BioChem Old Exam 3 Questions
You discover a new form of life in Mono Lake! You find that its DNA is always singlestranded and consists of 6 different kinds of bases, and it uses 31 different amino acids in its proteins. What is the minimal number of bases per codon in this organism needed to encode for its complete set of amino acids? A "codon" refers to the set of bases coding for a single amino acid.
2
What is the minimum number of phosphodiester bonds that must be broken to permit a single cycle of translation elongation in a living cell? Include the cost of formation of activated aa-tRNA. Do not include the cost of translation iinitiation
4
You have discovered a new enzyme that specifically hydrolyzes phosphate groups from the sugar mannose when mannose is attached to proteins. Thus, it catalyzes the following reaction: mannose 6P --> mannose. What would happen if you added a lot of this enzyme to the cytoplasm of cells? A) Nothing, because there is no mannose 6P attached to proteins in the cytoplasm. B) Lyososomal hydrolases will be secreted, leading to a disease similar to I-cell disease. C) Histones will be more positively charged and thus will bind tighter to DNA. D) The mannose 6P receptor will be overworked, leading to cell death. E) Someone who had type A blood will now have type O blood.
A) Nothing, because there is no mannose 6P attached to proteins in the cytoplasm.
Which statement accurately describes a difference between the initiation of DNA replication in prokaryotes and eukaryotes? A) Prokaryotes require helicase activity to initiate DNA replication, but eukaryotes do not require helicase activity for initiation. B) In eukaryotes, initiation occurs only once per origin per cell cycle. In prokaryotes, initiation can occur more than once per origin per cell cycle. C) Prokaryotic initiation is semiconservative, but eukaryotic initiation is completely conservative. D) Prokaryotic initiation occurs at the origin. Eukaryotic initiation occurs at Ter sites. E) Prokaryotic initiation leads to replication in both directions from the origin. Eukaryotic initiation leads to replication in a single direction from the origin.
B) In eukaryotes, initiation occurs only once per origin per cell cycle. In prokaryotes, initiation can occur more than once per origin per cell cycle.
You perform a Sanger DNA sequencing reaction using the molecule 5'-AGCGTAGATCT-3' as a template and include all the necessary ingredients EXCEPT ddCTP which you forget. You run your reaction to completion so that no polymerization intermediates remain and all chains are terminated. Which ONE of the following molecules will NOT be generated as a product? A. 5'-AGAT-3' B. 5'-AGATC-3' C. 5'-AGATCT-3' D. 5'-AGATCTACG-3' E. 5'-AGATCTACGCT-3'
B. 5'-AGATC-3'
What is the minimum direct cost, in terms of high energy phosphate bonds, required for the synthesis of a 250 amino acid protein, starting from a pool including all necessary amino acids, translation factors, ATP and GTP? Round your answer to the nearest 50. A) 0 B) 250 C) 500 D) 1000 E) 1500
D) 1000
Which of the following are substrates of aminoacyl-tRNA synthetases? A) ATP B) GTP C) tRNA D) A and C E) B and C
D) A and C
Which ONE of the following statements (A-D) about the RNAP II C-terminal domain (CTD) is FALSE? If all are TRUE, choose answer E. A) It has many repeats of a floppy and unstructured peptide sequence. B) It becomes heavily phosphorylated during the shift from the initiation phase to the elongation phase of transcription. C) It binds to the enzyme that puts a cap on the 5' end of the mRNA. D) It is the part of RNA polymerase that directly interacts with activating transcription factors E) ALL of the above answers are TRUE
D) It is the part of RNA polymerase that directly interacts with activating transcription factors
Statements A, B, and C refer to the termination of translation; Which of these are false? A) A release factor catalyzes transfer of the amino terminus of the nascent polypeptide from tRNA to water B) bacterial termination factors are tRNA-shaped ribonucleoproteins C) Chloramphenicol triggers premature transfer of unfinished polypeptides to water D) B and C are both false E) A, B, and C are all false
E) A, B, and C are all false
Which of the following enzymes is NOT required for base excision repair? If ALL are needed, choose (E). A) exonuclease B) endonuclease C) DNA ligase D) DNA glycosylase E) ALL of these enzymes are needed to perform base excision repair.
E) ALL of these enzymes are needed to perform base excision repair.
Which of the following indicates a high rate of translation of a particular mRNA? A) Introns B) Signal sequence C) N-glycosylation D) Enhancers E) Polysomes
E) Polysomes
Which of the following statements about the 5' cap of eukaryotic mRNA is FALSE? A) The 5' end of the mRNA is capped before transcription is completed. B) The cap is joined to the 5' end of the message by a 5'-5' triphosphate linkage. C) S-adenosylmethionine (SAM) is required for cap formation. D) The cap is important for the initiation of translation. E) Synthesis of the cap requires ATP.
E) Synthesis of the cap requires ATP.
Suppose the wrong amino acid is attached to a tRNA. How does the ribosome correct this error? A) The aa-tRNA will not base-pair with the cognate codon of the mRNA. B) The aa-tRNA will not bind to the A site of the ribosome. C) The aa-tRNA will bind to the A site of the ribosome but will fall off before peptidyl transfer. D) The ribosome will hydrolyze the incorrect amino acid attachment to the tRNA using its editing site. E) Trick question: the ribosome does not check the identity of the amino acid attached to a tRNA.
E) Trick question: the ribosome does not check the identity of the amino acid attached to a tRNA.
Based on the wobble rules, which of the following could NOT be the anticodon of a tRNA? "I" stands for inosine. If ALL could be the anticodon of a tRNA, choose the answer "All of these could be the anticodon of a tRNA." I. 5'-UAA-3' II. 5'-IAU-3' III. 5'-UCG-3' IV. 5'-CCU-3' A. II B. II, III C. I, III D. IV E. All of these could be the anticodon of a tRNA.
E. All of these could be the anticodon of a tRNA.
During protein synthesis in eukaryotes, what of the following steps require ATP?
Scanning of the mRNA for the initiating AUG
The anticodon of a particular tRNA is GUA. What codon or codons would this particular tRNA molecule recognize?
UAU and UAC
CpG islands are often located near the promoters of genes. Indicate the number of nucleotides in the following sequence that could potentially be modified by DNA methyltransferase that would lead to reduced expression of nearby genes. 5' TCACCTCGTGCTGTCACAGCA 3'
1
Which of the following could NOT be used as an anticodon because it would recognize codons of two different amino acids? I stands for inosine. The genetic code table is on the first page of the exam. A) 5'-IUG-3' B) 5'-IAU-3' C) 5'-UCG-3' D) 5'-GUU-3' E) 5'-ICG-3'
A) 5'-IUG-3'
Based on the wobble rules, which of the following could NOT be the anticodon of a tRNA? "I" stands for inosine. Use the genetic code table on the first page of the exam. A) 5'-UAU-3' B) 5'-IAG-3' C) 5'-IGA-3' D) 5'-GUU-3' E) 5'-IAU-3'
A) 5'-UAU-3'
Which of the following statements about eukaryotic mRNA splicing is FALSE? If all statements are TRUE, choose (E) A) ATP is required in the step in which two exons are ligated together. B) The intron is released as a lariat. C) Splicing is catalyzed by a ribonucleoprotein. D) Splicing begins before transcription has been completed. E) ALL of the above statements are TRUE.
A) ATP is required in the step in which two exons are ligated together.
Which of the following proteins do NOT bind to the ribosome during protein synthesis? If ALL of the proteins bind the ribosome during protein synthesis, choose (E). A) Aminoacyl tRNA synthetases B) Initiation factors C) Elongation factors D) Release factors E) ALL of these proteins bind the ribosome during protein synthesis
A) Aminoacyl tRNA synthetases
Huntington's disease is caused by abnormally folded proteins that aggregate and lead to neuron cell death. Select the answer that best describes what causes these proteins to aggregate: A) An increase in the number of CAG repeats in the huntingtin gene. B) A mutation in an enhancer of the huntingtin gene that leads to increased protein expression. C) A single base transversion that creates a dimerization interface in the huntingtin protein. D) Hyperacetylation of a histone tail that leads to increased huntingtin protein expression. E) Incorrect mRNA splicing that leads to the incorporation of introns in the huntingtin protein.
A) An increase in the number of CAG repeats in the huntingtin gene
5'-CAACCGTTGATCGAC-3' Assuming that this is the sense strand and that the sequence is in the middle of a gene in frame, what would be the sequence of the corresponding peptide? Refer to the genetic code table on the first page of the exam. A) Gln-Pro-Leu-Ile-Asp B) Val-Asp-Gln-Arg-Leu C) Gln-Asn-Thr-Pro-Arg-Val-Leu D) Gln-Arg-Asp-Asp E) Val-Gly-Asn
A) Gln-Pro-Leu-Ile-Asp
Which of the following protein(s) are expected to have a short sequence of basic amino acids in the middle of the protein that directs the protein to its appropriate cellular compartment? I. Components of the mediator complex II. Aminoacyl tRNA synthetases III. SRP IV. The Sec61 translocon A) I B) II C) III, IV D) I, III E) II, III, IV
A) I
To a test tube containing CAACCA-fMet, puromycin, and the appropriate ionic buffer, what additional components must be added to catalyze the peptidyl transfer reaction? I. The small ribosomal subunit (30S) II. The large ribosomal subunit (50S) III. ATP IV. GTP A) II B) I, II C) II, IV D) I, III, IV E) I, II, III, IV
A) II
Which of the following processes is catalyzed by a ribozyme (RNA enzyme)? I. mRNA polyadenylation II. Peptide bond formation III. Synthesis of telomeres IV. Attachment of amino acids to tRNA A) II B) I, II C) II, III D) I, IV E) II, IV
A) II
Which of the following statements about eukaryotic transcription is TRUE? If all statements are FALSE, choose (E). A) It doesn't really matter precisely where a mRNA transcript terminates, and unprocessed transcripts from the same gene often have variable lengths. B) Translation of the mRNA begins before transcription has been completed. C) rRNA, mRNA and tRNA are all transcribed by the same RNA polymerase. D) The first step in transcription initiation is binding of RNA polymerase to the promoter. E) ALL of the above statements are FALSE.
A) It doesn't really matter precisely where a mRNA transcript terminates, and unprocessed transcripts from the same gene often have variable lengths.
Which ONE of the following statements (A-D) about telomerase is FALSE? If ALL are TRUE, choose answer E. A) Telomerase is a ribozyme, an enzyme in which RNA performs catalysis. B) Expression of telomerase in somatic cells can contribute to cancer. C) In the absence of telomerase, linear chromosomes will not complete synthesis of the lagging strand, resulting in shorter chromosomes each generation. D) E. coli does not need telomerase because it has a circular chromosome. E) ALL of the above answers are TRUE.
A) Telomerase is a ribozyme, an enzyme in which RNA performs catalysis.
We are inspecting a prokaryotic ribosome-mRNA complex that has just completed initiation. Which one of the following statements is most likely to be false? A) The codon 5'-AUG-3' is aligned in the 30S subunit A site B) The large subunit is bound C) IF-2 has dissociated D) IF-2 has hydrolyzed GTP E) An initiator aminoacyl tRNA is bound to the AUG start codon
A) The codon 5'-AUG-3' is aligned in the 30S subunit A site
Which ONE of the following statements (A-D) about eukaryotic general transcription factors is FALSE? If all are TRUE, choose answer E. A) They bind to enhancer sequences to activate transcription. B) They bind to the promoter before RNA polymerase binds to the promoter. C) They bend the DNA which makes it easier to unwind. D) They form a large complex with RNA polymerase called the pre-initiation complex (PIC). E) ALL of the above are TRUE.
A) They bind to enhancer sequences to activate transcription.
You find a strain of E. coli bacteria with an origin that initiates replication exactly once per cell cycle. How will these bacteria grow compared to normal E. coli? A) they will grow more slowly B) they will grow more rapidly C) they will grow at the same rate D) they will grow at the same rate for a little while, but then stop growing due to a failure to terminate replication E) they will not grow at all
A) They will grow more slowly
Which of the following is required for replication termination in bacteria? A) Type II topoisomerase B) Ter sites C) Destruction of cohesin D) Destruction of the MCM complex E) Telomerase
A) Type II topoisomerase
Which one of the following does NOT contain a GTP binding site? A) elF4 complex B) EF-tu C) IF-2 D) SRP receptor E) RAB
A) elF4 complex
Which of the following statements about CRISPR/Cas9 are TRUE? I. In bacteria, the CRISPR/Cas9 system functions as a defense against phage viruses that infect bacteria. II. CRISPR/Cas9 acts at a posttranscriptional level to degrade mRNA. III. CRISPR/Cas9 depends on the RISC complex to present the single-stranded CRISPR RNA to its DNA target. IV. Cas9 is an endonuclease that cuts RNA. A. I B. I, III C. II, IV D. II, III, IV E. I, II, IV
A. I
Which ONE of the following statements best describes microRNAs(miRNAs)? A. miRNAs are encoded within our genome and decrease the translation of their target mRNAs. B. miRNAs are double-stranded RNAs that are encoded within our genome and typically act by leading to the slicing of their target mRNAs. C. miRNAs are double-stranded RNAs that are derived from viruses and typically act by leading to the slicing of their target mRNAs. D. miRNAs are made by bacteria to guide the Cas9 protein to its targets. E. miRNAs are small RNAs that are part of the spliceosome.
A. miRNAs are encoded within our genome and decrease the translation of their target mRNAs.
Which of the following sequences encodes the mRNA encoded by the DNA sense strand 5'-ATGCCAGCAT-3'? A) 5'-AUGCUGGCAU-3' B) 5'-AUGCCAGCAU-3' C) 5'-UACGGUCGUA-3' D) 5'-ATGCTGGCAT-3' E) 5'-UACGACCGUA-3'
B) 5'-AUGCCAGCAU-3'
You perform a pulse-chase experiment to radioactively label proteins targeted to the inner mitochondrial membrane and fix the cells for electron microscopy at specific times points following the chase. Which of the following best describes the sequence of radioactivity accumulating in the cell? A) Cytoplasmic ribosomes, Golgi, mitochondria B) Cytoplasmic ribosomes, cytoplasm, mitochondria C) ER-associated ribosomes, Golgi, mitochondria D) ER-associated ribosomes, Golgi, cytoplasm, mitochondria E) ER-associated ribosomes, cytoplasm, mitochondria
B) Cytoplasmic ribosomes, cytoplasm, mitochondria
5'-CAACCGTTGATCGAC-3' Which of the following mutations would be predicted to cause a premature stop codon in the section of the mRNA encoded by the sequence shown above? A) Insertion of a T just after the 5' C B) Deletion of the 5' C C) Deletion of the 5' CA D) Deletion of the 5'CAA E) None of the above
B) Deletion of the 5' C
Which of these processes is most likely to be controlled by monoubiquitylation? A) Viral membrane fusion B) Endocytosis of dopamine receptors from neuronal plasma membranes C) Destruction of huntingtin protein aggregates by the proteasome D) Removal of origin licensing factors at the end of G1 E) Initiation of protein synthesis
B) Endocytosis of dopamine receptors from neuronal plasma membranes
Order the following steps in the elongation phase of protein synthesis. I. GTP-hydrolysis by EF-Tu II. Binding of an aminoacyl-tRNA with associated EF-Tu to the A site of the small subunit III. Transfer of the peptide chain from the tRNA at the P site to the aminoacyl tRNA at the A site IV. A conformational change in the aminoacyl-tRNA that allows it to fully move into the A site V. Binding of EF-G to the A site A) I, II, III, IV, V B) II, I, IV, III, V C) II, III, I, IV, V D) V, IV, III, II, I E) II, V, IV, I, III
B) II, I, IV, III, V
Which of the following statements about wobble are TRUE? I. Inosine is often found in the third (3') position of a mRNA codon. II. Wobble helps explain why the identity of the base in the third (3') position of a codon is often unimportant in determining the amino acid encoded. III. With wobble pairing, a single tRNA can bind to more than one type of codon. IV. C-A base pairs are allowed at the wobble position due to fewer steric constraints on base pairing at the A site of the ribosome. A) I, II B) II, III C) I, II, III D) II, IV E) I, III, IV
B) II, III
What is the function of an N-terminal signal peptide on a protein? A) It is the site of N-linked glycosylation. B) It binds to the signal recognition particle (SRP) and directs the protein to the endoplasmic reticulum. C) It targets the protein for degradation by the proteasome. D) It functions as a translation start signal. E) Both the answers (A) and (D) are TRUE.
B) It binds to the signal recognition particle (SRP) and directs the protein to the endoplasmic reticulum.
A polypeptide is transferred from a peptidyl-tRNA to an aa-tRNA. What chemical group on the aa-tRNA participates in this reaction? A) Hydroxyl B) Primary Amine C) Ester D) carboxylic acid E) Acyl adenylate
B) Primary Amine
Which of the following processes consumes the most energy? A) Formation of one charged tRNA. B) Synthesis of one molecule of DNA polymerase. C) Insertion of one molecule of ethidium between DNA base pairs. D) Binding of one transcription factor to an enhancer. E) Splicing one mRNA molecule that only has group I introns.
B) Synthesis of one molecule of DNA polymerase.
You make a mutation that specifically eliminates the 3'-5' exonuclease activity of DNA Pol I. What effect will this have on DNA synthesis? A) RNA primers will not be chewed up on the lagging strand. B) There will be a higher mutation rate. C) The processivity of the enzyme will be reduced. D) DNA synthesis will now occur in a 3' to 5' direction. E) The enzyme will no longer be able to add nucleotides to a 3' tail.
B) There will be a higher mutation rate.
Which of the statements about vesicle coat protein is false? A) they associate with membranes B) They often contain cleavable signal peptides C) They help to concentrate cargo within the plane of organelle membranes D) They help to concentrate cargo within the lumens of organelles E) They act to change the curvature of membranes
B) They often contain cleavable signal peptides
Which of the following processes does NOT require the activity of a ligase? A) lagging strand DNA synthesis B) mRNA splicing C) mismatch repair D) nucleotide excision repair E) base excision repair
B) mRNA splicing
Which one of the following is NOT important for efficient transcriptional initiation in eukaryotes? A) enhancers B) phosphorylation of the RNAP II CTD (C-terminal domain) C) histone acetyltransferases D) mediator E) TATA binding protein
B) phosphorylation of the RNAP II CTD (C-terminal domain)
In the SARS-CoV-2 variants of concern from the UK, South Africa, and Brazil, one of the key mutations in the spike protein is N501Y, meaning that the asparagine (Asn or N) residue at amino acid 501 has been changed to a tyrosine (Tyr or Y). Which ONE of the following mutations is most likely to account for this amino acid substitution? Remember that SARSCoV-2 is a single-stranded RNA virus. A. A to G B. A to U C. G to A D. U to C E. C to G
B. A to U
Throughout this course we have seen GTP being used in many important biochemical reactions. One day, an angry biochemist tried to disrupt as many biochemical processes as possible by creating a toxin that binds irreversibly to GTP, effectively rendering GTP nonfunctional in a eukaryotic cell. Using your knowledge from BIOC406, which of the following processes would be directly disrupted by this toxin? I. Kinetic proofreading by EF-Tu II. Addition of a 5' cap on mRNA III. The chemical reactions in which introns are spliced by the spliceosome IV. Synthesis of AMP A. I, II B. I, II, IV C. II, III D. III, IV E. I, II, III, IV
B. I, II, IV
Which protein travels from the Golgi to the ER? A. Mannose 6-phosphate receptor B. KDEL receptor C. SRP D. A glycosyltransferase that performs O-linked glycosylation. E. None of these proteins. Proteins travel from the ER to the Golgi, not the reverse.
B. KDEL receptor
In the fruit fly Drosophila (where genes have wacky names), the nghia microRNA (miRNA) gene regulates expression of the meme gene, which encodes a transcription factor regulating antenna development. There is a sequence in the 3'UTR (3' untranslated region) of meme that is almost perfectly complementary to the nghia miRNA, with only a few bases of nghia that would loop out as a small bubble if you hybridized nghia to the meme DNA or mRNA. To test the importance of this sequence in the 3'UTR of meme, you make a mutant fly with a deletion of this 3'UTR sequence. If nghia works as a typical miRNA, what would happen to expression of meme in this mutant fly? A. Translation of the meme mRNA would decrease. B. Translation of the meme mRNA would increase. C. The meme mRNA would become more stable. D. The meme mRNA would be degraded. E. There would be no effect on stability or translation of the meme mRNA.
B. Translation of the meme mRNA would increase.
A growing E. coli cell makes as many as 1000 new 70S ribosomes each minute. If we count only the proteins actually incorporated into these ribosomes, how many new proteins must the cell synthesize per second, just to make the proteins that will be component parts of the new ribosomes? Choose the best approximate answer. A) 10 B) 100 C) 1000 D) 10,000 E) 100,000
C) 1000
According to the wobble rules, what is the MINIMAL number of tRNAs that would be required for the amino acid arginine (Arg)? Refer to the genetic code table on the first page of the exam. Note that there are 6 codons for Arg. A) 1 B) 2 C) 3 D) 4 E) 6
C) 3
According to the wobble rules, what is the MINIMAL number of tRNAs that would be required for the amino acid leucine (Leu)? Refer to the genetic code table on the first page of the exam. Note that there are 6 codons for Leu. A) 1 B) 2 C) 3 D) 4 E) 6
C) 3
On a visit to planet Brzovic, you discover that life there has evolved with DNA consisting of only 3 different bases, but that proteins have 30 different amino acids. What is the minimal number of bases per codon on this planet? A codon is defined to be the set of bases coding for a single amino acid. A) 2 B) 3 C) 4 D) 5 E) 10
C) 4
Which of the following DNA sequences would be most likely to have small insertion or deletion mutations following replication? Small = 1-3 bp insertions or deletions. A) 5' CGTGACAGTGACCAT 3' B) 5' GTTACGTAGGTCGAT 3' C) 5' GAGAGAGAGAGAGA 3' D) 5' TTCGAGTGAGCCGA 3' E) 5' GAGTGCCTGTAAGC 3'
C) 5' GAGAGAGAGAGAGA 3'
Which of the following statements best explains why cancer rates increase as we age? A) The older we get, the more cells we have. Thus, there is a greater chance that a cell becomes cancerous. B) Metabolism is decreased as we age. Thus, there are more free radicals that damage DNA. C) As we age, we accumulate more mutations and thus have an increased likelihood of mutations in important genes that control cell division. D) Rates of cell division increase as we age. E) We don't hear as well, and thus we are less able to hear about new products that we can take to reduce the risk of cancer.
C) As we age, we accumulate more mutations and thus have an increased likelihood of mutations in important genes that control cell division.
Damage to DNA caused by the oxidative deamination of cytosine is repaired mainly by which DNA repair system? A) Nucleotide excision repair B) Transfer of the damaged base to the active site Cys residue of the protein MGMT (methylguanine methyltransferase) C) Base excision repair D) Mismatch repair E) DNA photolyase
C) Base excision repair
What are two ways in which lysine acetylation on histone tails affects transcription? Choose only ONE answer. A) By increasing the affinity of histones for DNA and by decreasing histone binding to the preinitiation complex (PIC). B) By reducing the affinity of histones for DNA and by stimulating mRNA splicing. C) By reducing the affinity of histones for DNA and by recruiting other factors that remodel nucleosomes and change the transcriptional accesibility of nearby genes. D) By reducing the affinity of histones for DNA and by increasing sigma factor binding to RNA polymerase. E) By increasing the affinity of histones for DNA and by recruiting the mediator complex.
C) By reducing the affinity of histones for DNA and by recruiting other factors that remodel nucleosomes and change the transcriptional accessibility of nearby genes.
Which of the following does not describe a function of the SRP? A) Recognition of the signal peptide as it emerges from the ribosomal exit tunnel B) Binding of the ribosome and nascent polypeptide chain C) Cleavage of the signal peptide D) Transient pausing of polypeptide synthesis E) Hydrolysis of GTP accompanied by a conformational change
C) Cleavage of the signal peptide
Which of the following is NOT a function of the signal recognition particle (SRP)? A) Recognition of the signal peptide as it emerges from the ribosomal exit tunnel. B) Binding of the ribosome and nascent polypeptide chain. C) Cleavage of the signal peptide. D) Transient pausing of polypeptide synthesis. E) Hydrolysis of GTP accompanied by a conformational change.
C) Cleavage of the signal peptide
How do eukaryotes divide the labor of transcription among several RNA polymerase enzymes? A) Different tissues use different RNA polymerases. B) Some RNA polymerases are activated by the mediator complex. Others are activated by sigma factor. C) Different classes of RNAs (rRNA, mRNA, tRNA) are transcribed by different RNA polymerases. D) Different RNA polymerases work in different compartments - some in the nucleus and some in the cytoplasm. E) Some RNA polymerases transcribe in a 5' to 3' direction and others transcribe in a 3' to 5' direction. This is necessary to make RNAs that can form stem-loop secondary structures such as in tRNA and rRNA.
C) Different classes of RNAs (rRNA, mRNA, tRNA) are transcribed by different RNA polymerases.
A polypeptide is transferred from a peptidyl-tRNA to an aa-tRNA. What chemical group on the peptidyl-tRNA participates in this reaction? A) Hydroxyl B) Primary Amine C) Ester D) carboxylic acid E) Acyl adenylate
C) Ester
Which of the following proteins should have a nuclear localization signal? I. TATA binding protein II. aminoacyl tRNA synthetases III. Sec61 translocon IV. poly-A polymerase A) I B) I, II C) I, IV D) II, III, IV E) I, II, III, IV
C) I, IV
Which of the following is NOT characteristic of the human disease xeroderma pigmentosum? If all are characteristic of xeroderma pigmentosum, choose (E). A) A high rate of skin cancer. B) An impaired ability to repair thymine dimers. C) Impaired function of the enzyme DNA photolyase. D) Impaired function of nucleotide excision repair. E) ALL of the above are characteristic of xeroderma pigmentosum.
C) Impaired function of the enzyme DNA photolyase.
Which ONE of the following statements about the antibiotic puromycin is TRUE? A) It binds to the P site of the ribosome and blocks peptide bond formation. B) It resembles the 3' end of an uncharged tRNA (a tRNA without an amino acid). C) It can bind to the A site of the ribosome and perform a nucleophilic attack on the peptidyl tRNA present at the P site to form a peptide bond. D) It inhibits protein synthesis by blocking aminoacyl-tRNAs from binding to the A site of the ribosome. E) It inhibits protein synthesis by blocking the exit tunnel of the ribosome.
C) It can bind to the A site of the ribosome and perform a nucleophilic attack on the peptidyl tRNA present at the P site to form a peptide bond
Which of the following statements best describes the ribosomal small subunit? A) It contains the peptidyl transferase center. B) It has the intrinsic ability to specify which amino acids correspond to specific codons. C) It controls the sequential pairing of codons and anticodons in a specific reading frame. D) It is made entirely of RNA. E) It binds to the mRNA only after the large subunit has bound to the initiation codon.
C) It controls the sequential pairing of codons and anticodons in a specific reading frame.
In bacteria, where are promoters found? A) On the antisense strand of DNA to the 5' side of a gene. B) On the antisense strand of DNA to the 3' side of a gene. C) On the sense strand of DNA to the 5' side of a gene. D) On the sense strand of DNA to the 3' side of a gene. E) On the mRNA to the 5' side of a gene
C) On the sense strand of DNA to the 5' side of a gene
Which statement about DNA photolyase is FALSE? If all the statements are TRUE, choose (E). A) DNA photolyase repairs DNA damage caused by sunlight. B) DNA photolyase absorbs sunlight using a tetrahydrofolate-derived cofactor. C) People with mutations in DNA photolyase often develop skin cancer. D) DNA photolyase uses a base-flipping mechanism to access the damaged bases. E) ALL of the above statements are TRUE.
C) People with mutations in DNA photolyase often develop skin cancer.
Which of the following is an oncogene, a gene that when overactive causes cancer but is relatively quiet in nondividing cells? A) The huntingtin gene B) The human version of the mismatch repair gene MutS C) Telomerase D) Nitrites E) Wimholase
C) Telomerase
Which of the following steps in protein synthesis involve a GTP binding protein and GTP hydrolysis? A) Initiation B) Elongation C) Termination D) ALL of the above E) NONE of the above
D) ALL of the above
Which ONE of the following statements (A-D) about errors in replication, transcription, and translation is TRUE? If none are TRUE, choose answer E. (Please be careful not to make any errors while answering this question!) A) Errors made during DNA replication can be eliminated by a combination of the 3'-5' exonuclease activity of DNA polymerase and mismatch repair. B) Transcription has a lower error rate than DNA replication. C) The ribosome reduces errors in protein synthesis by checking to make sure that the correct amino acid is attached to a tRNA molecule. D) DNA polymerase can slip during replication, leading to short insertion or deletion mutations that are corrected by the mismatch repair system. E) ALL of the above answers are FALSE.
D) DNA polymerase can slip during replication, leading to short insertion or deletion mutations that are corrected by the mismatch repair system
Which of the following best accounts for the large number of different cell types in multicellular organisms? A) Different types of cells have different genes. B) Different types of cells have different subcellular compartments. C) Rates of DNA damage are different in different cell types. D) Different genes are expressed in different cell types. E) Different types of cells use different genetic codes.
D) Different genes are expressed in different cell types.
Which ONE of the following statements about RNA splicing is FALSE? A) Splicing occurs in the nucleus. B) Splicing is catalyzed by a large ribonucleoprotein complex. C) Splicing of transcripts from a single gene can generate different mRNA products in different tissues. D) GTP is needed to provide energy for the splicing of group I introns. E) Splicing of an mRNA can begin before transcription terminates.
D) GTP is needed to provide energy for the splicing of group I introns.
The chemical EMS is a mutagen that specifically causes mutations of G-C base pairs to A-T base pairs (i.e. G changes to A; C changes to T). Which ONE of the following mutations could NOT be caused by EMS? Please refer to the genetic code table. A) Val to Met B) Cys to Tyr C) Arg to Stop D) Glu to Gly E) Leu to Phe
D) Glu to Gly
Which of the following statements about protein glycosylation is FALSE? A) Glycosylation begins before proteins are fully synthesized. B) Glycosylation of cell surface proteins is required for some viruses to invade a cell. C) Glycosylation is a covalent modification that can occur on several different kinds of amino acids. D) Glycosylation is important for targeting proteins to the cell surface. E) Glycosylation is important for targeting proteins to the lysosome
D) Glycosylation is important for targeting proteins to the cell surface.
You set up a protein synthesis reaction in a test tube containing everything you need for protein synthesis: ribosomes, initation & elongation factors, aa-tRNAs, etc. The mRNA consists entirely of C and A nucleotides in random order. Assume that initation can happen anywhere. Which amino acids are polymerized into the resulting polypeptide? Consult the genetic code table on the first page of the exam. A) Pro, Lys B) Ser, Tyr, Pro, His, Gln C) Phe, Leu, Val, Gly, Cys, Trp D) Pro, Asn, His, Gln, Lys, Thr E) Phe, Gly
D) Pro, Asn, His, Gln, Lys, Thr
Which statement about the lariat mechanism of mRNA splicing is FALSE? A) The process is controlled by the spliceosome. B) Splicing can yield many different mRNA transcripts from a single gene. C) The first step of the lariat mechanism involves an attack on the pre-mRNA by a 2'-OH on the same RNA strand. D) The RNA within the lariat becomes part of the mature mRNA. E) The two nucleotides at the beginning of each intron are invariant.
D) The RNA within the lariat becomes part of the mature mRNA.
Which of the following does NOT consist of both RNA and protein? A) The signal recognition particle (SRP) B) The ribosome C) The spliceosome D) The Sec61 preprotein translocase E) Telomerase
D) The Sec61 preprotein translocase
Which of the following processes does NOT occur in the Golgi? If ALL these processes occur in the Golgi, choose (E). A) The synthesis of completely new sugar chains attached to proteins. B) The modification of sugar chains already attached to proteins. C) The sorting of proteins targeted to lysosomes. D) The sorting of proteins targeted to mitochondria. E) ALL these processes occur in the Golgi.
D) The sorting of proteins targeted to mitochondria.
The 3' end of the 16S bacterial rRNA has the sequence 5'-ACCUCCUUA-3'. You notice that this sequence is complementary to a sequence about 10 bases upstream of the start codon of most bacterial genes. What would be the direct effect of deleting the above sequence from the 3' end of the rRNA molecule? A) Transcription of most bacterial genes will increase. B) Transcription of most bacterial genes will decrease. C) Translation of most bacterial genes will increase. D) Translation of most bacterial genes will decrease. E) There will be no effect of deleting this sequence.
D) Translation of most bacterial genes will decrease.
Which of the following types of RNA undergo post-transcriptional modifications? A) mRNA B) rRNA C) tRNA D) all of the above E) none of the above
D) all of the above
Which of the following enzymes builds a polynucleotide chain in a reaction that does NOT use a nucleic acid template? A) telomerase B) primase C) RNA pol I D) poly-A polymerase E) DNA pol I
D) poly-A polymerase
Which ONE of the following statements comparing DNA replication to transcription is TRUE? If all are FALSE, choose answer E. A. RNA synthesis during transcription proceeds in a 5' to 3' direction, while DNA synthesis during replication proceeds in both a 5' to 3' direction and a 3' to 5' direction. B. Transcription occurs at a faster speed than replication. C. The same RNA polymerase protein functions in both transcription and in synthesizing RNA primers during DNA replication. D. Both replication and transcription require magnesium ions for catalysis. E. ALL of the above answers are FALSE.
D. Both replication and transcription require magnesium ions for catalysis.
Which ONE of the following statements about the bacterial CRISPR/Cas9 system is FALSE? A. Bacterial CRISPR loci are composed of many copies of a repeated sequence that is interrupted by unique sequences that match phage DNA. B. Cas9 is an endonuclease that cuts double-stranded DNA. C. The CRISPR/Cas9 system is part of a bacterial adaptive immune system. D. CRISPR/Cas9 acts at a posttranscriptional level to prevent the expression of mRNA. E. Cas9 is guided to its targets by RNA molecules.
D. CRISPR/Cas9 acts at a posttranscriptional level to prevent the expression of mRNA.
Order the following steps in the initiation phase of protein synthesis in bacteria. I. Initiation factor IF-2 bound to GTP escorts the initiator tRNA to the P site. II. The large subunit of the ribosome binds to the small subunit. III. The small subunit of the ribosome binds to initiation factors IF-1, IF-3 and the mRNA. IV. An aminoacyl tRNA binds to the A site. A. I, III, IV, II B. II, I, IV, III C. II, III, I, IV D. III, I, II, IV E. III, I, IV, II
D. III, I, II, IV
Why do antibiotics work to specifically target bacterial protein synthesis without interfering with human protein synthesis? A. Bacteria translate multiple proteins from the same mRNA. B. Translation of a mRNA in bacteria occurs at the same time as transcription. C. Protein synthesis in bacteria requires GTP hydrolysis. D. Ribosomes are not 100% conserved between bacteria and humans. E. Bacterial ribosomes must bind to the Shine-Dalgarno sequence in the mRNA while eukaryotic ribosomes must bind the cap sequence in the mRNA for translation initiation.
D. Ribosomes are not 100% conserved between bacteria and humans.
Which of the following is NOT a mechanism cells use to reduce the occurrence of mutations? If all are used by cells to reduce the occurrence of mutations, choose (E). A) Proofreading activity by DNA polymerase. B) Direct repair of chemically modified bases. C) Excision of damaged DNA and resynthesis using the complementary strand as a template. D) Cell cycle checkpoints that prevent a cell from dividing until DNA damage is repaired. E) ALL of the above mechanisms are used by cells to reduce the occurrence of mutations.
E) ALL of the above mechanisms are used by cells to reduce the occurrence of mutations.
Which of the following statements about DNA methylation is FALSE? If all the statements are TRUE, choose (E). A) DNA methylation can lead to mutations due to base mispairing. B) DNA methylation is important in bacteria for proper mismatch repair. C) DNA methylation can lead to changes in chromatin structure. D) DNA methylation can cause a decrease in transcription. E) ALL of the above statements are TRUE.
E) ALL of the above statements are TRUE
You perform an experiment in which you pulse pancreatic secretory cells with radioactive leucine and then chase with nonradioactive leucine. At various time points, you fix the cells for electron microscopy. Which of the following statements best describes the result of your experiment? A) Radioactivity appears first in the nucleus, then in the endoplasmic reticulum (ER), Golgi and plasma membrane. B) You see no radioactivity until it appears on the plasma membrane. C) At the earliest time points, most of the radioactivity is in the ER. At an intermediate time point, most of the radioactivity is in secretory vesicles near the plasma membrane. At a late time point, most of the radioactivity is in the lysosome. D) At early time points, you see DNA fragments about 1000 bases long. At later time points, the size of these fragments increases, suggesting that they are being ligated together. E) At the earliest time points, most of the radioactivity is in the ER. At an intermediate time point, most of the radioactivity is in the Golgi. At a very late time point, you see little radioactivity remaining in the cell.
E) At the earliest time points, most of the radioactivity is in the ER. At an intermediate time point, most of the radioactivity is in the Golgi. At a very late time point, you see little radioactivity remaining in the cell.
Which of the following statements best describes heterochromatin? A) Heterochromatin consists of accessible DNA that is transcriptionally active. B) Heterochromatin consists of DNA that is highly methylated and not bound to histones. C) Heterochromatin is the region of DNA that the TATA-binding protein binds. D) Heterochromatin consists of histones that are usually heavily acetylated and DNA that is condensed. E) Heterochromatin consists of DNA in a highly-condensed state that is not transcriptionally active.
E) Heterochromatin consists of DNA in a highly-condensed state that is not transcriptionally active.
Which of the following processes is mediated by at least one reaction involving nucleophilic attack by a 3'-OH group? I. Transcription II. Splicing of introns III. Synthesis of telomeres IV. Attachment of amino acids to tRNA A) I, III B) II, III C) I, III, IV D) I, II, IV E) I, II, III, IV
E) I, II, III, IV
Which of the following processes is directly mediated by at least one reaction involving nucleophilic attack by an OH group? I. Aminoacylation of tRNA II. Peptide bond formation III. Synthesis of telomeres IV. Attachment of a poly-A tail to mRNA A) I B) I, II C) I, III D) II, IV E) I, III, IV
E) I, III, IV
Which of the following N-terminal sequences is most likely to direct a protein to the secretory pathway? A) Met-Met-Asn-Glu-Leu-Glu-Ala-Ser-Asp-Leu-Leu-Val-Glu-Leu-Gly-Gln B) Met-Glu-Glu-Asp-Val-Val-Glu-Ser-Cys-Glu-Ala-Thr-Pro-Thr-Asn-Ser C) Met-Ser-Tyr-Ala-Tyr-Leu-Phe-Lys-Tyr-Ile-Ile-Ile-Gly-Asp-Thr-Gly D) Met-Met-Gln-Thr-Gln-Val-Ala-Ser-Arg-Ala-Gly-Tyr-Ser-Asn-Leu E) Met-Lys-Phe-Leu-Val-Asn-Val-Ala-Leu-Val-Phe-Met-Val-Val-Tyr-Ile
E) Met-Lys-Phe-Leu-Val-Asn-Val-Ala-Leu-Val-Phe-Met-Val-Val-Tyr-Ile
Which ONE of the following statements about N-linked glycosylation is FALSE? If all are TRUE, choose answer E. A. The first steps in N-linked glycosylation can occur co-translationally (i.e. at the same time as protein synthesis). B. The sugar is first attached to the protein as a 14-residue oligosaccharide. C. The sugar is covalently bound to an asparagine residue of the protein. D. N-linked glycosylation status can act as a checkpoint to ensure that only properly folded proteins exit the endoplasmic reticulum. E. ALL of the above are TRUE.
E. ALL of the above are TRUE.
Which ONE of the following proteins does NOT enter the secretory pathway? If ALL of these proteins enter the secretory pathway, choose the answer "All of these proteins enter the secretory pathway." A. IRE1 B. Mannose 6-phosphate receptor C. A protein with a KDEL sequence at its C-terminus D. The glucagon receptor E. All of these proteins enter the secretory pathway
E. All of these proteins enter the secretory pathway
Which ONE of the following would NOT be impacted by a disruption of the methyl cycle? If ALL would be impacted, choose the answer "ALL would be impacted...". A. Histone methylation B. 5' capping of mRNA C. Glycine synthesis from L-serine D. dTTP synthesis E. All would be impacted by a disruption of the methyl cycle
E. All would be impacted by a disruption of the methyl cycle
Which of the following statements comparing DNA replication and transcription is FALSE? A. DNA polymerase and RNA polymerase are both targeted to the nucleus. B. Unwinding of the DNA is necessary for the initiation of both DNA replication and transcription. C. Both DNA polymerase and RNA polymerase perform synthesis in the 5'-to-3' direction. D. DNA polymerase requires a sliding clamp for high processivity, but RNA polymerase does not require a sliding clamp for high processivity. E. Both DNA polymerase and RNA polymerase require an RNA primer.
E. Both DNA polymerase and RNA polymerase require an RNA primer.
Which of the following proteins use energy to do mechanical work (such as move or generate forces)? I. DNA helicase II. The MutS-MutL complex that functions in mismatch repair III. Histone remodeling complexes IV. Elongation factor EF-G A. I, III B. I, II, III C. I, III, IV D. III, IV E. I, II, III, IV
E. I, II, III, IV
