern (Watson-Crick)

True or False: Serine recombinases generate a Holliday junction intermediate.

False. • Serine recombinases cut 2 double-stranded DNA molecules simultaneously and mediate a switch of the cut double-strands. • No Holliday intermediate is generated, or necessary

True or False: During DNA replication, DNA polymerase will recognize depurinated guanosine in the template strand and pair it with Cytosine in the new strand.

False. • There is no base to dictate which nucleotide should be incorporated in the new strand.

Identify the sequence containing a transversion mutation... The wild-type sequence is GCGATA?

GCGATA CTCTAT **The transversion mutation occurred in the 2nd base-pair where the expected Guanine in the 2nd sequence should be bound to Cytosine however it transferred to a Thymine... *This is a purine -> pyrimidine transfer = Tranversion

Describe the transfer of genetic information?

Gene: a unit of hereditary information that contributes to a particular characteristic of a cell or organism • Parent (P) generation • F1 (filial generation) • F1 x F1 cross (self-cross) • F2 generation (mix of original parent generation)

What can you conclude from the Hershey-Chase experiment?

Hereditary material is heat-resistance and can be transferred from one bacterial cell to another.

Describe the bacterial replisome?

If DNA was 1 meter in diameter (Bell & Baker)... • The replisome would be the size of FedEx Truck • Truck traveling ~375 mph [Travel Boston --> NYC in 40 minutes) • Replication truck would proceed at an average of 106 miles without making an error • A smaller FedEx truck (primase) would have to link up with the large one every 0.1 miles (once per second) to deliver an RNA primer

Describe an immunoblot?

Immunoblot: proteins from a sample are subjected to electrophoresis, separating the proteins in the sample by size and charge. An antibody raised against your protein of interest is used to visualize changes in protein levels... *What translational machinery may be at work here... Click questions follow.

Who shared the Nobel Prize for solving DNA double helix structure?

James Watson, Francis Crick & Maurice Wilkins

Describe how DNA is constantly under assault?

Mechanisms of DNA assault (Damaging Agents) 1) X-ray -- oxidative radicals, single-strand break 2) UV-light -- bulky adduct addition 3) X-ray -- anti-tumor agents / inter-strand cross-link, double strand break 4) Replication errors -- A-G mismatch, I-C mismatch, insertion, deletion Response (Repair) 1) Base-excision repair (BER) 2) Nucleotide-excision repair (NER) 3) Recombination Repair 4) Mismatch Repair Consequences on Genome • Transient cell-cycle arrest • Apoptosis -- cell-death (inhibition of transcription, replication, chromosome segregation) • Mutations (chromosome aberrations) -- cancer aging inborn diseases

Describe the Beadle and Tatum experiment (1941)?

Metabolite A ---> Metabolite B ---> Metabolite C -----> Metabolite D enzyme 1 enzyme 2 enzyme 3 • Control cells: all 3 enzymes are functional • Cells grow on media that has JUST metabolite A Experiment - X-rays ** Cell exposed to X-rays induce genetic mutations (mutant cells isolated) • Media contains metabolite: cells only grow on media with the metabolite C or D

Does mismatch repair function during the late G2 Phase?

No, mismatch repair does not occur during the late G2 phase... •Mismatch repair relies on distinguishing the template strand from the new strand (e.g. following replication recognizing the methylated strand from the template strand)

Describe the Meselsen-Stahl Experiment?

Original DNA ---------- After one round of replication 1) Semiconservative --- 1 strand of each, interweave 2) Conservative --- keep strands separate 3) Dispersive --- Intermingling of strands • Experimental Conditions: 1) E. Coli start growing in Radioactive Nitrogen labeled media (heavy N) - N15 2) E. Coli transferred to (N14 -- light N) • Determined that the DNA was semiconservative (hybrid)

Enzymes important to know in DNA synthesis / replication?

Primase: lays down RNA primase primer DNA Polymerase 3: fastest polymerase DNA Polymerase 1: Okazaki fragments Helicase: Unwinds the strands SSBP: keep binding proteins separated DNA ligase: Ligation Topoisomerase/Gyrase: relieves tension / supercoiling

What are the heterocyclic bases of nucleosides?

Pyrimidines 1) Cytosine 2) Thymine (DNA) 3) Uracil (RNA) Purines 1) Adenine 2) Guanine

Describe the structure of RNA and the key differences from DNA?

Ribonucleic Acid (RNA); key differences from DNA... 1) The sugar is RIBOSE: hydroxyl group at the C2' position vs. H 2) RNA is typically single stranded 3) RNA is multi-functional: protein synthesis, gene expression, enzyme • RNA utilizes the nitrogenous base Uracil • DNA utilizes the nitrogenous base Thymine

What are the ribonucleosides vs. deoxyribonucleosides?

Ribonucleosides 1) Adenosine 2) Guanosine 3) Uridine 4) Cytidine Deoxyribonucleosides 1) Deoxyadenosine 2) Deoxyguanosine 3) Deoxythymidine 4) Doexycytidine

What are the ribonucleotides vs. deoxyribonucleotides?

Ribonucleotides 1) Adenylate 2) Guanylate 3) Uridylate 4) Cytidylate Deoxyribonucleotides 1) Deoxyadenylate 2) Deoxyguanylate 3) Deoxythymidylate 4) Deoxycytidylate

Which sequence is more likely to "melt" at a lower temperature?

T-A, A-T, T-A, A-T, T-A, A-T, T-A • (The sequence with more Adenine and Thymines will melt more quickly because it has a lower melting temperature; degrade more quickly with less Hydrogen bonds)

Describe the steps of Telomerase activity after replication? (a-g)

Telomerase Activity After Replication... a) Chromosome end after primer removal (Overhang on the 3' end) b) Binding of Telomerase to the overhanging 3' end of the chromosome (RNA template for new telomere repeat DNA) c) Synthesis of new telomere DNA using Telomerase RNA as template (NEW telomere DNA synthesized to lengthen the first strand) d) Telomerase movement to the 3' end of the NEWLY synthesized telomere DNA (elongating the 3' strand) e) Further lengthening of the First strand by synthesis of new Telomere DNA f) Chromosome end after telomerase leaves, DNA synthesized by 2 rounds of telomerase activity (yields a chromosomes with enough space for the normal replication machinery to act) g) Final Product: Leaves a new end of the chromosome after replication and primer removal, with overhang on the 3' end of the chromosome (first strand) and an Elongated 5' end of the chromosome due to the Telomerase activity (replication)

Describe Transposable Elements in Drosophila?

Transposable Elements in Drosophila • About 15% of their genome is mobile • P elements are a family of transposable elements • P elements are manipulated by geneticists to deliver genes to Drosophila embryos

True or False: Promoters Integrate both Positive and Negative Signals.

True. • DNA strand has Activator and Repressor binding sites with the Promoter region in between... These binding sites are the regulatory sequences... Further upstream the genes are transcribed as a unit.

True or False: The codon table is virtually universal... For example: GCG codes for Alanine in humans, as well as fruit flies, jellyfish, bacteria, slime mold and all other organisms.

True. • The only exceptions are some mitochondrial genes, stop codons in a couple unicellular organisms and non-standard amino acids

True or False: Transcription occurs using both DNA strand as a template?

True. • Transcription occurs using both DNA strand as template ** DNA sequences signal start and end of transcription

True or False: DNA packaging modulates gene expression?

True. DNA packaging modulates gene expression

Do you predict that adding an ethyl at position O6 on Guanine will result in a mutation?

Yes, O6-ethylguanine will result in a mutation... • Mutagen EMS will result in O6-Ethylguanine bound to Thymine... •This type of mutation is a Transition mutation, Pyrimidine --> Pyrimidine.. [Cytosine ---> Thymine transfer] ** Guanine alkylation is associated with several human cancers.

Describe in depth the Meselsen-Stahl Experiment?

a) Heavy DNA (N15) --- Original Parent molecule b) Hybrid DNA (N15 + N14) --- First generation daughter molecules c) Light DNA (N14) + Hybrid DNA --- Second generation daughter molecules

Describe the processes of Transcription in Bacteria?

a) In initation, the RNA polymerase holoenzyme first recognizes the promoter at the -35 region and binds to the full promoter b) As initation continues, RNA polymerase binds more tightly to the promoter at the -10 region, accompanied by a local untwisting of the DNA in that region. At this point, the RNA polymerase is correctly oriented to begin transcription at +1 c) After eight to nine nucleotides have been polymerized the sigma factor dissociated from the core enzyme d) As the RNA polymerase elongates the new RNA chain, the enzyme untwists the DNA ahead of it, keeping a single-stranded transcription bubble spanning about 25 base pairs. ABout 9 bases of the new RNA are bound to the single-stranded DNA bubble, with the remainder exiting the enzyme in a single-stranded form.

Describe how Mutations can affect the transfer of genetic information?

a) Replication errors and/or DNA damage can result in mutations b) Common Types of Mutations Include: • Transitions: purine-to-purine, or pyrimidine-to-pyrimidine change • Transversions: purine-to-pyrimidine or pyrimidine-to-purine change • Small deletions or insertions: may cause a codon "frame-shift" • Large deletions or insertions, inversions, or chromosome fusions c) Repair Mechanisms include: • Proofreading and mismatch repair (both use 3'-->5' exonucleases) • Base-excision repair • Direct repair • Nucleotide-excision repair

What is important about the ends of chromosomes?

a) Schematic diagram of DNA of parent chromosome... (5' ---->3') b) After semiconservative replication, new DNA strands have RNA primers at their 5' ends & 1 new DNA stand c) RNA primers are removed, leaving single-stranded overhangs at telomeres because DNA polymerase cannot fill them in... (overhang is on the 3' end at telomeres)

Describe the Shine-Dalgarno Sequence that aids in the initiation of translation in prokaryotes?

a) Sequence at 3' end of 16S rRNA b) Example of sequence upstream of the AUG codon in an mRNA pairing with the 3' end of the 16S rRNA... upstream of initiation (AUG) codon)

Describe E. Coli (prokaryotes) as it relates to RNA polyermase and transcription?

a) The E. coli sigma 70 holoenzyme is a well-studied RNA polymerase. The holoenzyme is composed of a CORE enzyme and an additional subunit called (Sigma), which provides initiation specificity. The core enzyme can catalyze the elongation reaction, but it can not initiate RNA synthesis b) Alternative sigma factors: E. coli has other sigma factors. Each type of sigma factor gives the holoenzyme a unique transcription initiation specificity Eukaryotes a) Eukaryotes have 3 forms of RNA polymerase: each type has its own initiation specificity (recognizes different DNA sequences as promoters)

Which region of DNA is more transcriptionally active?

• "Beads on a string" is more transcriptionally active (the nucleosome)

Describe what Francois Jacob and Jacques Monod said in 1961 and their experiments?

• "Fundamental problem of chemical physiology and of embryology is to understand why tissue cells do not all express, all the time, all of the potentialities inherent in their genome" • Why does cell growth pause when cells are switched between media?? (See a LAG IN CELL GROWTH when switching between glucose and lactose)

Describe the chemically induced mutation (Pyrimidine Dimers)?

• 2 neighboring pyrimidines such as "neighboring thymines" have hydrogen bonds to adenine and the H-bonds are disrupted because the Pyrimidine Dimers create a "KINK" in the DNA

Which of the following statements regarding Hemoglobin is Incorrect?

• 2,3 BPG increases the binding affinity of Hb for O2... This is not true because 2,3 BPG decrease the binding affinity of Hb for O2 and aids in cooperativity & unloading of O2.

We have now covered enzymatic reactions catalyzed by 2 amino acids (tyrosine (topoisomerase, recombinase) and serine (recombinase)... What do Tyrosine & Serine have in common that is key to their catalytic activity?

• A hydroxyl (-OH) serine + tyrosine hydroxyl initiates nucleophilic attack

A majority of cancer cells express what type of enzyme?

• A majority of Cancer Cells express Telomerase.

Describe initiation of eukaryotic translation?

• AUG is found via scanning (no Shine-Dalgarno) -40 S ribosome attaches the 5' and 3' mRNA ends to make a coiled closed loop

How does base pair hydrogen bonding and base stacking affect DNA denaturation?

• Adenosine & Thymine denature more quickly (2-Hydrogen bonds); less stable molecules • Guanine & Cytosine denature less quickly (3-Hydrogen bonds); more stable molecules • (Tm) -- Temperature (melting) - 50% of polynucleotide strand denaturation is affected by: 1) Non-polar solvents (disrupt stacking) 2) Cations (shield phosphate charges) 3) pH mismatches (destabilizes double strand) • Promoter region will degrade more rapidly than other regions of the cell... (higher concentrations of Adenosine & Thymine)

Describe the chromosome after replication?

• After replication, there is the chromosome end left after primer removal... which has an overhand left from the primer removal... The overhang is on the 3' end of the chromosome.

Describe the process of elongation?

• All 3 tRNAs are bound at their anticodons to the corresponding mRNA codon - The A site of the ribosome is the Acceptor site for an aminoacyl tRNA - The P site is where a Peptide bond forms that adds an amino acid to the growing polypeptide chain - The E site is where tRNAs no longer bound to an amino acid exit the ribosome **rRNA catalyzes the formation of a peptide bond between the amino acids bound to tRNAs at P & A sites

Allolactose signals _______ expression and _____________ production?

• Allolactose signals lacZ expression and Beta-Galactosidase production ** lac-Z gene encodes Beta-Galactosidase * Allosteric binding of Allolactose to the Operator (repressor gen) which turns on the pathway... however, if the allosteric binding site is not occupied then it will not turn on... -RNAP = prooter

Describe the process of Aminoacylation of tRNA by tRNA synthetase?

• Amino acids are loaded onto specific tRNAs by aminoacyl-tRNA synthestase 1) Amino acid is adenylated 2) 2 Classes of aminoacyl-tRNA synthetases (2' OH initiates attack / 3' OH initiates attack) 3) Class 1: additional step adds amino acid to 3' OH Class 2: amino acid added directly to 3' OH • First step is the amino acid is activated by the adenylation of the carboxyl group... alpha-Carboxyl of amino acid attacks alpha-phosphate of ATP, forming 5' aminoacyl adenylate • Aminoacyl tRNA synthetase then selects the matching tRNA and "charges" it, transferring the amino acid to the tRNA 3' OH ** Charged tRNA is ready to add an amino acid to the growing polypeptide

Describe the process of adding an amino acid to tRNA?

• Aminoacyl-tRNA synthetase adds the correct amino acid to the tRNA • 1 amino acyl-tRNA synthestase for each amino acid (20 total enzymes) • The amino acid is attached to the 3' end of the tRNA

What was Crick's Adaptor Hypothesis?

• An adaptor translates nucleotide sequence into a polypeptide protein • The molecular identify of an adaptor is: [tRNA] • The nucleotide triplet coding for an amino acid is transported by mRNA in a sequence of 4 different nucleotides and it codes for a specific amino acid utilizing an adaptor to translate the sequence into a polypeptide (~20 different amino acid protein)

What does Beta-DNA conformation allow, that makes it the most common?

• B-DNA conformation allows proteins to contact nucleic acid bases

Describe the process of Excision Repair?

• Base Excision repair: -Repairs depurination and deamination -A glycosylase cleaves the bond between the base and sugar -Other enzymes cleave the sugar phosphate backbone of nearby residues -DNA polymerase 1 and DNA Ligase fill in the gaps

Describe the difference between "Base Pairing" vs. "Base Stacking?"

• Base Pairing: utilizing Hydrogen bonds to bind nucleotides (purine binds with pyrimidine • Base Stacking: critical for polynucleotide strand stability; Van der Waals forces, electrostatic interactions (Essentially, layering of base-pairs)

An mRNA transcript can have many AUG codons in different frames... How is the translation start codon found?

• Base pair interactions between the mRNA and rRNA

How does DNA polymerase repair base pair mismatches?

• Base pair mismatches caused by Base Tautomers (rearrangements) are repaired by DNA polymerase ** The hydrogen bonds are rearranged and can cause problematic (rare forms of bonding; anomalous base-pairing arrangements)

Describe the metabolic pathways and the central dogma?

• Begin with Phenylalanine which can be converted to Tyrosine (if not appropriately can result in PKU)... Tyrosine can be converted to Thyroxine and DOPA (if not appropriately can cause Albinism)... DOPA ---> Melanin • Tyrosin and also have a reaction chain which leads to Alkaptonuria and people with this disease excrete Homogentisic Acid (HA) in their urine... If someone doesn't have the enzyme that metabolizes HA you will have Alkaptonuria

Where does DNA glycosylase cleave DNA?

• Between the base and the ribose

Provide more information about General Transcription Factors?

• Bind to the promoter • Recruit RNA polymerase II • Basal level of transcription • TFIID binds to the TATA box

tRNA and its amino acid are linked by a bond that forms between the tRNA ______ and the amino acid ________?

• Bond forms between the tRNA 3' OH & amino acid carboxylic acid

Based on the results below which enzyme is missing... (C+D have metabolites / cells growing on media)

• Cells only grow on media with C or D... thus cells lack the functional enzyme 2 that converts B ---> C • Gene mutation leads to loss of enzyme 2 • Conclusion: genes encode proteins

Describe Charged tRNA?

• Charged tRNA utilizes charges on the amino groups and the phosphate groups as well as possibly on the R groups... • Amino acid attached by carboxyl group to ribose of last ribonucleotide of tRNA chain • Last 3 nucleotides of all tRNAs are -CCA-3'

Describe what is meant by chromatin remodeling?

• Chromatin Remodeling aids in transcriptional activation by altering chromatin structure in promotor regions. • DNA packaging modulates gene expression 1) Lysine Acetyltransferases (KATs) • Also known as (HATs) • Acetylate histones -- will disrupt binding linkage of DNA + histones/proteins • Are generally associated with GENE ACTIVATION 2) Histone Deacetylases (HDACs) • Remove acetyl groups • Restore the 30nm fiber • Are generally associated with GENE INACTIVATION

What are Chromosomes comprised of?

• Chromosomes are comprised of Chromatids •Chromatid --[DNA Replication]---> Pair of Chromatids •Sister chromatids have homologous sequence... **The same location on the sister chromatids have the same sequence. E.g. Sister Chromatids --[DNA Replication]---> Sister chromatid Pairs

What enzyme closes the nicks in the lagging strand with DNA ligase?

• Closing the nicks in the lagging strand with DNA Ligase 1) DNA ligase picks up AMP... (adenyltlation of DNA ligase) 2) AMP transfer activates phosphate (activation of 5' phosphate in nick) 3) DNA ligase catalyzes phosphoryl-transfer reaction to join 3' -OH and 5' phosphate (displacement of AMP seals nick)

Codon-anticodon base pairing impacts which process?

• Codon-anticodon base pairing impacts translation For example: group 2 strong base pairs with 1 wobble base pair • Strong base pairs / coding specificity • Wobble base pair / coding flexibility • The nucleobase I = Inosine, which contains hypoxanthine is (deaminated adenosine)... loses the double bonded oxygen and changes up the bonding arrangements with other nucleobases. (I-A), (I-T), (I-C)

What do coiled double-stranded DNA form that allow DNA to compact?

• Coiled Double-stranded DNA form supercoils that compact DNA • Relaxed strands are not as coiled tightly for packaging; however the supercoils can be compacted to fit large amounts of a genome into a small cell • Supercoiling compensates for structural strain caused by changes in DNA strands... • For example: The Relaxed Strand must make 8 turns, whereas the Supercoiled DNA allows for strand separation and takes 1 less turn

What is the Co-linearity of mRNA and protein synthesis?

• Colinearity of mRNA and protein synthesis is that the direction of translation & transcription occur in the same direction. ** Colinearity is the concept that nucleotide sequences in genes dictate amino acid sequences in proteins.

Provide more information about Activators?

• Contain a DNA binding domain & a transcription activating domain • Most function as monomers or dimers • Binds to particular DNA sequences 3 Examples of Activators a) Helix-turn-helix b) Zinc Finger c) Leucine Zipper

Describe genes regulated by steroids?

• Contain a DNA sequence that the steroid-receptor complex recognizes -- Steroid Hormone response elements (HREs) • Located in promoters usually within 1kb of the transcription start site • Most genes contain multiple HREs

Describe the chemically induced mutation (Nucleotide Base Deamination)?

• Cytosine ---> Uracil • Adenine ---> Hypoxanthine • 5-Methylcytosine ---> Thymine • Guanine ---> Xanthine ** Thymine cannot be Deaminated Reaction steps in Nucleotide Base Deamination 1) H2O attacks -NH2 2) Lone pairs from other Nitrogen kick -NH2 + H off, released -NH3 3) Tautomerization of group forms final product ** Nucleotide base deamination allows Non-Standard base pairing

What enzyme has a 3'-5' exonuclease that "proofreads" new DNA strand?

• DNA Polymerase has a 3'-5' exonuclease that "proofreads" new DNA strand • Nucleotides are added to the growing strand... • Polymerase has fingers, thumb and exonuclease (Exonuclease is 3'-5' and proofreads new DNA strand)

What types of bonds do DNA bases form with each other?

• DNA bases for Hydrogen bonds with each other; this is called "Base Pairing" • E.g. Adenine (A) ---- Thymine (T) Guanine (G) ---- Cytosine (C) • Purines bind with pyrimidines

What are some facts about the actively expressed gene?

• DNA denatures at start of the gene before it is expressed • Lower melting temperature facilitates DNA denaturation • Denaturation lets transcription machinery access DNA • DNA is also denatured during genome replication ** Local DNA denaturation can occur in specific regions of the DNA molecule

Describe how deaminated or depurinated bases can be removed through base-excision repair?

• DNA glycosylase first cleaves the bond b/w the base and sugar which leads to the Damaged base leaving and yields an "abasic site" in which [AP endonuclease] can get grid of the damaged base...Then DNA polymerase 1 works with NTPs and to create new DNA + nick and [DNA Ligase] works to finish off the job.

Which molecule is transmitted, DNA or Protein? (Who's experiment was this)

• DNA is Transmitted, NOT protein 1) Protein coats of phages are radioactively labeled 2) Phages infect bacteria with genetic information 3) No radioactivity enters cell 1) DNA of phages is radioactively labeled 2) Phages infect bacteria with genetic material 3) Radioactivity enters cell ** Hershey-Chase Experiment (1952)

Which nucleotide molecule is more stable, DNA or RNA?

• DNA is molecularly more stable than RNA • The hydroxyl (OH) group on RNA is prone to Hydrolysis and makes it molecularly less stable than DNA which has a (H) attached at the same 2' position

Describe how DNA is packaged?

• DNA is packaged in an extremely tightly coiled fashion that exhibits an elaborate packaging mechanism • DNA is able to fit long lengths of a genome into an extremely tiny cell through an extensive folding mechanism E.g. (E. coli bacterium genome is 1.7 mm which fits inside the cell that is 0.002 mm

Why does DNA wrap around a histone?

• DNA is wrapped around histone proteins to generate a nucleosome. • Nucleosomes are further packaged into a 30nm fiber • The storage form of Genomic DNA is Chromosomes E.g. [E. Coli chromosome: circular, no histones, no nucleosomes] [Human Chromosome: linear histones, nucleosomes] • 1 trillion cells & nuclei • Each nuclei contrains 46 chromosomes • Each chromosome contains 50-100 x 10^3 genes • 30 nm fiber that contains nucleosomes • Roughly ~ 3 billion DNA base pairs

During E. coli DNA replication, which enzyme removes the RNA primer?

• DNA polymerase 1 removes the RNA primer during E. coli DNA replication

What proofreads the new DNA strand?

• DNA polymerase has a 3'--->5' exonuclease that "proofreads" the new DNA strand (in the opposite direction that the new strand is being produced) • DNA polymerase "proofreading" activity is essential for replication fidelity Example of how "Proofreading" Sequence Works: 1) C* is a rare tautomeric form of cytosine (C) that pairs with A and is incorporated into the growing strand 2) Before the polymerase moves on, the cytosine undergoes a tautomeric shift from C ---> C*... The new nucleotide is now mispaired 3) The mispaired 3' -OH end of the growing strand blocks further elongation. DNA polymerase slides back to position the mispaired base in the 3'--->5' exonuclease active sites 4) The mispaired nucleotide is removed... DNA polymerase slides forward and resumes its polymerization activity. (Mispaired nucleotide removed by hydrolysis of phosphodiester bond)

What does DNA polymerase synthesize?

• DNA polymerase synthesizes two new polynucleotide strands • DNA polymerases ONLY work in the 5' ---> 3' direction • Synthesizes both the "Leading & Lagging" Strands that are both in the 5' ----> 3' orientation

During E. coli DNA replication, what would happen if Helicase was defective?

• DNA replication would NOT begin

Describe the topological properties of DNA?

• DNA topological properties are changed ONLY when one or both strands of DNA are cleaved and rejoined • Topisomerases cut DNA to release physical tension (DNA transcription)

Single or Double-stranded DNA can denature into what?

• Double-stranded DNA can denature into 2 polynucleotide strands • Transition between double-stranded and single-stranded states are affected by: 1) Temperature 2) Solution conditions (e.g. pH)

Consider the following in the context of eukaryotic transcription: core promoter, 5' UTR, protein coding region, 3' UTR, enhancer region, proximal elements, 5' cap and poly A tail. Illustrate what genomic DNA looks like by indicating where in the gDNA these are located...

• Enhancer Regions (-1000s) • Promoter Proximal Elements (-200 to 50) • Core Promoter (-35 to +1) • TATA box (-30) • 5' UTR (after +1) • Protein Coding (Translation Start ATG / AUG) -- further downstream • 3' UTR -- furthest upstream (Translation Stop, TAG, TAA, TGA) **The 5' cap and Poly-A tail are NOT encoded in genomic DNA

Describe the function of an Enhancer?

• Enhancers are even further upstream of promoters, sometimes thousands of base pairs away. • Required for maximal transcription of a gene (maximum activation) -Thousands of base pairs from the start site **Beads on a string = nucleosome

Describe Integration -- HIV as an Example?

• Enveloped RNA retrovirus -"Retro": RNA is used to synthesize DNA using the protein Reverse Transcriptase • Infection process: -RNA --> cDNA (via reverse transcriptase) --> integration into the genome (via Integrase) where it forms the latent Provirus -Eventually the Provirus can produce viral proteins using ~270 host enzymes and RNA genomes to form new infectious Virions • Described as Lentiviruses -- meaning slow progression of disease ** Recombination produces Antibodies

How are enzyme levels controlled?

• Enzyme levels are controlled by the molecular regulation of gene expression. Induction: gene transcribed in response to the presence of the enzyme's substrate (e.g. Lactose operon) Repression: gene NOT expressed in response o the presence of enzymatic end product E.g. • When the Inducer is added, the concentration shoots up and when it's removed the concentration plateaus... (Adaptive regulation of Lactose operon genes)

Eukaryotes have how many RNA polymerases?

• Eukaryotes have 3 RNA polymerases 1) DNA -----> Polymerase 1, 3 2) RNA Polymerase 1,3 ----> non-coding RNA 3) Non-coding RNA ---> RNA polyermase 1 (pre-ribosomal RNA (rRNA) and/or RNA polyermase 3 (transfer RNA (tRNA), some rRNA, additional RNAs OR 1) DNA ----> Polyermase 2 2) RNA Polyermase 2 ----> mRNA 3) mRNA ---> Ribosome 4) Protein

Describe DNA packaging in eukaryotic cells: chromatin?

• Eukaryotic genomic DNA has associated, basic proteins called Histones • 5 types of Histones: [H1, H2A, H2B, H3, H4]... these all have various different functions • Genomic DNA wraps around the histones • The DNA + histone nucleoprotein complex is called a Nucleosome • Bacteria also have basic DNA binding proteins, but do not have nucleosomes.

How many ring structure conformations can Furanose take?

• Furanose ring can take 4 different conformations • Endo vs. Exo facing conformations

What is the effect of the different conformations that Furanose can form?

• Furanose ring conformation affects polynucleotide conformation • Phosphate-Phosphate Distance effects the polynucleotide chain (e.g. the length / coiling of the chain)

Looking back at Furanose Ring Conformations, how do they affect DNA structure?

• Furanose ring conformations affect Double-Stranded DNA conformation • E.g. alpha-DNA, beta-DNA, Z-DNA • Beta-DNA is the typical double stranded (C2'-endo) conformation; it is the most common form of DNA

The guanine in G/C pair becomes methylated on its oxygen. What base pair(s) will be represented at this site in the progeny cells?

• G/C and A/T

How do you generate polynucleotide chains via phosphoryl transfer reactions?

• General Reaction: original phosphoryl transfer reaction (1st slide) • Adding nucleotide: add in nucleotides to attack the triphosphate group and force Inorganic (PPi) to leave and generate the phosphorylated nucleotide w/ a new nucleotide attached.

What do genes lead to?

• Genes lead to [Heritable Traits] and ["Blueprint" for synthesizing proteins]

How does DNA sequence/structure change affect genetic information transfer?

• Genetic information transfer is affected when DNA sequence or structure is changed. • Example: *Mutation generated during genome replication is not repaired.

Describe the combination of experimental approaches to identify promoters?

• Genetics: mutations that change the frequency of transcription initiation • Biochemistry: DNA sequences that initiate transcription by RNA polymerase • Sequence comparisons: common DNa sequences found near RNA 5' end • Footprint Assays: DNA sequence bound by RNA polymerase * Upstream Promotor (higher negative values) * Promoter region (-70 to +30)

The full oxidation of glucose involves 4 processes: glycolysis, the conversion of pyruvate to acetyl-COA, TCA cycle and ETC... How many ATP, NADH, FADH2 and CO2 are produced in each process per 1 molecule of glucose?

• Glycolysis: 2Net ATP / 2 NADH • PDH Rxn: 2 NADH / 2 CO2 • TCA: 2 ATP/GTP, 4 CO2, 6 NADH, 2 FADH2 • ETC: ~25 ATP

What was a finding of the Griffith experiment that had to do with heat?

• Griffith learned that [HEAT] killed the Type III S virulent bacteria to make them nonvirulent so when the mouse was injected; the mouse survived and no bacteria were recovered. Question: What happens when Type IIR living, nonvirulent bacteria are mixed with HEAT killed Type IIIS nonvirulent bacteria and the mixture is injected into the mouse?

Describe Mismatch repair via MutL/MutS/MutH?

• Have the DNA sequence following DNA replication (methylated strand vs. unmethalated strand for enzymes to specify new vs. old strand) • MutS binds to mismatch • MutH / MutL recognized unmethylated DNA [These 3 compounds are the mismatch repair enzymes] • These enzymes + ATP work to split the DNA into 2 new segments which run parallel reactions... • Utilize ATP again + DNA Helicase II (exonuclease excises a section of DNA from new strand... "nick") -Left side reaction runs 5'-3' exonuclease -Right side reaction runs 3'-5' exonuclease • Lastly, DNA polymerase III (SSB - Single Strand Binding Protein) nicks on unmethylated strand are repaired by DNA Ligase.

Who used bacteriophages to demonstrate that DNA is transmitted into the host and not protein?

• Hershey and Chase

Describe how enzymes recognize specific DNA sequences and catalyze phosphoryl-transfer reactions?

• Homologous sequence aligns and recombinase binds

What is problematic with the Hoogsteen Base Pairing setup?

• Hoogsteen base pairing can affect the DNA Helix conformation (minor and major grooves aren't aligned as well and the distance between glycosidic bonds is decreased • Hoogsteen base pairing allows 3 or 4 DNA stands in a helix (more steric interactions)

What are human chromosomes capped by?

• Human chromosomes are capped by Telomeres • The Telomere shortening mechanism normally limits cells to a fixed number of divisions. This sets a limit on lifespans.

Describe a comparison of Genomes across species?

• Humans have the highest total number of DNA, highest total number of chromosomes (46) and approximate number of genes • Bacterium have the least of these markers (1 chromosome) • Human > mouse > plant > fruit fly > nematode > yeast >bacterium

How are hydrogen bonds between base pairs disrupted?

• Hydrogen bonds between base pairs are disrupted when DNA is denatured • The Covalent bonds remain intact (unaffected by denaturation) -- these are the bonds that link the sugar backbones of nucleotides • Hydrogen bonds are the ones that are disrupted when DNA is denatured

How are hydrogen bonds affected by temperature and solvents?

• Hydrogen bonds between bases are affected by temperature & solvent • Denaturation --> Separation of strands --> Separated strands of DNA in random coils • Separation of strands --> Association of strands by base pairing --> Annealing (recoiling of DNA strands)

Describe Avery's Transformation Experiment?

• Hypothesis: the genetic material is one of the main 5 macromolecules in the cell • Degrade each one sequentially to see when Griffith's transformation fails Macromolecule / Degradation Enzyme 1) Protein --- Protease 2) Lipids --- Lipase 3) Carbohydrates --- Amylase 4) RNA --- RNase 5) DNA --- DNase

Describe bacterial translation initiation complex?

• In bacteria (Prokaryote), translation initiation involves base pair interactions between three different RNAs. The mRNA base pairs with an RNA found in the small (30s) ribosome subunit. • This sequence helps to distinguish the initiating AUG from other AUG codons... THe mRNA AUG base pairs with the fMET-tRNA anticodon loop **Start Codon / Shine-Dalgarno sequence in mRNA base pairs with 16S rRNA

What are some causes of DNA mutations and repair mechanisms?

• Incorrect base incorporation during DNA replication...(Corrected by DNA polymerase proofreading or mismatch repair) • Chemical changes to bases in a DNA molecule 1) Base Alkylation (E.g. O6-methylguanine substitutes for adenosine) 2) Deamination: loss of exocyclic amino groups (E.g. deamination converts cytosine ---> uracil 3) Depurination: N-glycosidic bond between base and pentose is cleaved 4) Pyrimidine dimer: bond forms between adjacent T (or C) nucleotides

Describe the causes of DNA mutations and repair mechanisms?

• Incorrect base incorporation during DNA replication...(Corrected by DNA polymerase proofreading or mismatch repair) • Chemical changes to bases in a DNA molecule 1) Base Alkylation (E.g. O6-methylguanine substitutes for adenosine) -Corrected by direct repair; E.g. involving methyltransferase 2) Deamination: loss of exocyclic amino groups (E.g. deamination converts cytosine ---> uracil -Corrected by base-excision repair employing DNA glycosylases 3) Depurination: N-glycosidic bond between base and pentose is cleaved -Corrected by base-excision repair 4) Pyrimidine dimer: bond forms between adjacent T (or C) nucleotides -Corrected by Direct Repair (or nucleotide excision repair) promoted by DNA photolyases

Describe translation initiation in Prokaryotes?

• Initiation factor 3 (IF-3) aids in binding 30S to mRNA • A stretch of nucleotides in 16S pairs with the Shine-Dalgarno sequence, a sequence that indicates where translation begins • tRNA.fMet (modified form of methionine is attached to the tRNA) binds to the P site by IF-2 • The 50S unit binds • The initiation factors are released

Describe the transposable elements in Bacteria?

• Insertion Sequences (IS) -Simplest transposable element in bacteria -Contains genes required to mobilize the element -First identified in studies analyzing galactose metabolism mutants -Requires transposase to transpose • Transposon (Tn) -Larger than insertion sequences (IS) -Contains genes for insertion & other genes

What was Griffith's Transformation Experiment?

• Introducing: Streptococcus pneumonia (Pneumococcus) • Smooth Strain (Type III S) : These cells evade the mouse immune system with their "cloak" of smooth polysaccharide Result: infected mice die (virulent bacteria recovered) • Rough Strain (Type II R): These cells lack the "cloak" of protection and are targeted by the mouse immune system. Result: infected mice live (nonvirulent bacteria are not recovered)

What is the key reaction in forming a Nucleoprotein Complex?

• Key Reaction: Phosphoryl Transfer * Base deprotonates to allow a nucelophilic attack of the positively charged phosphorus, leaving group leaves and forms an intermediate which stabilizes into the Phosphoryl transferred product

What is Lactose metabolized by?

• Lactose is metabolized by Beta-Galactosidase • Lactose ---[B-Galactosidase]----> Glucose, Galactose, Allolactose (3 options of metabolism products)

Provide more information about Coactivators?

• Large, multi-protein complex, that does not directly bind to DNA • Interacts with activators and general transcription factors • Helps recruit RNA polymerase II • Some can modify chromatin structure

Describe the terms "leading and lagging" strands?

• Leading Strand (5' ---> 3'): template or parent strand -The leading strand is synthesized intact, without breaks • Lagging Strand (5' ---> 3'): template or parent strand (has a GAP at the beginning of the strand) -The lagging strand is synthesized in pieces that are joined by DNA ligase • Replication Fork: division between the Leading and Lagging strands • DNA polymerase I removes the RNA primer and adds DNA... 1 DNA polymerase acts on both the leading / lagging strands at the same time (utilizes different subunits)

What other enzyme discussed during part 4 is adenylated?

• Ligase * Adenylation of DNA ligase occurs during STEP 1 of closing the nicks in the lagging strand with DNA Ligase

What does local denaturation precede?

• Local denaturation precedes replication ** Denatured regions are rich in (A & T) -- Adenosine and Thymine

Which of the following amino acids associate with the backbone of the DNA double helix?

• Lysine and Arginine

What does not follow Mendelian Patterns of Heredity and who studied it?

• Maize pigmentation does not follow Mendelian Patterns of Heredity • McClintock could not firmly map chromosomal position of gene(s) controlling maize pigment -Genetic element kept "jumping around" 1944, 1952: experiments showing DNA is the genetic molecule 1948-early 1950's: McClintock's experiments 1953: Watson-Crick DNA model

Describe amino acids initiating polypeptide synthesis?

• Methionine: cytosolic eukaryotic ribosomes • N-formylmethionine: prokaryotic, mitochondrial and chloroplast ribosomes

Describe Direct Repair: demethylation by Oxidative Demethylation or Methyltransferase?

• Methyltransferase utilizes an enzyme and a lone pair of electrons to attack the methyl group that is disrupting hydrogen bonding, and rearrange the molecule to [Directly Repair] the molecule... Example Reaction: [O6-Methylguanine --[Methyltransferase]--> Guanine]

Describe how mismatch repair relies on distinguishing the template strand from the new strand?

• Mismatch repair relies on distinguishing new from old strand because the mismatch repair enzymes react specifically on the methylated vs. un-methylated stands... • Template strand is methylated following replication whereas the new stand of DNA is not. • After a few minutes the new strand is methylated by enzyme [Dam Methylase] and the two strands can no longer be distinguished

Describe the disease Phenylketonuria?

• Mutation in the gene for phenylalanine hydroxlase • Mutation prevents phenylalanine from being converted to tyrosine • Excess phenylalaine in individuals with PKU is coverted to phenylpyruvic acid • PKU patients cannot make tyrosine -- usually get this from food • Patients can have serious symptoms -- mental retardation, slow growth • Patients cannot ingest NutraSweet

Describe how a glycosidic bond joins the nitrogenous base to pentose?

• N-glyocsidic bond joins the nitrogenous base on the 1' end of the sugar backbone, to form a Nucleoside

Which molecule is produced during the light reactions of photosynthesis?

• NADPH

What is the first step in the peptidyl transferase reaction that transfers amino acid S to K?

• Nitrogen in amino acid K attacks carbon in amino acid S • Nucleophilic attack

How does the addition of the poly-A tail work is it encoded in the genomic DNA?

• No, the Poly-A tail is not encoded in the genomic DNA • The process of adding the Poly-A tail begins with the cleavage of the pre-mRNA by [CPSF / CstF] • It begins when the sequence [AAUAAA] is recognized by protein complex signaling "end of transcription" • The Poly (A) tail is added by protein (PAP) and protected from degradation by (PAB II)... The Poly-A tail adds on to the cut spot an shows AAAAAAAAAAA...

What are Transposons?

• Normal components of the genome that move from location to location • Cause genetic changes • Can produce mutations -- if inserted into genes • Can regulate gene expression -- if inserted into gene regulatory sequences

Describe Hoogsteen Base Pairing?

• Not Watson-Crick base pairing • Have been found in regions of DNA that are bound to antibiotics or proteins • Have been found in damaged or chemically modified DNA • There is an interest in using these base pairs to modulate gene expression

What strand forms can nucleic acids form?

• Nucleic acid chains can be either Single-Stranded or Double-Stranded.

Nucleic acid secondary structure denaturation is _____________________?

• Nucleic acid secondary structure is Temperature Dependent • T(melting) or T(m): Temperature at which half the polynucleotide strands denature • As temperature increases; you will more likely have separation... However, at lower temperatures, 50% of strands denature more quickly than at higher temperatures. (Temperature produces a right-shift in Tm -- 50% denaturation)

How do nucleoside structures determine DNA conformation?

• Nucleoside structures determine DNA conformation by the characteristics of the nucleoside • B-DNA is the most common form [medium length, C2'-endo, anti-conformation, right-handed • It is dependent on the glycosyl angle & the sugar pucker

Compound T (Toxic) is suspected of robustly deaminating cytosines. What base pair will become more highly represented after several rounds of DNA replication following exposure to compound T?

• Nucleotide base deamination of Cytosine will lead to the formation of Uracil. • Several rounds of DNA replication following exposure to compound T will result in the base pair (T-A)

What type of conformation do nucleotide base pairs take relative to Pentose sugar?

• Nucleotide bases typically take an ANTI-conformation relative to pentose. • This poses the least steric interaction / hinderance of the nucleotide base from the sugar backbone

How do humans repair pyrimidine dimers?

• Nucleotide excision repair

What are the players in information transfer?

• Nucleotides (RNA, DNA) • Amino Acids (Protein) -These 2 compounds interact to form Nucleoprotein complexes

How are nucleotides added to the original structure?

• Nucleotides are ALWAYS added to the 3' Hydroxyl... This is because: (5' -----> 3' synthesis) • DNA Polymerase Facilitates 3' -OH Nucleophilic attack on dNTP... (Mg2+ coordinated by DNA polymerase) 1) activates 3' -OH attack on dNTP phosphate 2) stabilizes phosphates' negative charge

What do open reading frames (ORFs) correlate to?

• Open reading frames (ORFs) correlate with protein-coding nucleotide sequence • A double stranded DNA sequence has 6 potential reading frames (3 on each strand) • A long reading frame without stop codons is called an open reading frame (ORF)... ORFs are suggestive of a protein coding sequence

What type of bonds link nucleic acids?

• Phosphodiester bonds link nucleic acids • DNA is linked in a 5' ---> 3' conformation *However, the individual phosphodiester linkages go from the 3' end of the nucleic acid to the 5' end of the adjacent nucleic acid)

What is essential to topoisomerase activity?

• Phosphoryl-transfer reaciton is essential to topoisomerase activity

Which of the following will most likely be rich in adenines and thymines?

• Promoter regions

Describe the chemically induced mutation (Depurination)?

• Purine Nucleotides: (Guanine & Adenine) ** Deamination or Depurination can result in mutations during DNA replication Deamination • DNA replication can lead to mutations in the genes (base-pair transfers / non-standard base pairing) Depurination • DNA replication can lead to mutations because base pairs have been deleted.

Give more details about how Telomerase comes to the rescue...?

• RNA component (hTR) base-pairs with repeated DNA sequence at the end of the chromosome • Reverse transcriptase component uses the RNA template of telomerase (hTR) to add new dNTPS. • hTERT adds telomere specific sequences [de novo] to the 3' end of the chromosome... NET GAIN OF TELOMERE SEQUENCE • Telomerase translocates down the new DNA and can add hundreds of new base-pairs before it jumps off the template.

Describe Bacterial RNA polymerase?

• RNA polymerase + Sigma Factor = holoenzyme • Sigma factor helps the enzyme find promoters to begin RNA transcription

How does RNA polymerase add nucleotides?

• RNA polymerase adds nucleotides via phosphoryl-transfer reaction

How does RNA structure contribute to RNA function?

• RNA structure contributes to RNA function because of the base pairing of hydrogen bonds; for example in Transfer RNA (tRNA) • Utilizes codon and anti-codon loops, which are structurally and functionally significant

Define the terms "reading frame" and "frame shift mutations"?

• Reading Frame: consecutive, non-overlapping codon sequences translated into a polypeptide. The reading frame start is set by the initiating codon (AUG). • Frame Shift Mutations: disrupt the normal reading frame by inserting or deleting nucleotides that are not multiples of 3 (adding or deleting 3 nucleotides does not disrupt the reading frame)... The reading frame downstream of the mutation is shifted giving an entirely different amino acid sequence; a stop codon is usually encountered as the aberrant polypeptide is synthesized.

Describe Recombination: Genetic Repair and Exchange?

• Recombination between homologous sequences can occur: 1) In response to DNA damage 2) Spontaneously during Meiosis 3) When mediated by enzymes (recombinase, integrase) ** Two classes: Tyrosine & Serine Recombinases

Describe the differences between Repressors and Activators?

• Regulatory protein binds DNA in the absence of ligand [DNA IS ATTACHED] 1) Repressor - ligand = Gene Off 2) Activator - ligand = Gene On • Regulatory protein binds DNA when ligand-bound (allosteric binding site) [DNA IS ATTACHED] 1) Repressor + ligand = Gene Off 2) Activator + ligand = Gene On • Regulatory protein falls off DNA when bound to ligand (DNA IS DETACHED) 1) Repressor + ligand = Gene On 2) Activator + ligand = Gene Off • Regulatory proteins needs ligand to bind DNA [DNA IS DETACHED] 1) Repressor - ligand = Gene On 2) Activator - ligand = Gene Off ** Many levels of gene expression control (and post-translational modifications) *Basic principles of gene expression are conserved but great molecular diversity... E.g. especially in Eukaryotas due to the many steps involved in regulation

What process would be impaired if a cell had a deficient glycosylase?

• Repairing a deaminated nucleotide

What can disrupt replication fidelity?

• Replication fidelity can be disrupted by base tautomers. • Common forms vs. rare forms of nucleotides... essentially the less stable forms of the molecules that can be formed due to disruption during replication by Base Tautomers (reversible reactions) ** Base tautomers pair with non-standard base partner (Standard vs. Anomalous base-pairing arrangements) can lead to mutations in DNA

How is HIV like a transposable element?

• Reverse transcriptase produces a DNA copy from an RNA template • This DNA is inserted into the host's genome 1) HIV entry to T cell --> docking --> fusion 2) Viral RNA --[reverse transcriptase] ---> cDNA ** Transposons generate phenotypic variation, diversify genomes & contribute to evolution

What conformation does Ribose adopt in nucleotides?

• Ribose adopts a ring conformation in Nucleotides E.g. Aldehyde <----> B-Furanose (ring structure)

What are ribosomes?

• Ribosomes bind to mRNA and facilitate the binding of the tRNA to mRNA, promoting protein synthesis... • Ribosome composition: S-value refers to the sedimentation rate... which depends on the 3D shape of the molecule What do the ribosomes look like? • Exit site (E), Peptidyl site (P), Aminoacyl site (A), Growing polypeptide chain, Amino acid, Large subunit, tRNA, Small subunit, mRNA all come together

What do sequences recognized by enzyme have that directs recombination?

• Sequences recognized by enzymes have an Asymmetry that directs recombination 1) Inversion -- (sites of exchange) --asymmetrical sequence to direct recombination (forms a horseshoe loop) 2) Deletion and Insertion -- asymmetrical sequence to direct recombination (Forms a loop around)

How do sequential phosphoryl transfer reactions work in relation to DNA?

• Sequential phosphoryl transfer reactions break and repair DNA 1) Phosphoryl-Transfer reaction via catalytic tyrosine residue in enzyme, takes a Closed Conformation ---> Open Conformation **The enzyme changes to open conformation; unbroken DNA strand passes through break in first strand 2) ** The second phosphoryl-transfer reaction repairs the break... [Enzyme is closed conformation; liberated 3' oH attacks 5' -phosphotyrosyl protein-DNA linkage to relegate cleaved DNA strand 3) DNA is released or new cycle begins

Give more information about Sigma Factors; describe some important ones (5)?

• Sigma 70: Regulates the expression of most genes • Sigma 32: Regulates expression of heat shock proteins • Sigma 28: regulates genes involves in cell motion • Sigma 38: regulates gene expression against external stressors • Sigma 54: regulates gene expression for nitrogen metabolism

Describe translation initiation in Eukaryotes?

• Similar to initiation in prokaryotes with some exceptions.... 1) Uses more initiation factors (eIFs) 2) Initiator methionine is unmodified 3) The 5' cap is used 4) Does not use a Shine-Dalgarno sequence but a Kozak sequence -- scanning model 5) The poly-A tail is used

Describe what is meant by Resolving a Holliday Junction?

• Single Holliday junction has 2 cleavage planes (horizontal & vertical) • Double-strand break repair via Double Holliday junctions (called the Szostak Model)

What type of structure does single stranded RNA adopt?

• Single stranded RNA adopts complex secondary structures. • Hairpins can form • Base pairing hydrogen bonds

Describe Garrod's Hypothesis of Inborn Errors of Metabolism?

• Studied alkaptonuria -- a disease with a good prognosis, but adults sometimes develop arthritis • Urine turns black upon exposure to air • Archibald Garrod determined that people with alkaptonuria excrete homogentisic acid (HA) in their urine • Garrod concluded that alkaptonuria is a genetic disease caused by the absence of an enzyme that metabolizes HA. • Garrod's work was not appreciated at the time

Describe the process of lengthening of the first strand of?

• Synthesis of new telomere DNA using telomerase DNA as a template at the 3' overhang spot • Following the synthesis of new telomere DNA using telomerase RNA as a template... Telomerase moves to further lengthen the Telomere. (Telomerase movement to the 3' end of NEWLY synthesized telomere DNA) • Then there is further lengthening of the first strand by synthesis of new Telomere DNA. • Now there is enough space for the normal replication machinery (DNA synthesized by 2 rounds of telomerase activity) • The final product is that the new end of the chromosome after replication and primer removal leaves a new overhand left on the 3' end of the newly synthesized strand, and a longer 5' end of the chromosome due to the Telomerase Activity.

Describe how Telomerase comes to the rescue by binding to the the overhanging 3' end of the chromosome?

• Telomerase is a DNA polymerase made of protein and an integral RNA molecule which provides the template for the synthesis of telomere repeats. • In humans, hTERT is the protein component and hTR is the RNA component. (RNA of telomerase is on the 3' end) • RNA template of telomerase binds to the overhanging portion of the 3' end of the chromosome, and is the template for new telomere repeat DNA.

What are some facts and outcomes of Telomere Shortening?

• Telomere shortening contributes to aging • During each division, 20-200 base pairs are lost • Once telomeres get too short, chromosomal fusion may occur, triggering apoptosis (programmed cell death)

Describe the process of Telomere Shortening?

• Telomeres shorten with each cell division • Hayflick Limit: Cells in culture can only divide a certain number of times before they become senescent (no longer divide) • The enzyme [Telomerase] is required to lengthen the ends of Telomeres • Telomerase is not expressed in most cells

Describe the process of Termination?

• Termination phase starts when the A site encounters 1 of the 3 stop codons... • This causes a protein called a Release Factor to enter the site. Release factors resemble tRNAs in size and shape but do not carry an amino acid • These factors catalyze hydrolysis of the bond linking the tRNA in the P site with the polypeptide chain E.g. 1) Release factor binds to stop codon 2) Polypeptide is released 3) Ribosome subunits separate

Which strand is the template for growing the 5'---> 3' strand?

• The 3' ---> 5' strand is the template for growing the 5' ---> 3' strand. • DNA is synthesized from 5' ---> 3' by DNA Polymerase • The new strand uses an anti-parallel strand as a template

What does the Mendelian Inheritance model dictate?

• The Mendelian inheritence model dictates that genes are transmitted as "Intact" E.g. TT + tt --> T x t ---> TT, Tt, tt Phenotype: visualization of the offspring models Genotype: genetic product... TT, Tt, Tt, tt

The RNA sequence is the same as which strand sequence?

• The RNA sequence is the same as the DNA coding strand sequence -DNA non-template (coding) strand (5'---->3') -DNA template strand (3'---->5') -RNA transcript strand (5'---->3')... Has Uracil's

Describe the length of human DNA?

• The length of human DNA is enormous! • Each diploid cell contains 2 meters of DNA • Adult human contains 10^14 cells = 2x10^11 km of DNA • Equivalent to 6,000 round trips to the moon

The nucleotide sequence is decoded using what molecule?•

• The nucleotide sequence is decoded using Transfer RNAs (tRNAs) -tRNAs are short (60-95 nucleotides), highly structured, extensively modified, stable RNAs. Each type of tRNA carries a specific amino acid covalently attached to its 3' OH end. The 5' end of the tRNA anticodon (corresponding to the 3' end of the mRNA codon) can be more flexible in its base pairing (it "Wobbles")

What was the one-gene-one enzyme hypothesis?

• The one-gene-one-enzyme hypothesis was proposed by George Beadle and Edward Tatum • It essentially stated that: One gene codes for ONLY ONE enzyme

Describe the typical eukaryotic promoter?

• The promoter region is from the (-30 to the +1) region on the strand... • The -30 region is called the (TATA box...where the base sequence reads TATAAA) • The +1 region is the region closer to initiation of transcription... YYANYY) • Further upstream (negative values) are Various regulatory sequences that are NOT PROMOTERS!

Which regions of DNA associate with histones that are highly acetylated?

• The promoter regions of constitutively expressed genes

Are the many transcription factors?

• There are many eukaryotic transcription factors that bind within promoters, promoter proximal elements or enhancer regions. • General transcription factors recruit RNA polymerases to the DNA • Eukaryotic transcriptional initiation requires multiple protein components (proteins required for initiation of transcription at the RNA Polymerase II) -Initiation • Pol II • TATA-binding Protein (TBP) • TFIIA, TFIIB, TFIIE, TFIIF, TFIIH -Elongation • ELL • p-TEFb • SII • Elongin

Describe how Topisomerases control superhelicity?

• Topisomerase enzymes have a catalytic tyrosine that cleaves and rejoins DNA strands via a phosphoryl-transfer reaction • Topisomerase activites include: 1) DNA packaging 2) Genome replication 3) CHromosome segregation 4) Transcription and gene expression 5) DNA recombination and repair Type 1 Topoisomerase: cuts a single strand of DNA Type 2 Topoisomerase (or gyrase): cuts both strands of DNA

How do Topisomerases act on DNA?

• Topisomerases relieve strain in DNA by breaking and rejoining strands E.g. No topisomerase --> Addition of Topisomerase yields a break of the back segment of DNA ---> Resealing of break on front side (This process alters the topology of DNA)

Topisomerases use the amino acid ____________ to break ____________ bonds in the DNA double helix

• Topisomerases use the amino acid Tyrosine to break Covalent bonds in the DNA double helix. ** Phosphoryl transfer reaction is Essential to topoisomerase activity

Describe the function and more information about Repressors?

• Transcription factors that inhibit activators • Have a DNA-binding domain and repression domain • Can bind to a binding site near an activator's binding site, and its repression domain interacts with the activation domain of the activator • Can bind to an activator binding site to prevent activator binding • Can recruit co-repressors

Describe transcription in Eukaryotes?

• Transcription in Eukaryotes is MORE complicated than prokaryotic transcription because it takes place in multiple locations of the cell whereas in the bacterium (prokaryote) it is unseparated. • DNA has a promoter and an RNA coding sequence... --> Transcription by RNA Polymerase II, addition of 5' cap when 20-30 nucleotides of pre-mRNA are made. Addition of 3' poly(A) tail. • Leads to pre-mRNA (larger) --[RNA splicing: introns removed --> mRNA --->[translation]--> polypeptide

Describe the process of making protein from mRNA?

• Transcription start at 5' cap / 5' UTR in (eukaryotes only) • Translational start after the 5' UTR (start codon) -Reads the coding region (open reading frame -- ORF) until it reaches the stop codon before the 3' UTR and Poly-A tail UTR = untranslated region -- does not code for protein

Transfer RNAs (tRNAs) carry the amino acids that are added to what?

• Transfer RNAs (tRNAs) carry the amino acids that are added to the growing polypeptide ** Each tRNA brings a specific amino acid to the growing peptide • 4 loops (arm, anticodon arm, T/C arm, Amino acid Arm) • Precursor tRNA (pre-tRNA) are first produced, then extra sequences are removed and 5' - CCA - 3' is added at the 3' end.

What does translational frameshifting result in?

• Translational frameshifting results in the production of two different proteins. 1) Gag Protein 2) Pol protein

How do transposons use recombination to travel around genomes?

• Transposition involves the following steps... 1) Transposase binds to short DNA sequences 2) Transposase oligomerizes on DNA to form a "synaptic" complex 3) Transposase cleaves adjacent DNA via phosphoryl transfer reactions, excising the transposase + transposon DNA 4) The transposase-DNA complex binds to target DNA 5) 3' OH groups of the transposon DNA attacks the target DNA, integrating the transposon DNA 6) DNA polymerase and ligase seal the gaps ** 3' OH initiates nucleophilic attack on target DNA -- Transposon DNA --> synapsis (synaptic complex) -----> cleavage ---> excised transposon + target DNA ----> target capture ----> strand transfer

Describe how Transposons are mobile DNA elements that move around the genomes?

• Transposons are mobile DNA Elements that move around Genomes • Transposable elements can affect gene expression, and even cause mutations that result in disease • Transposable elements comprise > 40% of the human genome. Genotype: (bz = bronze) Bz (normal form) bz (point mutation) bz-m (transposable element insertion) -- 40% of human genome

Describe the properties of the genetic code?

• Triplet: 3 consecutive bases correspond to 1 amino acid • Redundant: except for methionine and tryptophan, each amino acid is encoded by more than 1 codon. 2 codons that encode the same amino acid are said to be synonymous • Universal: the same code is used in all organisms ** Special codons identify the start and end of a protein coding sequence • AUG = initiating codon • The codons: UAA, UAG, UGA are the stop or termination or nonsense codons; they do not code for any amino acid in normal cells just he stop of the protein coding sequence ** The codons run in the 5' --> 3' direction and the anticodons must correspond in the 3' ---> 5' direction however they're flipped to read in the 5'--->3' direction with the amino acid attached.

Describe the disease Albinism

• Tyrosinase is mutated -- tyrosinase converts tyrosine to DOPA (melanin is derived from DOPA)... • Individuals with albinism produce no melanin, which is a molecule that absorbs UV light thereby protecting DNA from damage • Albinos have white skin and white hair and are sensitive to light

Describe the direct repair of a pyrimidine dimers

• UV light acts on the thymine dimer to create [Cyclobutane thymine dimer and/or a Spore Photoproduct] ** Prokaryotes and some eukaryotes photolyase energy from light... most eukaryotes? **Nucleotide excision repair (indirect) corrects DNA structural changes (pyrimidine dimers) 1) Excinuclease 2) DNA helicase 3) DNA Polymerase 1 4) DNA Ligase

Describe genetic recombination Genetic Repair and Exchange?

• Unrepaired break ---> double-strand break ---> recombinational DNA repair • Homologous pair ---> Crossover point --> "crossing over" between chromosomes

Review: Describe Enhancers

• Upstream of promoters, sometimes thousands of base pairs away • Required for maximal transcription of a gene

Consider the following template strand. What is the sequence of the coding strand? What is the sequence of RNA that is transcribed from this DNA? Indicate the 5' and 3' ends for all of the strands. 5'-------------------->3' AATGTGCACTGGAGCTGACAC

• Use the template strand to make the RNA strand from the 5' ---> 3' direction. • The coding strand is the DNA strand that matches the template strand E.g. Coding Strand (3'--->5') TTACACGACCTCGACTGTG E.g. RNA strand (3'---->5') UUACACGUGACCUCGACUGUG

Describe the coordination of the simultaneous synthesis of the leading and lagging strands?

• Utilization of multiple subunits of DNA Polymerase 3 will allow for the coordination of the leading and lagging strands at the same time... Both are synthesizes in the same direction (5' ----> 3' direction)

What is the Watson-Crick model of DNA?

• Watson-Crick posed the DNA double helix model. • The outer strands represent the two sugar-phosphate chains; whereas the base pairs are represented by the horizontal connections between the 2 chains) • The two chains (sugar-phosphate chains) run in opposite directions... One runs 5' ---> 3' while the other runs 3' ---> 5' • There are minor grooves and major grooves in the chain

How does base conformation affect hydrogen bonding patterns between base pairs?

• Watson-Crick: Anti-Anti conformation • Hoogsteen: Syn-Anti conformation

What can you treat bacterial diseases with?

• You can treat Bacterial Diseases with Prokaryotic Transcriptional Inhibitors such as: Rifampin (rifampicin) • The process of Rifampin is to BLOCK RNA polymerase -It is a Tuberculosis-causing bacteria • The process of Rifampin acts on the step in transcription where sigma is released and RNA polymerase moves off promoter.

What are the different types of RNA?

• mRNA = messenger RNA; protein-coding genes • rRNA = ribosomal RNA; a major component of ribosomes • tRNA = transfer RNA; brings amino acids to ribosomes during protein synthesis • snRNA = small nuclear RNA; helps proteins used in the processing of mRNA • miRNA = micro RNA; important in gene expression regulation

How can mRNA be edited?

• mRNA can be edited: enzyme-mediated deamination changes nucleotide sequence E.g. [Cytidine ---> Uridine] and [Adenosine ----> Inosine]

tRNA has what type of structure?

• tRNA (transfer RNA) has a Cloverleaf structure and multiple modifications • There is a site for amino acid attachment and an anticodon triplet

How do serine recombinases exchange DNA?

•Serine Recombinases generate Double-Stranded Breaks to Exchange DNA a) Cutting / Subunit rotation b) Religation / dissociation ** Both strands are cleaved, generating 3' OH and 5' P (Serine Recombinase) ** Recombinases with a Nucleophilic Serine also mediate recombination

Describe the process of homologous recombination?

•Type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. It is most widely used by cells to accurately repair harmful breaks that occur on both strands of DNA, known as double-strand breaks. 1) Double-strand break in 1 of 2 homologs is converted to a double-strand gap by the action of exonucleases. Strands with 3' ends are degraded less than those with 5' ends, producing 3' single-strand extensions. 2) An exposed 3' end pairs with its complement in the intact homolog... The other strand of the duplex is displaced (DNA polymerizes as nucleotides are added to the 3' end) 3) The invading 3' end is extended by DNA polymerase plus branch migration, eventually generating a DNA molecule with 2 crossovers called Holliday intermediates. [**DNA polymerase uses intact, homologous sequence as a template for repair] 4) Further DNA replication replaces the DNA missing from the site of the original double-strand break. 5) Cleavage of the Holliday Intermediates by specialized nucleases generates either of the 2 recombination products. In product set 2, the DNA on either side of the region undergoing repair is recombined.