BIOL 1610 Quizzes

Ace your homework & exams now with Quizwiz!

The bands observed in a gel for a VNTR (variable number of tandem repeats) polymorphism in a father (F) and mother (M) are shown in the diagram. What possible patterns of bands are expected among their offspring?

(1, 2), (1, 4), (2, 3), (3, 4)

You are working at NASA studying new life forms found in the Cueva de Villa Luz caves. You have collected an unknown specimen that appear to be 0.5 micron in size, have a cell membrane and ribosomes. This specimen could be...

(B) prokaryote

Select all that are correct regarding the graph pictured here. time(days) on x axis hay -pile diameter (m^2) on y axis

- "Ratatat" had the largest hay-pile for the duration of the experiment (after time 0) - Hay-pile diameter is the dependent variable -Ground squirrels did not build hay-piles

Which of the answer choices is true about ATP synthase? Select all that apply.

- ATP synthase is a transport protein. - ATP synthase is an integral membrane protein.

In step 6 of the citric acid cycle, succinate + FAD → fumarate + FADH2. Which statements concerning this reaction are true? Refer to the figure shown. (Note that in redox reactions, the molecule that "causes" another to gain or lose electrons is referred to as the agent.) Select all that apply.

-FAD is an oxidizing agent in the reaction. - Fumarate is more oxidized than succinate.

LHCII is a protein that functions to: (choose all that apply)

- harvest light energy - bind chlorophyll

Select each true statement

- homologs separate during anaphase of mitosis and meiosis 1 - chromatids condense to chromosomes during prophase of mitosis and meiosis 1

Which bonds rely on the attraction of positive and negative charges? Select all that apply.

- hydrogen bonds - ionic bonds

Which stages of mitosis are correctly matched with the events that occur in the stage? Select all that apply.

- metaphase; chromosomes line up in the middle of the cell - cytokinesis; a contractile ring of actin filaments forms at the cell equator

Let's say you feel very strongly that cigarette smoke does not increase the probability of getting cancer, and you base your view on something you read on the Internet. This is a good example of a(n):

- none of the other answer options are correct ^^^^^^ - hypothesis. - theory. - experiment. - observation.

Which of the statements is true regarding glycine?

-Glycine increases the flexibility of the peptide backbone; -the side chain is small so it tucks in

How many water molecules would be produced in making a polypeptide that is 14 amino acids long?

A true-breeding black rabbit is crossed with a true-breeding white rabbit to produce an F1 generation of 16 individuals. If the black color trait is dominant, which of the outcomes represents the expected phenotype of an F1 generation cross?

16 black rabbits, 0 white rabbits, 0 gray rabbits

pyruvate to acetyl CoA reaction

- occurs in the mitochondrial matrix. - occurs twice for each glucose oxidized. - shows synthesis of the substrate that enters the citric acid cycle.

Select each true statement about mitosis

- separates sister chromatids during anaphase - is a form of asexual cellular reproduction - produces identical daughter cells

Select all that are true of mitosis.

- sister chromatids separate during anaphase - it's a form of asexual reproduction

The structural diversity of carbon-based molecules is determined by which properties? Select all the apply.

- the ability of carbon's covalent bonds to rotate freely - the ability of carbon to form four covalent bonds - the orientation of carbon's bonds in the form of a tetrahedron

What are the functions of an enzyme? Select all that apply.

- to increase the rate if a specific reaction - to lower the activation energy for the reaction

What are the functions of an enzyme? Select all that apply.

- to lower the activation energy for the reaction - to increase the rate of a specific reaction

Deoxyribonucleic acid is used for:

- transmission of information - storage if information

An ounce of almonds has _______________ compared to an ounce of Doritos. Choose all that apply.

- two and a half grams more of fiber - three times as much protein - many vitamins and minerals -1/6 of the digestible carbohydrates

In the neuron simulation, the membrane potential of the neuron is measured using a voltmeter. What is the potential of an unstimulated neuron (this is also called the resting potential)

-65 mV

With independent assortment, the ratio of genotypes in the F2 generation of a cross between true-breeding strains (AA bb x aa BB) can be described as 1:2:1:2:4:2:1:2:1. To what genotype does the "4" in the ratio refer?

Aa Bb

Which hypothesis of mechanism of coral boring was supported by the investigation?

Acid secretion

The codons in mRNA specify the amino acids that are used to make a protein. Is the statement true or false?The limitations of the genetic code are such that a single amino acid may be specified by no more than four codons.

false

The third pre-class video shows a scratch test. What is being measured in a scratch test?

How fast cells move into an empty space.

The energy from the movement of electrons through the electron transport chain is directly used to synthesize ATP.

false

The observable characteristics of an organism constitute its genotype.

false

The same strand in a DNA double helix is used as the template strand for transcription of every gene in a given chromosome.

false

Which component of a phospholipid is found in the interior of a lipid bilayer?

fatty acids

When a charged tRNA is about to bind to the vacant A site of a ribosome, where is the growing polypeptide?

in the P site

Examine the figure shown, which depicts one stage in the process of translation in a eukaryote.

in the P site of the ribosome

Carbohydrates and proteins are two types of macromolecules. Which functional characteristic of proteins distinguishes them from carbohydrates?

ability to catalyze biochemical reactions

Glycolysis is a series of chemical reactions (endergonic and exergonic) by which the cell can obtain ATP. NAD+ plays a crucial role in the reactions of glycolysis by:

accepting electrons during glycolysis, with the overall result that glucose is partially oxidized to pyruvate.

Where must the SRP receptor be located in a cell?

in the membrane of the rough endoplasmic reticulum

How might an enzyme inhibitor slow down the action of an enzyme without binding to the active site?

by binding to another site on the enzyme and changing its shape

During transcription, the RNA/DNA complex extends for the entire length of the DNA sequence of interest.

false

For a folding domain that forms a sort of "fist" with certain amino acid R groups buried within and other R groups facing out, the hydrophobic R groups mainly face "out" and the hydrophilic R groups mainly face "in."

false

In Mendel's experiments, his parental pea plants are referred to as the F1 generation, and their progeny are referred to as the P1 generation.

false

Where are the chlorophyll molecules located in plant cells that carry out photosynthesis?

in the thylakoid membranes

In a protein-coding region of DNA, any mutation that replaces a single nucleotide for another will replace any amino acid with any other amino acid.

false

Most proteins retain metabolic activity when denatured.

false

The codons in mRNA specify the amino acids that are used to make a protein. Is the statement true or false?Because there are 4 RNA nucleotides and each codon is 3 nucleotides long, there are 64 possible codons, each of which directs the ribosome to incorporate a different amino acid into a growing polypeptide chain.

false

Certain complexes of the mitochondrial electron transport chain pump protons. Protons are pumped across the _____ mitochondrial membrane, from the _____ to the _____.

inner; matrix; intermembrane space

Which of these bond types involve the attraction between full opposite charges?

ionic

When the red probe was used to measure membrane potential as the nerve impulse passed the probe location, how did membrane potential change?

it became less negative

FRAP experiments measure:

lateral movement of fluorescently labeled proteins.

Which of the sequences best represents the flow of energy through living systems?

light → photosynthesis → carbohydrate → cellular respiration →ATP → heat

Which of the four major macromolecule types is mostly hydrophobic?

lipid

The class of organic molecules defined by a physical property rather than a structure are the:

lipids

Which biomolecule is defined by a physical property instead of a chemical structure?

lipids

Which of the organic molecules are commonly used for energy storage?

lipids and carbohydrates

The MGDG lipid (monogalactosyl diacylglycerol) is an unusual lipid because

lipids; lipids and proteins

When a substance in a reaction is oxidized, it:

loses electrons.

The type of RNA that physically interacts with a ribosome, providing the sequence information for a specific protein, is abbreviated:

mRNA.

Homologous chromosomes separate from each other in:

meiosis I.

Homologous pairs of chromosomes separate during:

meiosis I.

During meiosis, genetic variability is introduced during which phase?

metaphase I

Which of the following plays a key role in both mitosis and meiosis?

microtubules

Of the chlorophyll molecules that absorb the energy of a single photon, 98% do not carry out charge separation because:

most chlorophyll are part of the light-harvesting antennae, and not part of the reaction center.

Which of the four major biomolecule types does most of the work in the cell and is about half of the solid mass of the cell?

proteins

Which of the following produces 2 NADH and zero ATP per glucose?

pyruvate oxidation

Mendel used true-breeding strains of peas. Would true-breeding peas with the trait caused by a dominant allele or a recessive allele have been easier to produce?

recessive allele

The _____ forms of the electron carriers NAD+/NADH and FAD/FADH2 have high potential energy.

reduced

Which of the following does NOT happen in the Calvin cycle of photosynthesis?

reduction of NADP+ to NADPH

Consider three different enzymes (identified as 1-3, below), each of which has a unique complement of three amino acids that are crucial for the binding of the substrate at the active site. Select from choices A-D the characteristic you would predict a substrate would possess that would bind to an active site where these amino acids are present. Enzyme 1: leucine, tryptophan, and alanine

relatively hydrophobic

The potential energy in a molecule of ATP that is harnessed to do the work of the cell is held in part in the:

repulsion of the phosphate groups from each other.

Based on the information provided what are the genotypes of couple 2?

same as couple 1

Nondisjunction results in gametes that violate which principle?

segregation

Meiosis reduces ploidy by

separating homologs

You are a Mutant! According to the point mutation video on pre-class page, how many new unique mutations does every human baby have (on average)?

seventy

In eukaryotic cells, transcription cannot begin until ________.

several transcription factors have bound to the promoter

Using the periodic table provided, select the element that would be found in least abundance in a living cell.

silicon (Si)

During meiosis II:

sister chromatids are separated.

(Read the page linked above before answering this question.) What phenotypic impacts were NOT noticed in the D257A mutant mice?

slower replication

In pyruvate oxidation one molecule of pyruvate enters into a mitochondrion and two molecules of acetyl-CoA are formed.

true

Meiosis is thought to have appeared early in evolution because most eukaryotes perform meiosis and the steps of meiosis are the same in all eukaryotes.

true

The Gibbs Free Energy of a system is defined as the system's capacity to do work.

true

The alignment of chromosomes at metaphase of meiosis II is most similar to the alignment of chromosomes during metaphase of mitosis.

true

The codons in mRNA specify the amino acids that are used to make a protein. Is the statement true or false?Sixty-one of the 64 possible codons are specified amino acids, whereas the other 3 are stop codons. Each of the 61 codons specifies just one amino acid.

true

The codons in mRNA specify the amino acids that are used to make a protein. Is the statement true or false?Some amino acids are specified by just one codon, whereas others are specified by multiple codons.

true

The sum of all chemical reactions in a cell is referred to as metabolism.

true

When glucose is broken down in a cell, all of the energy it stores is not released simultaneously but is instead released in a stepwise process.

true

A specific enzyme has glutamic acid as part of its active site. Which of these amino acid substitutions would be most likely to prevent the enzyme from catalyzing its appropriate reaction.

tryptophan

A skin cell in G2 of interphase has _____ as much DNA as it had in G1.

twice

Which of the options is circled in this electron micrograph?

two double-stranded DNA molecules

Nitrogen and phosphorus are in the same column of the periodic table. They have similar properties in bonding with other molecules because they have the same number of:

valence electrons.

Which of the following is a product (as opposed to a substrate) of at least one of the processes of cellular respiration?

water

(Read figure 12.2 before this Q) When we say that DNA replication is semiconservative, we mean that:

when DNA is replicated each new double helix contains one parental strand and one newly synthesized daughter strand.

The statement that, in garden peas, yellow seed color is dominant to green seed color means that:

when a true-breeding parent with yellow seeds is crossed with a true-breeding parent with green seeds, all offspring will have yellow seeds.

A replication fork is shown below. The leading strand the 3' on top with smaller opening to the right and huge opening to the left

would be on the top, synthesized left to right

When Mendel crossed true-breeding dominant yellow-seed plants with true-breeding recessive green-seed plants, the offspring were phenotypically:

yellow-seed plants.

In plants, the ultimate electron donor in photosynthesis is water.

true

Which of the answer choices is FALSE about ATP synthase?

- ATP synthase is an important enzyme in the citric acid cycle. - ATP synthase relies on an electrochemical gradient of sodium ions to make ATP. - Under aerobic conditions, the globular F1 portion of ATP synthase catalyzes a catabolic reaction. - ATP synthase makes a total of four - ATP molecules in glycolysis. - ATP synthase pump protons from low to high concentration using ATP.

Which hypothesis/hypotheses is/were proposed to explain the unique ability of the clam?

- All of the above ^^^^^^ - Non-Acid Chemical Boring - Mechanical Rasping - Acid secretion

The atom:

- All of these choices are correct ^^^^^^ - has negatively charged particles circling around a positively charged nucleus. - is the basic unit of matter. - contains protons, neutrons, and electrons. - .is the unit of composition for elements.

Which of the following statements about water is CORRECT?

- All of these choices are correct ^^^^^^ - Water molecules form hydrogen bonds with other polar molecules. - Water has good solvent properties. - Water is a polar molecule. - Water is the most abundant molecule in living cells.

Which of the examples are cellular life forms: yeast, bacteria, plant, animal?

- All of these choices are correct. ^^^^^^ - Only plants and animals are cellular. - All are cellular except yeast. - All are cellular except bacteria.

Which of the following statements is true?

- DNA is double stranded, whereas RNA is single stranded - RNA can act as an enzyme - DNA and RNA don't have identical monomers

Which of the following molecules contains a polar covalent bond? Select all that apply. Electronegativity: H (2.2), C (2.55), N (3), Cl (3.15), O (3.44)

- HCN - H2O2

In humans, a widows peak hairline (H) is dominant to a straight hairline (h). Having freckles (F) is dominant to having no freckles (f). A person with a widows peak and freckles could have which of the following genotypes? (select all that apply)

- HHFF - HhFf

What causes hyponatremia? (Hint: More than one answer choice)

- Hormonal imbalance - Excessive drinking of water

Why is DNA ligase important for a cell? Select all that apply.

- It joins Okazaki fragments. - It joins DNA together from different origins of replication

Which of the options correctly match the type of cell division with the cellular events or results characteristic of that type of cell division? Select all that apply.

- Meiosis produces genetically unique daughter cells. - Mitosis produces genetically identical daughter cells. - In meiosis, the original cell undergoes two rounds of cell division.

A biologist working in a lab adds a compound to a solution that contains an enzyme and substrate. This particular compound binds reversibly to the enzyme at the active site. Once the compound is bound to the enzyme, the rate of catalysis of substrate to product is greatly reduced. Which of the statements are true of the compound?

- The effect of the compound can be overcome by adding more substrate. - The compound competes with the substrate for the active site of the enzyme.

Which choices accurately match each of the cellular processes to the stage of meiosis in which it occurs? Select all that apply.

- The nuclear envelope disappears in prophase I. - Microtubules attach to kinetochores at the centromere of each homolog in prometaphase I. - Chromosomes condense to thickened structures that are visible under the microscope in prophase I.

Indicate all of the following phrases that accurately describe what happens in eukaryotes when a ribosome encounters a stop codon. Select all the correct phrases.

- The protein is released from the tRNA - A release factor binds to the A site - The ribosomal small subunit and ribosomal large subunit separate from the mRNA.

Examine the figure shown, which depicts one stage in the process of translation in a eukaryote.

- The tRNA carrying the polypeptide will be in the P site. - A new tRNA will bind to the ribosome. - The tRNA that is no longer carrying the polypeptide will be ejected from the ribosome.

What do you observe in Figure 2 of the linked reading. Select all that apply.

- There is more light emitted from CMV. - The light emitted from cTnT is localized to the heart area. - The light emitted from CMV is distributed throughout the body.

Which statements are true of an inhibitor that binds the active site of an enzyme? Select all that apply.

- These inhibitors compete with the substrate for the active site of the enzyme. - These inhibitors are structurally similar to the normal substrate of an enzyme. - Adding more substrate can reduce the effect of these inhibitors.

Select all that are true of a ribosome.

- acts as an enzyme - performs transcription - composed of protein - composed of rRNA

Which of the choices are components of an ATP molecule? Select all that apply.

- adenine - ribose - three phosphate groups

Some poisonous plants harm people and animals because they produce compounds that are structurally similar to amino acids. Possible reasons why these compounds are toxic include that they _______________ Select all correct phrases

- are recognized by amino acyl tRNA synthetases, and are linked to a tRNA molecule. - change the final folded shape of the protein. - impair the function of proteins.

Select all that are true of aminoacyl tRNA synthetase.

- attaches an amino acid to the correct tRNA - is a protein

Suppose you are studying the transport of a certain polar molecule across the plasma membrane of cells in culture. Over a period of time, you measure the concentration of a polar molecule inside and outside of the cells. You find that the concentration of the molecule is higher in the cell and is gradually increasing. You also measure the ATP concentration inside the cell and find that it is decreasing. Which of the following is probably responsible for the transport of this polar substance into the cell? (Select all that apply.)

- facilitated diffusion -

Which of the examples are considered anabolism? Select all that apply.

- fat cells growing bigger during times of ample nutrition - synthesis of new DNA copies prior to cell division

Why does meiosis result in more genetic variation than can be explained by mutation alone? Select all that apply.

-because of the random alignment of maternal and paternal homologs during metaphase of meiosis I - because of crossing over between homologs during prophase I

Which of the outcomes represents the expected genotypes of an F1 generation consisting of 16 individuals from a cross of a true-breeding black (BB) rabbit and a true-breeding white (bb) rabbit?

0 BB, 0 bb, 16 Bb

Read the scenario: You get in your car to drive to class. You turn the key, and the engine starts making a clicking sound, but does not start (1). You think to yourself, "The battery must be dead" (2). So, you borrow the battery from your neighbor's car (with permission, of course) and exchange it for the one in your car (3). You figure that if the battery in your car is dead and you replace it then the car will start (4). You get in the car again, turn the key, and the car starts right up (5), and you make it to class on time.Notice that there are numbers at the end or parts of some of the sentences in the scenario. Refer to these numbers when answering the question. Which sentence, or part of a sentence, in the story is an observation?

The structural formula below is of two amino acids joined together to form a dipeptide. The carbons in this dipeptide are numbered 1 through 4. Use this formula to answer the question: Which of the carbons are a carbons?

1 and 3

Use the table below to answer the questions, also the genetic code is provided to assist you. Assume that this table is read from LEFT to RIGHT. 1. Which DNA strand is the template strand? (1 or 2) 2. What is the polarity of the polypeptide (should N or C be written in that first box on the left)? 3. What is the amino acid that is not labeled? 4. What is the DNA template strand sequence for Gly? 5. What is the codon for Arg?

1. 1 2. N 3. Gly 4. 3'CCT5' 5. 5'CGA3'

Nitrogen has an atomic number of 7 and an atomic mass of 14.007 1. How many electrons are in the inner shell of nitrogen? 2. How many neutrons does nitrogen have? 3.How many protons does nitrogen have? 4.How many valence electrons does nitrogen have? 5.How many covalent bonds must nitrogen form to be stable? 6.How many electrons does nitrogen have?

1. 2 2. 7 3. 7 4. 5 5. 3 6. 7

Below is an image of translation occurring, use it to answer the following questions. the EPA trna and ribosome; the arrow is going from right to left 1. If the ribosome is moving from right to left, as indicated by the arrow, what is the polarity of the mRNA? The left side of the mRNA (where the ribosome is moving towards) is the 2. On the ribosome, which site is where the tRNA is ejected? 3. C. The new aminoacyl tRNA is entering at which site? 4. On which RNA do we find the anti-codon?

1. 3' 2. 1 3. 3 4. tRNA

1. What is the probability of those two individuals having an offspring with the phenotype aD? 2. What is the probability of those two individuals having an offspring with the genotype AaDD? 3. What is the probability of those two individuals having a male offspring with the phenotype Ad?

1. 3/16 2. 1/16 3. 1/16

The sugar in the figure below is part of a nucleotide, use letters A-D to answer the questions below. (5pts) 1.On the figure above, the phosphate group would attach to the sugar next to which letter? 2. On the figure above, the nitrogenous base would attach to the sugar next to which letter? 3. Which letter represents where you will add on the next nucleotide? 4. Which letter represents the extra hydroxyl group present in RNA?

1. A 2. C 2. B 4. D ONLY GOT 1/2 RIGHT

Match each of these cellular processes with the phase of meiosis in which it occurs. Each cellular process may be used once, multiple times, or not at all. 1. ____sister chromatids are separated 2. ____the cytoplasm of the daughter cells are separated 3. _____ homologous chromosomes line up in the middle 4. _____the DNA is replicated 5. _____sister chromatids line up in the middle

1. Anaphase II 2. Cytokinesis 3. Metaphase I 4. S phase 5. Metaphase II

An experiment was performed to study the progress of cells through the mitotic cell cycle. Consider the image. The group of cells on the left are examples of the cells at the beginning of the experiment. The cells on the right are representatives of three different experimental treatments using four different compounds. Each of these compounds were used individually to study their effects on the cell cycle. cytochalasin: an inhibitor of actin microfilament assembly colchicine: an inhibitor of microtubule formation aphidicolin: an inhibitor of DNA polymerase activity emetine: an inhibitor of ribosome activity (and therefore protein synthesis) 1. Which of the cells came from a culture treated with cytochalasin? 2. Which of the cells came from a culture treated with colchicine? 3. Which of the cells most likely came from a culture treated with emetine or aphidicolin?

1. Cell B 2. Cell C 3. Cell A

Cell A is likely in ______whereas cell B is in ________ . Cell A is________ , whereas cell B is______ . Cell A ________. Cell B is preparing for ______ .

1. G1 phaase 2. G2 phase 3. 2n=6 4. 2n=4 5. contains sister chromatids 6. preparing for S phase

A student was studying cell growth using cells grown in laboratory cultures. The cultures were synchronized so that all of the cells passed through the same stage of the cell cycle at the same time. The cells were examined during five different periods of time, intervals (A-E). The amount of DNA present per cell was determined for each interval. The graph shows the result of this study. 1. Most of the cells examined during interval A have half as much DNA as those measured in interval C. Therefore, most of the cells at interval B must have been in: 2. Most of the cells examined during interval D were in: 3. Most of the cells examined during interval C were in: 4. Based on the information in the graph, which interval(s) correspond(s) to times at which most of the cells were at G1 of the cell cycle?

1. S phase 2. M phase 3. G2 phase Intervals A and E

The following statements list events that occur during translation, from initiation through termination. Arrange the order of events that occur during translation by numbering them 1 (the first event) to 6 (the last event to occur). Note, not all the events are listed. Each answer should be a number, e.g. "1", "2", etc.

1. The first aminoacyl tRNA holding (f-Met) complementary base pairs to the start codon AUG 2. A new aminoacyl tRNA binds to the codon in the A site 3. A peptide bond is formed between the new amino acid at the A site to the polypeptide at the P site 4. The large ribosomal subunit binds to the small ribosomal subunit 5.A release factor enters the A site 6. A stop codon enters the A site

Which of the choices is the most common energy "currency" for a cell?

ATP

Put the statements relating to DNA replication and the cell cycle in the correct order.

1. The initiator protein binds the origin 2. Helicase unwinds the DNA. 3. Primase synthesizes an RNA primer 4. DNA polymerase synthesizes the newly replicated strand in a 5' to 3' direction 5. Ligase catalyzes covalent bond formation between Okazaki fragments

1. _______Versions of a gene that may differ by a couple nucleotides 2.________ AAbb or AaBb or aaBb 3. ______The observable product of a gene

1. alleles 2. genotypes 3. phenotype

The molecule below is considered a(n)____ because it has ____protons. This molecule would likely form a(n) _______bond with phosphate (PO4-). This molecule is considered______and is therefore _______ the molecule shown is a N+ with 4 single H surrounding it

1. base 2. accepted 3. hydrogen 4. polar 5. hydrophilic

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The promoter sequence is off the page to the RIGHT. 5' . . .GGCTAAGCGTCACCACA. . .3' (Top strand) Promoter 3' . . .CCGATTCGCAGTGGTGT. . .5' (Bottom strand) 1. Which DNA strand is the template strand?

1. bottom 2. all of these answers are correct

Read the following scenarios and indicate which of the following processes they describe. 1.Sodium ions (Na+) move through sodium channels in a synthetic membrane. 2.Sodium molecules move randomly around a solution of sodium chloride in water, frequently colliding with other sodium ions and chloride ions. 3.Water molecules move into the cytosol of a cell placed in a hypotonic solution. 4.Water molecules move into the cytosol of a cell placed in pure water. 5.The action of sodium-potassium pumps moves sodium ions (Na+) out of a cell and potassium ions (K+) into a cell.The action of sodium-potassium pumps moves sodium ions (Na+) out of a cell and potassium ions (K+) into a cell.The action of sodium-potassium pumps moves sodium ions (Na+) out of a cell and potassium ions (K+) into a cell. 6.Glucose molecules move into cells lining the intestine against their concentration gradient driven by the movement of sodium ions (Na+) into the cells down their concentration gradient. a.osmosis b.secondary active transport c.diffusion d.primary active transport e.facilitated diffusion

1. e 2. c 3. a 4. a 5. d 6. b

Ribose and deoxyribose differ at position _____ . The position of the 3' carbon is ______ . Position 5' is_______

1. e 2. d 3. b

DNA has bases on the______ of the molecule, strands that are _______ , and guanine almost always pairs with _______ by (a/n) _____ bond(s).

1. interior 2. antiparallel 3. cytosine 4. hydrogen

Use the figure below of RNA processing to answer the following questions. 5' blue, orange, blue, blue, orange 3' turns into 5' blue, blue, blue 3' 1. What do the orange bars represent? 2. What do the blue bars represent? 3. What is missing from the figure above for it to be a mature mRNA?

1. introns 2. exons 3. 3' poly- A tail

Indicate the types of bonds that connect the compounds or molecules below. (6pts) Electronegativity values are: H 2.2, C 2.5, N 3.04, O 3.4, K 0.8, Cl 3.2 1. ______ NH3 2. ______ CH4 3. _______KCl 4. _______ Guanine pairing with Cytosine via this bond 5. ________CO2 6. _________A protein's secondary structure is defined by this type of bond

1. polar covalent 2. nonpolar covalent 3. ionic 4. hydrogen bond 5. nonpolar covalent 6. hydrogen bonds

1. Class of macromolecule 2.Name of macromolecule's monomer subunit 3.What does R symbolize in this macromolecule 4.The name of the bond that connects the monomers is

1. protein 2. amino acid 3. side group 4. peptide

A replication fork is shown below. Helicase is a(n)_____ and in this picture would be moving in the direction._______ pic: 3' on top the smaller opening is on the right and the huge opening is to the left

1. protein 2. left to right

Which number represents the pH of a solution with the highest concentration of hydrogen ions?

1.0

Potassium is important in neuron function and osmotic regulation. Find Potassium on the periodic table. The symbol is K .How many protons ______ and electrons __________ are in a Potassium atom? (uncharged).How many protons _______and electrons ___________ are in the Potassium ion (K+)?

1.K atom proton number ~ a 2.K atom electron number ~ a 3.K ion proton number ~ a 4.K ion electron number ~ b a.19 b.18

State what specific types of bonds are formed in the molecules shown below. (Electro-negativities of the atoms are listed).

1.PO4 (electronegativity of P is 2.19, O is 3.44) ~ a 2.CH3(electronegativity of C is 2.5 and H is 2.1) ~ c 3.KBr (electronegativity of K is 0.8, Br is 2.96) ~ b 4.HCl (electronegativity of H is 2.1, Cl is 3.2) ~ a a.polar covalent b.ionic c.non polar covalent

Carbon as it appears on the periodic table is shown below. Match the statements below with the correct answers. Carbon has an atomic number of___________ and ___________ protons. In its uncharged form, carbon has ___________________ electrons.

1.atomic number ~a 2.protons ~a 3.electrons ~a a. 6

Complete the matching exercise below by choosing the CORRECT description of each bond type in aqueous solution.

1.electrons shared by atoms ~a 2.an interaction of a partially positive hydrogen atom and an electronegative atom ~b 3.an interaction between oppositely charged ~c a.covalent bond b.hydrogen bond c.ionic bond

Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r), and having freckles (F) is dominant to having no freckles (f). If a woman heterozygous for both traits married a man with no freckles who couldn't roll his tongue, what is the probability that they would have a freckled, tongue-rolling child?

1/4

A change in one pH unit corresponds to a ______-fold change in hydrogen ion concentration? (Hint: Read explanation of pH on page 36 of your textbook)

Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial DNA. If the cytosine content of DNA from the bacterial cells is 40%, what is the adenine content?

10%

A solution of pH 5 contains_____________H+ than the same amount of solution at pH 3

100 times less

How many hydrogen atoms are present in a hydrocarbon chain of five carbons joined to each other by single covalent bonds?

You are given two true-breeding groups of gerbils. The gerbils in the first group have black fur and curly tails; the gerbils in the second group have yellow fur and straight tails. When you produce an F1 generation, you see only gerbils with black fur and curly tails. When you produce an F2 generation, 75% of the gerbils have black fur and 25% have yellow fur. You also see that 25% of the gerbils have straight tails and 75% have curly tails. If the single alleles responsible for fur color and tail appearance sort independently, how many of the black gerbils in this generation are expected to have straight tails?

18.75%

An organism has five independent (unlinked) genes and the following genotype: AABbDdeeff. How many different gametes could this organism produce?

The boring tissue of the clam (aka pedal mantle) reduces the pH of the coral surface by how many pH units?

Imagine you are following a particular tRNA, called tRNAQ, through the process of translation in a eukaryote. Consider the steps of tRNAQ translation. In what order does tRNAQ go through the following steps listed? Note that some steps may be used more than once .1. The polypeptide is transferred to tRNAQ. 2. tRNAQ binds the A site of the ribosome. 3. tRNAQ binds the P site of the ribosome. 4. The ribosome shifts, with tRNAQ still bound. 5. tRNAQ binds the E site of the ribosome.

2, 1, 4, 3, 4, 5

When full, the innermost electron shell of an atom contains _________ electrons, and the next shell contains ________ electrons.

2; 8

When full, the innermost electron shell of an atom contains _________ electrons, and the next shell contains ________electrons.

2; 8

The cell above can be designated as a circle with 6 single straight lines that vary in size BUT there are 3 pairs, meaning 2 lines are the same size 3 times

2n=6

An mRNA molecule has a sequence5'—CAGAUCUAAUGCUUAUCGGAU—3'.

An mRNA molecule has a sequence5'—CAGAUCUAAUGCUUAUCGGAU—3'.When translated in a laboratory setting where translation can be initiated anywhere along the molecule, how many reading frames are possible?

In a typical land plant chloroplast, how many different membranes are present?

Read the scenario: You get in your car to drive to class. You turn the key, and the engine starts making a clicking sound, but does not start (1). You think to yourself, "The battery must be dead" (2). So, you borrow the battery from your neighbor's car (with permission, of course) and exchange it for the one in your car (3). You figure that if the battery in your car is dead and you replace it then the car will start (4). You get in the car again, turn the key, and the car starts right up (5), and you make it to class on time. Notice that there are numbers at the end or parts of some of the sentences in the scenario. Refer to these numbers when answering the question. Which sentence, or part of a sentence, in the story is an experiment?

Which strand listed below is the complementary strand to this DNA strand: 5' ATCTCTGG 3'

3' TAGAGACC 5'

In a DNA strand, successive nucleotides are linked by:

3'-5' phosphodiester bonds.

In transcription, a template strand of DNA is read in the ______________ direction in order to direct synthesis of RNA in the ______________ direction.

3'-5'; 5'-3'

A template DNA strand contains 30% A, 20% T, 27% G, and 23% C. The RNA transcript contains:

30% U, 20% A, 27% C, and 23% G.

An organism's genome is analyzed and found to contain 18% guanine. What percentage of that organism's DNA is adenine?

32%

If it were determined that the sugar-phosphates making the nucleotides in alien nucleic acid were similar in nature to those found on Earth, how many phosphate groups would be found in the piece of alien DNA with 160 nucleotides per strand?

320

If a double-stranded DNA sample were composed of 15% cytosine, what would be the percentage of thymine?

35%

Referring to the following mRNA sequence, 5'—AUGAGACUUACCGAA—3', what would the anticodon look like if the second nucleotide of the fourth codon was mutated to U?

3′--UAG--5′

The FoxP2 gene is thought to be involved in language in humans. At prophase I, how many copies of the FoxP2 gene are present in a cell? Keep in mind that humans are diploid.

4 copies; 1 on each sister chromatid in a pair of homologous chromosomes

Which of the answer choices is true about ATP synthase?

ATP synthase is an integral membrane transport protein.

The nucleotide sequence of the codon used to initiate protein synthesis is

AUG

Consider the events that describe the progress of a protein that will be secreted from the cell. Which of the following sequences of events correctly? 1. SRP binds to the growing polypeptide chain and to the ribosome. 2. Translation resumes. 3. SRP binds to its receptor. 4. The signal sequence is cleaved. 5. Protein synthesis begins in the cytosol. 6. Translation pauses.

5 → 1 → 6 → 3 → 2 → 4

In translation, a template strand of RNA is read in the _______________ direction in order to direct synthesis of a polypeptide in the _______________ direction.

5' > 3'; N > C

Given the DNA template strand of 3' TAC 5', the anticodon on that pairs with the corresponding mRNA will be

5' AUG 3'

A double-stranded DNA molecule, only part of which is shown, is being transcribed. If the molecule is transcribed from left to right, one of the nucleotides shown in bold would be the first transcribed in this small molecule.5'—ATGATCGGATCGATCCAT—3'3'—TACTAGCCTAGCTAGGTA—5' Which sequence is the correct mRNA produced from the transcription of this DNA molecule?

5'-AUGAUCGGAUCGAUCCAU-3'

Assuming A-U and G-C pairing between the anticodon and the codon, what anticodon in tRNAMet would pair with the codon 5'-AUG-3'?

5'-CAU-3'

A template DNA strand contains the sequence 5'-ATGCTGAC-3'. The corresponding sequence in the RNA transcript is:

5'-GUCAGCAU-3'.

The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. (4pts)

5'CAU3' ; 5'UUG3' ; 5'AGA3'

You have a solutiin with a Hydrogen Ion concentration of .000001. What is the pH of this solution?

The random alignment of maternal and paternal homologous chromosomes during metaphase I is one of the ways genetic variability among gametes comes about. For example, it is possible for an organism with 4 pairs of homologous chromosomes to produce gametes with up to 16 different combinations of maternal and paternal chromosomes (24= 16). In the case of humans with 23 pairs of chromosomes, there are over 8 million possible combinations. How many possible combinations of maternal and paternal chromosomes are possible in the gametes of an organism with 6 chromosomes?

A double-stranded piece of alien nucleic acid has been isolated. Each individual strand of the nucleic acid is 160 nucleotides long; for a total of 320 nucleotides in the isolated piece of nucleic acid. An initial analysis shows that of the 320 nucleotides, 95 contain the base uracil.How many nucleotides containing the base isoAdenine (iA) would be found in the isolated piece of double-stranded nucleic acid?

Examine the figure shown, which depicts a stage in the process of translation in a eukaryote.

A polypeptide bond is formed between the arginine and the valine, transferring the polypeptide to the A site.

Which statement is true of DNA?

A purine always forms a complementary base pair with a pyrimidine.

Atractyloside is a poison that inhibits the transport of ADP from the cytosol across the mitochondrial membranes and into the mitochondrial matrix. The direct effect of this drug is to stop ATP synthesis because:

ADP is a necessary substrate for the reactions catalyzed by ATP synthase.

Among the list below, which shows a pair of synonymous codons? (Use a table of the standard genetic code to answer this question).

AGG and CGA

A cell cycle "checkpoint" would be best described as:

ALL of these choices are correct ^^^^^^^^^ - a site in the cytoplasm where proteins are inspected for mutations. - either G1, S, G2, prophase, metaphase, anaphase or telophase. - specific stages where further progress of the cell cycle can be halted. - any step where the cell cycle is blocked by a mutated protein.stages - where progress of the cell cycle can be halted.

1. In fruit flies, brown body color (B) is dominant to black body color (b). You have an individual fruit fly with a brown body, but you do not know their genotype. To determine the genotype of the brown body fruit fly, you do a test cross. This means you cross the brown body fruit fly with ______ 2. Before the test cross, you know that the brown body fruit fly has the genotype _______ 3. The first offspring is brown-bodied. This result shows you _______ 4. The second offspring is black-bodied. This result shows you _______ 5. The probability of the third offspring being brown-bodied is __________

ALL these are WRONG 1. a Bb fruit fly 2. BB or Bb 3. that the brown-bodied parent was Bb 4. that the black-bodied parent was bb 5. 1/8

The hydrolysis of _____ is an exergonic reaction that drives many endergonic reactions in a cell.

ATP

Class 3: Chemistry of Life: Pre-Class Assignment

Aliens on Earth? The #arseniclife Affair In November of 2010 you stumble upon a NASA press release that in one month they will hold a news event that will "discuss an astrobiology finding that will impact the search for evidence of extraterrestrial life". On D-day on stage at this event is a young postdoctoral researcher, Felisa Wolfe-Simon. Felisa's interests in the "big questions" about life (e.g., why life is the way that it is, and why its chemistry is the way that it is) lead her to consider why phosphorus, often in the form of phosphate in the cell (that is, a phosphorus atom linked to four oxygen atoms), was chosen during the course of evolution to form many biological molecules. Phosphorus is found in DNA, RNA, ATP, and lipid in membranes, and is used to "tag" proteins and change their activity (i.e., protein phosphorylation). In particular, she considered the fact that phosphorus is not very abundant at the bottom of the ocean, where life is commonly believed to have originated. Could another atom have done the job early in the evolution of life? Might some life forms have evolved using another atom in the place of phosphorus and still exist today? If so, which atom are they using? Knowing a bit of chemistry, it's easy to predict which atom could take on a similar role in the molecules of life. The Periodic Table of Elements (page 32 of your textbook) classifies atoms based on their characteristics, and atoms in the same column (called group) often share similar properties. One of the elements you should have found during this search is As or arsenic, a poison. The reason that arsenic is so poisonous to us is precisely because it "looks like" phosphorus to our cells. Arsenic and phosphorus share many chemical properties, but they are also different, and when our cells try to use arsenic, things go badly. But this might not be the case for an organism that has evolved to use arsenic. Felisa's goal was to find life on Earth that might be able to use arsenic instead of phosphorus as a proof of principle that life can arise using other biomolecules.

Fatal familial insomnia is a prion-based genetic disorder of the brain. Which of the following evidence supports this theory?

All of the above ^^^^^^ - The disease runs in families - Prion protein aggregates are seen in the cells of the thalamus of patients. - Patients with this disease have specific mutations in this gene.

Homologous chromosomes

All of these answers are correct ^^^^^^^^ - come from different parents - have very similar DNA sequences - may have different alleles - have the same genes

What properties are associated with a malignant cancer?

All of these choices are correct ^^^^^^ - It invades surrounding tissue. - It is metastatic. - It is fast growing.

What factors are required for net movement of a substance to occur by facilitated diffusion?

All of these choices are correct ^^^^^^ - a concentration gradient - a transport protein - a plasma membrane

Proteins can be used for which cellular roles?

All of these choices are correct ^^^^^^ - cell signaling. - biological catalysis - structural support - cell communication

Cell cycle checkpoints:

All of these choices are correct ^^^^^^ - provide opportunities to check if the cell has carried out steps necessary for cell division. - act as a brake on cell division if something is not right. - can be blocked by the protein p53.

Which of the following choices would block the process of DNA synthesis by DNA polymerase?

All of these choices are correct ^^^^^^ - removal of the 5' triphosphate from the nucleotides used by DNA polymerase - removal of the 3'-OH from the last nucleotide of the daughter strand - removal of the base from the nucleotides used by DNA polymerase - removal of DNA ligase from the DNA replication process

Transcription of RNA from DNA in eukaryotes requires:

All of these choices are correct ^^^^^^ - transcription factors. - a promoter sequence. - activator proteins. - RNA polymerase

The interactions between amino acids are major factors in determining the shape of a protein. These interactions can be affected by the environment surrounding a protein. Which factor would have an effect on the shape of a protein?

All of these choices are correct ^^^^^^ - the pH of the environment - whether the other molecules in the environment are predominantly hydrophilic or hydrophobic - the concentrations of ions present in the environment - the temperature of the environment.

The strands in a double helix of DNA are:

All of these choices are correct. ^^^^^^ - held together via hydrogen bonds. - wound around each other with 10 base pairs per turn. - antiparallel - complementary.

The second meiotic division resembles mitosis because:

All of these choices are correct. ^^^^^^ - sister chromatids are separated during anaphase II to become the chromosomes of the daughter cells. - spindle microtubules attach from opposite directions to the centromere of each sister chromatid pair. - the daughter cells have the same number of chromosomes as the parent cell. -chromosomes decondense during telophase II.

If you crossed two heterozygous yellow-seed pea plants (genotypes Aa), the relative frequency of:

All of these choices are correct. ^^^^^^ - the A allele in each parent's gametes would be 1/2. - the a allele in each parent's gametes would be 1/2. - green-seed plants (genotype aa) would be 1/4. - homozygous yellow-seed plants (genotype AA) would be 1/4.

Which of the choices is/are considered traits?

All of these choices are correct. - fur color in cats - leaf shape in trees - beak size in owls - height in humans

Why does active transport of molecules across a membrane require ATP?

An input of energy is needed to allow the movement of molecules from an area of low concentration to one of higher concentration.

Why does active transport require ATP?

An input of energy is needed to allow the movement of molecules from an area of low concentration to one of higher concentration.

Why does ADP have less potential energy than ATP?

Because ADP has only two phosphate groups.

If FRAP is performed on two membranes, one at 25ºC and the other at 40ºC, which one of the following results would most likely be observed?

Both membranes would recover fluorescence in the bleached area, but the membrane at the warmer temperature would recover more rapidly.

Protein polarity is described as having an N-terminus and a C-terminus. Consider a ribosome that is actively engaged in translation. As the ribosome moves along the mRNA, the protein grows at the ________ terminal end by addition of the amino acid that is bound to the tRNA at the _______ site.

C-terminus, A site

Use HONC 1-2-3-4 from covalent bond mnemonic from class. Which of the following hydrocarbons has a double bond in its carbon skeleton? (Hint: Draw out the molecules with the numbers of H and C shown in the formula. Focus on the HONC rules. Which of these molecules will have a double bond in it to meet the HONC rules.)

C2H4

Which molecule would most likely require a transport protein to cross the plasma membrane of a red blood cell?

C6H12O6

A graduate student is planning an experiment to evaluate the expression of PDGF-related genes in her cell population of interest. As a control, she hopes to confirm the expression of genes that are present in all dividing cells. For her controls, she should evaluate the expression of:

CDKs.

What do you deduce from Figure 1 of the linked reading? Choose the single best answer.

CMV and cTnT have different DNA regulatory (promoter) sequences

Which of the molecules is classified as an organic molecule?

CO2

During photosynthesis, _____ is reduced to _____.

CO2; sugar

At physiological pH, the ionized state of the carboxyl (COOH) group in the R group of aspartic acid is:

COO-.

What unique property of carbon enables this element to be "life's chemical backbone"?

Carbon behaves as if it has four valence electrons.

Which of the choices is a characteristic of meiotic cell division?

Cell division results in the production of gametes.

During photosynthesis in plants and algae, ____ is oxidized and ____ is reduced.

H2O; CO2

Felisa is looking for life forms on Earth that might use arsenic instead of phosphorus. What kind of environment might Felisa begin her search for these life forms?

High arsenic environment like Mono lake and Searles Lake in California

Which of the following enzymes is the first to bind to the DNA sequences at the origin of replication?

DNA helicase

What is the central dogma?

DNA is transcribed into RNA, which is translated into protein.

Which of the following statements below correctly describe the role of the protein during DNA replication? Select all that apply

DNA polymerase adds dNTPs on the newly synthesized strand

Assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA template, the RNA transcript, and the protein product?

DNA template 3'- ......... -5'RNA transcript 5'- ......... -3'Protein product H2N- ......... -COOH

Predict what would happen if crossing over between homologous chromosomes occurred as part of mitosis.

Daughter cells would not be genetically identical.

In a normal non-genetically modified organism, how can different proteins be expressed in different tissues??

Different cells have different transcription factors.

Agrobacterium is a bacterium that infects plants and causes them to form tumors. You are asked to determine how long a plant must be exposed to these bacteria to become infected. Which of the following is an appropriate CONTROL for the experiment?

Do not expose the plant to Agrobacterium and measure how many tumors are formed.

If you analyze the sequences of the two copies of any of the chromosomes shown in the karyotype, there would be slight sequence differences. What could account for the small differences between a few of the homologous chromosomes?

Each homologous chromosome in a pair is from a different parent.

Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for a new type of synthetic cell. During your brainstorming sessions, you propose that polycistronic mRNA inserted directly into the synthetic cell would be much more useful than mRNA that is only translated into one protein. This would allow for multiple proteins necessary for a particular function to be translated together. One of your colleagues says that is a good idea, but if you decide to go with polycistronic mRNA, you had better make sure to use a prokaryotic translation system. Why might it be problematic to use a eukaryotic translation system with polycistronic mRNA?

Eukaryotic ribosomes initiate translation by binding to the 5' cap, which is only found in eukaryotic mRNAs.

Purified phospholipids gather together and form membranes only if the appropriate enzyme is present.

False

True or False: People with Fatal familial insomnia harbor the prion gene mutation in only the cells of the thalamus.

False

The reporter says that kids born to couples 1 and 2 will all be genetically identical. Is this true or false and why?

False, because independent assortment, crossover and random fertilization ensure genetic variation

Thermogenesis has been studied the plants in the genus Arum, including skunk cabbage and the corpse flower. In these plants, what biological process is most strongly associated with heat production?

Flowering and pollinator attraction.

What do prions tell us about protein function?

Folded proteins are more stable

Which of the statements applies to frameshift mutations?

Frameshift mutations change the amino acid sequence downstream from the site of the mutation

When nutrients are suboptimal for cell growth and division, the cell cycle arrests. At which stage of the cell cycle/checkpoint would you predict this arrest to occur?

G1 checkpoint

The correct sequence of steps in the eukaryotic cell cycle is:

G1→ S phase → G2→ mitosis → cytokinesis.

The Amoeba Sisters video on the pre-class page is long but it is a great introduction. Three cell cycle check points are discussed. In which of these check points does the cell assess whether DNA has been replicated correctly?

Secondary active transport in yeast and plant cells uses the _______ concentration gradient, whereas animal cells use the ______________ gradient.

H+ .... Na+/K+

In plants and algae, ____ is the source of the electrons needed for photosynthesis.

H2O

Which of the following sequences accurately represents the flow of electrons through living organisms?

H2O → photosynthesis → carbohydrate → cellular respiration → H2O

Class 4 Water: Pre-Class Assignment

How important is Water in our daily life and to life on our planet? What happens when you have too little water or too much water? In class 4 we will focus on the water-the molecule, its properties and its impact on biomolecules and life. We will begin by reading about a case of Cynthia Lucero, a Boston marathon runner who died from "too much water". Read THIS ARTICLE and answer the questions below. https://ptsportswellness.wordpress.com/2011/08/26/hyponatremia-the-athletes-drinking-problem/

Several chemical properties make water uniquely suited for its role as a central "molecule of life". Which statement is FALSE?

Hydrogen bonding leads to high cohesiveness between water molecules

Which of the following statements describes translation initiation in Eukaryotes:

Initiation factors, a tRNAmet, and the ribosome's small subunit bind to the 5'cap of mRNA.

What is the unique ability of the giant clam Tridacna crocea?

It can bore fully into coral rock

Which one of the statements regarding the S cyclin-CDK complex is true?

It ensures that DNA is not replicated multiple times.

You have an aqueous solution with a pH of 8.0. You add sodium chloride to a concentration of 1 gram per 100 millilitres. What happens to the pH?

It stays the same.

Why would a compound that interferes with bacterial cell wall synthesis be useful for treating a bacterial infection?

It would limit growth of the bacterial population through cell division.

Which process is an example of the first law of thermodynamics in action?

Light energy is transformed into chemical energy during photosynthesis.

What is hyponatremia?

Low concentration of sodium in your body fluids

Acidic=_____________pH=_______________H+ concentration=_____________ number on the pH scale.

Low; High; Low

Examine the data shown in figure 2, and use these data to select the single best description of the data that is shown.

MRP2 mRNA was more abundant in some NSCLC tumor cell line samples and patient samples, but not in SCLC tumor cell lines or patient samples.

Why is MRSA referred to as a "super bug"?

MRSA is resistant to many antibiotics

You are asked to determine how long a cell must be exposed to viruses called TUV to become infected. Which of the following experiments will provide the best data to address that question?

Measure the number of infected cells after they are exposed to a known concentration of TUV for different lengths of time.

Measure the number of tumors formed on plants, which are exposed to a known concentration of Agrobacterium solution for different lengths of time.

When oxygen is depleted, the citric acid cycle stops. What could we add to the system to restore citric acid cycle activity (other than oxygen)?

NAD+ or FAD

Which example is an electron carrier in its reduced form?

NADH

Which example represents the reduced forms of the two major electron carriers?

NADH and FADH2

Following the citric acid cycle but before the electron transport chain and oxidative phosphorylation, most of the energy from the original glucose molecule is found in:

NADH.

If the RNA transcript 5'-AUGAUCGGAUCGAUCCAU-3' is present and translated codon by codon from one end to the other, which of the following polypeptides would correspond to this part of the mRNA? Use the table shown to answer this question.

NH2- Met-Ile-Gly-Ser-Ile-His -COOH

At physiological pH, the ionized state of the amino (NH2) group in the R group of lysine is:

NH3+.

You've noticed that when your cat is napping she often curls up and puts her tail over her nose. This morning it was quite warm and you notice she does not have her tail over her nose. You think perhaps she does this when it's relatively cold in your apartment, to keep her nose warm. Scientifically, this is a good example of a(n)

NOT: theory maybe hypothesis

The pre-class write-up on described research that investigated the basis for Multi-Drug Resistant tumors. Which statement below accurately describes the drug resistance of these two cell lines.

NSCLC showed greater resistance to all four drugs than SCLC.

It is often stated that the phosphate-phosphate bonds in ATP are "high energy," but in fact, they are not notably high in energy. Rather, they are easy to break, and the ΔG of hydrolysis is a "useful" quantity of energy. What makes the phosphate bonds easy to break?

Negative charges on phosphate groups repel each other.

What would happen if complexes I-IV of the electron transport chain pumped protons in the opposite direction?

No ATP would be synthesized.

Humans are often referred to as "carbon-based" life forms. Given that humans breathe oxygen, shouldn't humans be referred to as "oxygen-based" life forms?

No, because carbon is the most abundant element in human cells, not oxygen

Do all plants exhibit thermogenesis?

No, it is rare, and only found in a couple groups of plants.

You have learned that mutations can occur in DNA sequences. Are all mutations deadly?

No, some mutations can have no effect or can be beneficial

Toxoplasmosis (a parasitic disease) can be transmitted from cat feces to humans when they clean the litter box. If a woman has an active toxoplasmosis infection early in her pregnancy her offspring may also become infected. The infection in the offspring can damage the developing eye and brain among other things. Is this a good example of inheritance of an acquired trait?

No, the infection affected specific aspects of development but not the genes in the offspring.

The function of a protein is dependent upon the shape into which the chain of amino acids folds. Many noncovalent interactions are responsible for maintaining the protein's shape. Assume you have isolated a protein from an organism in its proper shape, and you have treated it with an enzyme that selectively targets and breaks only the peptide bonds in the proteins. Would the protein retain its shape under these conditions?

No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together.

_____ are the subunits of nucleic acids, and _____ are the subunits of proteins.

Nucleotides; amino acids

In plants and algae, which of the answer choices is a by-product of photosynthesis?

Recall that a carbon atom behaves as if it possesses four valence electrons. Given this information, what is the most likely structural formula for carbon dioxide (CO2)?

O=C=O

Which order accurately reflects the process of science as described in your textbook?

Observation -> question -> hypothesis formulation -> experiment -> support or refute hypothesis

Which one of the statements best represents the relationship between cellular respiration and photosynthesis?

Photosynthesis stores energy in organic molecules, whereas cellular respiration releases it.

Which one of the following statements BEST represents the relationship between cellular respiration and photosynthesis?

Photosynthesis stores energy in organic molecules, while respiration releases it.

What is the name of the enzyme complex that forms at the start of transcription?

RNA polymerase

Which example correctly lists the components necessary for eukaryotic transcription?

RNA polymerase, general transcription factors, DNA, and RNA nucleotides

Which statement about RNA is correct?

RNA uses the same purine bases as DNA.

Class 5 pH: Pre-Class Assignment

Read the small new piece published in the New York Times below that describes a very unique clam. Follow it up by reading the original research article that investigated the acid secretion properties of the clam. You only need to read the abstract and the introduction of the research article to answer the questions in the assignment. Acid secretion by the giant clam.pdf

Which property of life concerns occasionally making mistakes, which sometimes (albeit rarely) are more suited to the changing environment?

Responds to a changing environment and regulates functions

Suppose that in humans the ability to roll the tongue (R) is dominant to being unable to roll it (r). Having freckles (F) is dominant to having no freckles (f). A freckled tongue-roller could have which genotypes?

RrFf RRFF

A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely:

S phase.

In the periodic table below (Fig 2.3) find the symbol for Phosphorus. Select two elements below that are in the same group and would have similar properties to Phosphorus.

Sb N

What would Felisa need to show in order to convince other researchers that a life form uses arsenic in its cells and does not merely survive in the presence of (or tolerate high levels of) arsenic?

Show that an organism can grow in presence of arsenic and no phosphorus and incorporate arsenic into its biomolecules.

(see pages 168-169, we did not get to this in lecture yet) RUBISCO can be described as a lousy enzyme because:

Sometimes it carries out a reaction with the wrong substrate, leading to a waste of energy.

If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level?

The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.

What is thermogenesis as it relates to plants?

The ability to produce heat in plants.

Two petri dishes of radish seeds are prepared as follows: A disk of absorbent, but otherwise inert, filter paper is placed in the bottom of each dish. Next, 5 mL of distilled water are added to each disk. Then, two grams of dry radish seeds are spread over each moist disk. One dish is put in a dark cupboard, and the other is put on a sunny windowsill. The investigator checks the dishes daily and adds water equally as needed. Seeds in both treatments germinate within 2 days. At the end of 10 days, the plant material on each petri plate is dried and weighed. The results are:

The additional mass came from the carbon and oxygen atoms present in the CO2 it took up during photosynthesis, which it used to synthesize organic molecules.

Which statement best summarizes cellular respiration?

The chemical potential energy stored in organic molecules is converted to chemical energy that can be used to do the work of the cell.

Consider the diagram. What is wrong with this diagram of secondary structure in a polypeptide chain? Hint: In the representation of β sheets as paired arrows, the convention is that the amino end is at the base of the arrow and the carboxyl end is at the tip. 2 arrows up

The directionality of the polypeptide chain reverses orientation between the arrows representing a β sheet.

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen?

The gene would not be transcribed

Although the phospholipid molecules can be in constant lateral movement, they very rarely flip from one side of the bilayer to the other. Which of the answer choices could explain this?

The head groups are repelled by the hydrophobic membrane interior.

The thylakoid membrane is:

The inner-most membrane of the chloroplast

For an atom that is not an ion, which statement must be true?

The number of electrons equals the number of protons.

Which of the following statements must be true in order for mitochondrial ATP synthase to function properly?

The pH of the intermembrane space must be lower than the pH of the mitochondrial matrix.

Based on the molecular structure of ATP, what predictions can you make about its behavior in the cell: The phosphate functional group, as seen in ATP, is ionized at typical cellular conditions. In what way would this contribute to a cell's internal pH?

The pH would become more acidic.

A woman's doctor tells her to gargle with salt water. She stirs a tablespoon of salt into a cup of warm water and watches the salt dissolve. Why does the salt dissolve in water?

The partial positive charges on hydrogen atoms in water molecules are attracted to chlorine ions, and the partial negative charges on oxygen atoms in water molecules are attracted to sodium ions.

Predict how phospholipids would arrange if they were placed in a nonpolar solution rather than a polar solution like water.

The phospholipid tails would orient toward the solution, and the heads would cluster away from the solution.

Why does a phospholipid on the cytoplasmic side of the cell membrane rarely flip to the extracellular side if both environments are polar?

The polar head group cannot pass through the nonpolar interior.

Imagine that a rancher has a herd of cattle with brown hides and short horns. All of his cattle are also relatively short in stature. If all of these were true-breeding traits, what could you say about the progeny of these cattle?

The progeny of these cattle will be short in stature and have brown hides and short horns.

What structural changes happen in abnormal prion proteins?

The protein has more beta-pleated sheets

(Read the page linked above before answering this question. Also refer to figure 4.2 of your textbook and apply what you learned from module 1.) Compare the properties of the amino acid at position 257 in the wild type and the D257A mutant and determine which of these statements is TRUE.

The side chain changed from one that is acidic to one that is nonpolar.

You are investigating a mutant eukaryotic cell line that makes all of its mRNAs much longer than the mRNAs from normal cells. Intrigued, you examine the proteins in these cells and note that many of them are either much longer or much shorter than the normal proteins from nonmutant cells. Assuming there is just one mutant defect in these cells, which of the possibilities is most likely?

The spliceosome is nonfunctional.

Several chemical properties make water uniquely suited for its role as a central "molecule of life". Which statement is FALSE?

The structure of a water molecule is stabilized by hydrogen bonds.

The β sheet has two amino ends.

A beaker contains two solutions of salt dissolved in water. The two solutions have different concentrations of salt (measured by molarity, M) and are separated by a membrane that is permeable to both salt and water. The salt and water will move through the membrane by diffusion.

There will be a net movement of salt from side B to side A and net movement of water from side A to side B.

A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells?

These cells likely contain damaged DNA.

Imagine that you have crossed two types of peonies, one with purple flowers and long stems, and the other with white flowers and short stems. When you cross these flowers, you get the following numbers of progeny: 83 with purple flowers and short stems; 29 with purple flowers and long stems; 26 with white flowers and short stems; and 9 with white flowers and long stems. Based on these data, what can you say about genes that define flower color and stem length?

These genes sort independently.

The study of MDR tumors led to identification of MRP genes, which encode proteins that are normally located on the surface of cells, and are normally highly expressed in human intestine, brain, liver, placenta, and kidney. The proteins bind to ATP, and use the energy of ATP hydrolysis to transport cellular waste products out of the cell. Why do you think these proteins confer resistance to multiple different drugs when they are over-expressed?

These proteins move select chemotherapy drugs out of the cells, preventing their activity.

In order to test the effects of a new drug, you isolate the messenger RNA molecules from both treated and untreated eukaryotic cells and separate them according to size, using gel electrophoresis. In each lane of the gel, the shorter RNA molecules migrate more quickly through the gel and end up near the bottom of the gel, whereas the longer RNAs migrate more slowly and remain near the top.The samples that were loaded into each of the four lanes are as follows:Lane 1: the primary RNA transcripts isolated from the nucleus of untreated cellsLane 2: the primary RNA transcripts isolated from the nucleus of cells treated with the drug being testedLane 3: RNA isolated from the cytosol of untreated cellsLane 4: RNA isolated from the cytosol of cells treated with the drug being testedWhich conclusion is most likely to be correct?

These results suggest that the drug affects RNA processing.

Which of the statements describes catabolic reactions?

They are exergonic and have a negative change in free energy.

How do you think round-up ready plants avoid being killed by glyphosate?

They are genetically modified by incorporating different version of EPSPS that doesn't bind glyphosate.

Which of the following is NOT a characteristic of the abnormal prion protein?

They are spongy proteins

The concentration of NaCl inside a red blood cell is 9%. Which of these describes the results if red blood cells are placed into a 0.9% solution of NaCl?

They will burst

A 0.9% NaCl solution is isotonic (aka same concentration) to red blood cells. Which of these describes the results if red blood cells are placed into a 9% solution of NaCl? (Hint: Think osmosis. Draw it out. Show salt and water and figure out where there is more water and then how water will move.)

They will shrink

After meiosis, which of these are NOT possible genotypes for the sperm from aaBbccDd? (Assume that each gene assorts independently)

aBCD

Promoters of many genes have mostly adenines and thymines. What is the most likely reason for this high proportion of adenines and thymines?

This is the region where template and nontemplate strands separate, and A-T base pairs require less energy to separate than G-C base pairs.

(Read the page linked above before answering this question) Using the provided data in the table as support, determine the effect of the D257A mutation?

This mutation abolished the proofreading activity of the polymerase.

Transcription factors are proteins that bind promoter sequences and help transcription. What do you conclude after seeing Figure 2 of the linked reading? Choose the single best answer.

Transcription factors that bind cTnT promoter sequences are much more abundant or active in heart cells.

What would happen if an enhancer sequence were mutated so that its binding partner was always bound and recruiting the RNA polymerase complex?

Transcription would occur continuously.

Alleles are alternate molecular forms of a gene.

True

Amino acids with hydrophobic side chains are often found in the region of an integral membrane protein that spans the membrane.

True

In the sequence 5'-AGGCCT-3', an available phosphate group would be found at the nucleotide labeled "A."

True

Part of the reason why salt dissolves in water is that hydrogen bonds form between water molecules and chlorine ions.

True

The sequence of amino acids in a protein is referred to as its primary structure.

True

True or False: There is not a one-size-fits-all solution for the problem of how much to drink for endurance runners.

True; there are many factors to consider such as sweat rate and temperature.

In what order do the stages of mitosis occur?

V > II > IV > I > III

One of your friends is arguing that viruses are alive. What information would you provide to convince him that viruses can't be considered alive?

Viruses cannot carry out metabolic reactions on their own.

If a sample of RNA contains 15% guanine, how much cytosine does it contain?

We cannot determine from this information

Could silicon-based life ever exist within the universe?

Yes, as silicon is in the same family as carbon and elements in the same family have similar properties, although silicon-based life is unlikely given the interaction between silicon and oxygen.

Which of the following is NOT a component of a nucleotide?

a carboxyl group

In the metabolic pathway illustrated, the reactant (substrate A) is converted equally to one of two end products, E or G. Use the diagram of the pathway to answer the questions Letters indicate the substrates and products, and numbers indicate the enzymes. In this pathway, the intermediate, C, is a substrate for both enzyme 3 and enzyme 5 and is converted with equal efficiency to D and F.

a decrease in the production of E and G

A mutation takes place in a protein-coding gene that changes one codon resulting in a single amino acid replacement. Which type of replacement is most likely to result in a disruption of protein structure and function

a hydrophobic amino acid to a hydrophilic amino acid

Any heritable change in the genetic material is ____________.

a mutation

A mutation takes place in a protein-coding gene that changes one codon resulting in a single amino acid replacement. Which type of replacement is least likely to result in a disruption of protein structure and function?

a polar amino acid to a polar amino acid

Which choice is considered an integral membrane protein?

a protein with its amino-terminus in the cytoplasm and its carboxy-terminus in the extracellular space

Energy released by transferring electrons along the electron transport chain is stored as potential energy in the form of:

a proton gradient.

A testcross of an organism of unknown genotype is done when the organism is crossed to another organism that is:

a recessive homozygote.

Transcription continues until:

a terminator sequence is encountered.

What type of protein is being activated by the G1/S cyclin-CDK complex to promote the expression of histone genes?

a transcription factor

Each sentence in the story below has a number. Refer to the numbers at the beginning of the sentences when answering the questions. These sentences are not necessarily in the correct order for the scientific method. (7pts) (1) A few years ago you noticed that your neighbor had a lot more tomatoes per plant than you did. (2) If I add more fertilizer to my tomato plants, I will get more tomatoes per plant. (3) My tomato plants are not getting enough fertilizer to produce more fruit. (4) This year, your plants produced more tomatoes per plant than last year. (5) This year you used fertilized your tomato plants regularly. Which sentence in the story is... (please indicate with the number) a. a result b. a hypothesis c. an observation d. a prediction e. a test Do your results support your hypothesis? (yes or no) What critical step are you missing above that would make your experiment more robust?

a. 4 b. 3 c. 1 d. 2 e. 5 yes the data analyzed

You have a solution with a Hydrogen ion concentration of 0.0000001 A. What is the pH of this solution? B. Is this solution acidic, basic or neutral?

a. 7 b. neutral

1.diploid cell: b 2.haploid cell: c 3.gene: e 4.allele: a 5.genome: f 6.DNA: d

a.is a variant form of a given gene. b.containing two complete sets of chromosomes, one from each parent. c.having a single set of unpaired chromosomes. d.deoxyribonucleic acid, a self-replicating material present in nearly all living organisms as the main constituent of chromosomes. It is the carrier of genetic information. e.a distinct sequence of nucleotides forming part of a chromosome, the order of which determines the order of monomers in a polypeptide or nucleic acid molecule which a cell f.the complete set of genes or genetic material present in a cell or organism.

Glycolysis is a series of chemical reactions (endergonic and exergonic) by which the cell can obtain ATP. NAD+ plays a crucial role in the reactions of glycolysis by:

accepting electrons from glucose, with the result that glucose is partially oxidized to pyruvate.

The plasma membranes of some plant cells use transport proteins to move protons out of the cell against their concentration gradient. This is an example of:

active transport.

The sodium-potassium pump is an example of:

active transport.

After meiosis, which of these are possible genotypes for the eggs from AaBbCCdd? (Assume that each gene assorts independently)

all of these are possible ^^^^^^ - AbCd - ABCd - abCd - aBCd

What factors are required for net movement of a substance to occur by facilitated diffusion?

all of these choices are correct ^^^^^^ - a plasma membrane - a transport protein - a concentration gradient

Phospholipids spontaneously form a variety of structures in aqueous solution. Which choice best describes this property?

all of these choices are correct ^^^^^^ - formation of lipid bilayers - the first cells - the ability of vesicles to fuse with the plasma membrane (exocytosis) - the ability of vesicles to bud off from the plasma membrane (endocytosis)

Niacin and Riboflavin, which are needed to make electron carriers NAD and FAD, are found in

almonds

Which has more calories per ounce?

almonds

Glyphosate is the active ingredient in the herbicide called ROUND-UP. What common biological molecule does glyphosate resemble?

an amino acid

The sodium-potassium pump is an example of:

an antiporter.

In the metabolic pathway illustrated, the reactant (substrate A) is converted equally to one of two end products, E or G. Use the diagram of the pathway to answer the question. Letters indicate the substrates and products, and numbers indicate the enzymes. In this pathway, the intermediate, C, is a substrate for both enzyme 3 and enzyme 5 and is converted with equal efficiency to D and F.

an increase in the production of E

an increase in the production of G

Recall that alleles of a single gene will segregate from one another during anaphase I. When do alleles for two different genes—located in two different chromosomes—segregate?

anaphase I

A mutation is

any change in the nucleotide sequence of the DNA

Organisms that are prokaryotes are in the domains

archaea and bacteria

Animals breathe in air containing oxygen and breathe out air containing less oxygen. The consumed oxygen is used:

as an electron acceptor in the respiratory electron transport chain.

At which checkpoint would a cell become arrested if a chromosome was not properly aligned in the spindle?

at a checkpoint early in the mitotic phase

Two semi-permeable membrane bags containing 40% glucose solution (bag A) and 20% glucose solution (bag B), respectively, are placed in a beaker containing 25% glucose. The bags are permeable to water but not glucose.

bag A will gain mass

Why do some plasma-membrane transporters use the energy of ATP move to ions against their concentration gradient?

because the concentration gradient allows some transporters to move other molecules against their concentration gradients.

Hydrogen bonds are attractions...

between atoms, each with opposite partial electrical charges.

Glyphosate affects plants because it:

binds to a biosynthetic enzyme and inhibits its activity.

Tetracycline kills bacteria by

blocking tRNA access to the ribosome (No translation)

The energy in a molecule of ATP that is harnessed to do the work of the cell is held in the:

bond between phosphate groups.

You find a way to attach either a red or green fluorescent dye to nucleotides. Double-stranded DNA molecules with both strands labeled red fluoresce red, those with both strands labeled green fluoresce green, and those with one strand labeled red and the other green fluoresce yellow. You grow human cells in the presence of "red" nucleotides until both DNA strands of all chromosomes fluoresce red. You then allow one round of DNA replication in the presence of "green" nucleotides. What pattern of fluorescence do you expect to see in the sister chromatids of each chromosome?

both chromatids yellow

How does meiosis generate genetic diversity?

both crossing over at prophase I and random alignment of homologs at metaphase I

The movement of water into, or out of, a cell is an example of:

both osmosis and diffusion.

A phospholipid molecule in a membrane can:

both spin (rotate around its vertical axis) and move side-to-side (lateral movement).

Recall that in Mendel's work, mating between yellow, wrinkled, seed-producing plants and plants that produced smooth green seeds resulted in a ratio of 9:3:3:1 for progeny phenotypes. This observed ratio can be explained by:

both the multiplication rule and the principle of independent assortment.

What cellular process(es) is/are responsible for the increase in protein content associated with the gap phases of the cell cycle?

both transcription and translation

Helicase is an enzyme that separates the double helix of the DNA into two separate strands. Helicase does this by________________.

breaking hydrogen bonds

Anabolic pathways of metabolism are pathways that:

build complex molecules from simple ones.

A double-stranded piece of alien nucleic acid has been isolated. Each individual strand of the nucleic acid is 160 nucleotides long; for a total of 320 nucleotides in the isolated piece of nucleic acid. An initial analysis shows that of the 320 nucleotides, 95 contain the base uracil. How many nucleotides in the piece of alien DNA would contain the base adenine?

cannot be determined

An organic molecule must contain which of the following elements?

carbon

Which one of the elements is found in every organic molecule?

carbon

Protein synthesis requires the use of mRNA, which

carries the information from DNA

insertions and deletions of single nucleotides:

cause frameshift mutations

Sister chromatids are held together by the

centromere

When carrying out a controlled experiment, it is important to:

change only one variable at a time.

Sugar monomers make up which of the four major macromolecules?

complex carbohydrates

Non-sister chromatids are:

copies of homologs but not fully identical chromosomes.

A pair of shared valence electrons is referred to as a(n):

covalent bond.

A sequence of (5')-CCA-(3') is found at the 3' end of all tRNAs. This portion of the tRNA can be found:

covalently linked to an amino acid.

Sexual reproduction increases the genetic variability of a population more than does asexual reproduction because of

crossing over

Which one of the choices is capable of phosphorylating key proteins involved in regulating the cell cycle?

cyclin-CDK complex

The amount of _____ is fairly constant throughout the cell cycle, but the amount of _____ varies.

cyclin-dependent kinases; cyclins

Chemicals called uncouplers can make membranes permeable to small molecules and ions. What effect might uncouplers have on cellular respiration?

decreased ATP production because the proton gradient would decrease

Chemicals called uncouplers can make membranes permeable to small molecules and ions. What effect might uncouplers have on photosynthesis?

decreased carbohydrate production because ATP would decrease.

Deletions that eliminate a multiple of three nucleotides can:

delete amino acids in a polypeptide chain

The unfolding of a protein by heat or chemical treatment is referred to as:

denaturation.

Which of the following statements is false?

deoxyribose is more reactive than ribose

For genotype AaBbCCdd, what do "A" and "a" represent?

different alleles

The random movement of molecules is referred to as:

diffusion

The beaker in the illustration contains two solutions of salt with different concentrations (measured by molarity, M). The two solutions are separated by a membrane that is permeable to water but not to salt.

diffusion of water from A to B but no diffusion of salt

The random movement of molecules within a solution is referred to as:

diffusion.

A region of a protein that folds in a particular way, and that carries out a specific function, is referred to as a folding________

domain

With independent assortment, the ratio of phenotypes in the F2 generation of a cross between true-breeding strains (AA bb x aa BB) can be described as 9:3:3:1 when A and B are dominant over a and b. To what phenotype does the "9" in the ratio refer?

dominant for both traits

dominant for one trait and recessive for the other

For genotype AaBbCCdd, why are there two of each letter?

each chromosome has a homolog (diploid)

During glycolysis, pyruvate oxidation, and the citric acid cycle, the chemical energy in glucose is transferred to:

electron carriers and ATP.

The majority of the energy captured in the citric acid cycle is in the form of:

electrons donated to NAD+ and FAD.

Most of the proteins of the electron transport chain are:

embedded in the inner mitochondrial membrane.

Synthesis of a protein is an example of a chemical reaction that is:

endergonic and anabolic.

A major difference between eukaryotic cells and prokaryotic cells is that:

eukaryotic cells have a nucleus and prokaryotic cells do not.

Suppose you are studying the transport of a certain polar molecule across the plasma membrane of cells in culture. Over a period of time, you measure the concentration of a polar molecule inside and outside of the cells. You find that the concentration of the molecule is lower in the cell but is gradually increasing. You also measure the ATP concentration inside the cell and find that it is not changing. Which of the following is probably responsible for the transport of this polar substance into the cell?

facilitated diffusion

A phenotype always refers to something that you can see with your eyes, like hair color or eye color.

false

All RNA is translated to generate proteins.

false

Because there are three different possible reading frames in a messenger RNA (mRNA) molecule, most mRNAs can be translated in a cell into three different proteins.

false

During transcription of a given protein-coding gene, both strands are used as template.

false

You are given two populations of true-breeding tomato plants with two simple dominant/recessive traits that sort independently. Using the multiplication rule, how many different phenotypic combinations would you expect to see in the F2 generation? In what phenotypic ratio?

four; 9:3:3:1

In the point mutation video, what characteristic in dogs arose from a single point mutation?

fur length

In cellular respiration, oxygen:

gains electrons and is reduced

In cellular respiration, oxygen:

gains electrons and is reduced.

According to the principle of segregation, a heterozygous plant with alleles Aa will produce:

gametes in the ratio of 1 A allele:1 a allele.

What's the advantage of having 23 pairs of chromosomes instead of just one pair?

genetic variation generated during DNA replication

Meiosis produces gametes with reduced ploidy so that

genome copy number is maintained between generations

In genetic crosses, the symbol Aa refers to a:

genotype.

You are studying a protein that you call Protein X. There is an aspartic acid at a key position in Protein X that is important in the folding and stabilization of that protein. If this aspartic acid is changed to a different amino acid, which one of the amino acid substitutions is most likely to allow the protein to fold normally?

glutamic acid

Look at Table 4.1 again. What polypeptide would have been formed if Nirenberg and Matthaei had used a synthetic RNA that was poly-G (all guanine nucleotides)?

glycine (Gly)

Which of the following produces 2 NADH and 2 ATP per glucose?

glycolysis

Which of the following takes place in the cytoplasm of eukaryotic cells?

glycolysis and fermentation

Based on what you know of ATP's chemistry, which of the following has functions similar to ATP?

guanine nucleotide

In Mendel's pea plants, an individual that is heterozygous for seed color:

had two different alleles for seed color and expressed the dominant allele.

A pair of atoms joined by a polar covalent bond:

has a slight positive charge on one atom and a slight negative charge on the other.

Many salmon return to the place where they were born to spawn (reproduce). You hypothesize that they use visual cues to find their way back. To test your hypothesis, you blind salmon and then examine whether or not they are able to return to their birthplace. You find that they are able to find their way back. From this experiment, you:

have rejected your hypothesis.

These enzymes play important roles in DNA replication: DNA polymerase, primase, ligase, helicase. In what order do they work during replication?

helicase, primase, DNA polymerase, ligase

Two major types of protein secondary structures are referred to as:

helix and sheet.

An organism that has two different alleles of a given gene has a _____ genotype.

heterozygous

An organism that has two different alleles of a given gene has a(n) _____ genotype.

heterozygous

Mendel crossed true-breeding yellow-seed plants with true-breeding green-seed plants. Given that yellow color is a dominant trait, what would the genotype of the offspring be?

heterozygous for yellow and green alleles

Prophase of meiosis I has some important differences from prophase of mitosis. These differences include: ___________ pair, and _________ occurs.

homologous chromosomes; crossing over

Which of the following correctly describes crossing over?

homologous recombination (prophase 1 of meiosis)

Sexual reproduction creates more genetic variation in a population than does asexual reproduction because

homologs align randomly during metaphase of meiosis 1

Secondary structure is characterized by which type of interactions?

hydrogen bonding within the peptide backbone

A young girl is staring at the raindrops running down her window. She notices that the raindrops remain more or less intact, even as they cascade down the windowpane. This is a result of:

hydrogen bonds between water molecules.

Secondary active transport uses a pre-established ion gradient to move a second compound across the plasma membrane. The pre-established ion gradient arises from:

hydrolysis of ATP

A polymerization reaction is made irreversible by:

hydrolysis of a pyrophosphate group.

hydrophilic, with a negative charge

hydrophilic, with a positive charge

The interior region of a phospholipid bilayer is characterized as:

hydrophobic

Lipid bilayers spontaneously form to orient the _____ tails _____ to minimize their contact with water.

hydrophobic; inside

In the F2 generation of a homozygous round (AA) X homozygous wrinkled (aa) cross in peas, two seeds are chosen at random. What is the probability that one is round (AA) and the other is wrinkled (aa)?

idk but it is NOT those down there (3/4) X (1/4) 2 X (3/4) X (1/4)

net diffusion of water from A to B and of salt from B to A

Based on the molecular structure of ATP, what predictions can you make about its behavior in the cell: Will ATP diffuse passively across cellular or sub-cellular membranes?

During DNA replication, a mistake occurred causing the third nucleotide of the corresponding codon (5' ACU 3') to change from a U to a G. This codon exists in the middle of a coding region of a gene, what could happen to the protein with this new mutation?

no change (silent)

Consider the tryptophan codon 5' - UGG- 3' in the standard genetic code shown in table 4.1. Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?

no; yes

Two elements within the same group:

occupy the same column on the periodic table and have the same number of electrons in their outermost shell.

A protein that is found in the Golgi apparatus was synthesized:

on ribosomes located on the rough ER.

In double-stranded DNA, the sugar-phosphate backbones are:

on the outside, separated by grooves of unequal size.

A reproductive cell, or gamete, has:

one allele of each gene.

You find a way to attach either a red or green fluorescent dye to nucleotides. Double-stranded DNA molecules with both strands labeled red fluoresce red, those with both strands labeled green fluoresce green, and those with one strand labeled red and the other green fluoresce yellow. You grow human cells in the presence of "red" nucleotides until both DNA strands of all chromosomes fluoresce red. You then allow one round of DNA replication in the presence of "green" nucleotides Continuing your experiment with "red" and "green" labeled chromosomes, you allow cells with DNA labeled "red" in both DNA strands to undergo two rounds of DNA replication in the presence of "green" nucleotides. What pattern of fluorescence would you expect to see in the sister chromatids of each chromosome?

one chromatid green, the other yellow

Which of the options is circled in this electron micrograph?

one double-stranded DNA molecule

In a double-stranded DNA molecule, the strands are said to be antiparallel because:

one strand runs in 5' to 3' direction and the other in 3' to 5'.

Which of the following is true of mitosis?

only occurs if the cell passes the G2 checkpoint

A beaker of water is separated by a selectively permeable membrane that allows the passage of water but not ions. A solution of 4% sodium chloride (NaCl) is placed on one side of the membrane and pure water is placed on the other side of the membrane. The solutions are allowed to equilibrate. At this point, which process is going on?

osmosis

The mitochondrial electron transport chain is part of:

oxidative phosphorylation.

A molecule that is _____ loses electrons, and a molecule that is _____ gains electrons.

oxidized; reduced

The final (terminal) electron acceptor of the electron transport chain is:

oxygen

What is the final electron acceptor in the electron transport chain?

oxygen

Which substance could most easily cross a synthetic membrane composed of phospholipids but not proteins?

oxygen (O2)

The [H+] of a solution changes from .000001 to .000000001. Did the pH increase or decrease? What did the pH change to?

pH increased to 9

Amino acids polymerize via a __________ bond, which is ____________ .

peptide; covalent

The lipid components of cellular membranes often include:

phospholipids and cholesterol.

Which of the elements would most likely have bonding properties similar to nitrogen (N)? Consult the periodic table provided if necessary.

phosphorus (P)

Felisa Wolfe Simon is interested in the element ___________ because it is found in many molecules such as ____________.

phosphorus; DNA

Many of the specific functions that are triggered when a cell passes one of the cell cycle checkpoints result from activation of enzymes and other proteins. A common mechanism for this activation is:

phosphorylation of specific proteins.

Animals breathe in air containing oxygen and CO2 and breathe out air containing less oxygen and more CO2. The consumed oxygen is produced by:

photosynthesis

In a water molecule, hydrogen and oxygen are held together by a ____________ bond.

polar covalent

According to the codon table, which amino acid sequence results from a synthetic "poly-A" mRNA consisting only of A-bearing ribonucleotides (that is, 5'-AAAAAA . . . AAAAAA-3')?

polylysine

Water interactions are depicted in the figure below. Based on your knowledge of the polarity of water molecules, the shaded molecule depicted in the center is most likely ________. (4pts) 4 molecules that are not shaded facing towards a shaded circle in the middle

positively charged

Imagine that a researcher was able to travel back in time, shortly after the appearance of the first RNAs on Earth. What would she most likely find?

precursors of tRNAs bound to nucleotides, and not amino acids

What can lizards, snakes and hedgehogs do?

produce ion channels that do not bind cane toad toxins

Which of the following is NOT a function of mitotic cell division in animals?

production of gametes

Enzymes are critical for metabolism because they facilitate nearly all chemical reactions in a cell. Enzymes are typically composed of which of the following?

proteins

The properties of life are listed below. Match these properties to the examples below. A. Evolution B. Membrane delimited C. Energy storage and use D. Replication/reproduction E. Responds to a changing environment and regulates functions F. stores and follow instructions 1.Smart Phone 2.Infertile Human Couple 3.Canned Tuna a.ABCE b.B c.CE

smart phone => CE infertile human couple => ABCE canned tuna => B

Below is a graph of a chemical reaction, the red line represents the reaction in the presence of an enzyme and a noncompetitive allosteric inhibitor Why does the red line flatten out at a much lower rate?

some of the enzymes in the inactive state

Photosynthesis is the pathway used to synthesize carbohydrates from:

sunlight, CO2, and H2O.

Photosynthesis is the pathway used to synthesize carbohydrates from:

sunlight, carbon dioxide, and water.

(Read the page linked above before answering this question.) Did the data support or refute the scientists' hypothesis?

support

Aquaclear is a new general herbicide for aquatic plants. It is effective against freshwater but not saltwater plants. It works by breaking down the cell walls of the plants and the freshwater plants die because their cells accumulate large concentration of the herbicide which causes them to.... (Hint: Think osmosis. When solute (herbicide) concentration is high inside the cells water concentration is low)

swell and burst.

Which of the following brings amino acids to the ribosome for use in translation?

tRNA

The fully folded structure of a functional protein composed of a single polypeptide chain is referred to as:

tertiary

The energy in organic molecules is released in a series of steps, rather than a single step, because:

the amount of energy released would be too much to capture in one reaction.

Which choice is an example of a hydrogen bond?

the bond that forms between a hydrogen atom in one water molecule and an oxygen atom in another water molecule

When the peptide bond is created between amino acid 1 and amino acid 2:

the carboxyl group of amino acid 1 is joined to the amino group of amino acid 2.

Which of the following is believed to have developed fairly relatively recently in the evolution of cellular life?

the citric acid cycle

In a reciprocal cross:

the crosses are set up between individuals with two traits: in one cross the male has the first trait and in the second cross the female has that trait.

A phenotype is:

the expression of a trait in an individual.

Energy is required in order to add a nucleotide to the growing strand of DNA during replication. From where does that energy come?

the incoming nucleotide

Which of the following is NOT a major challenge to the efficiency of photosynthesis?

the increased oxidation of NADPH to NADP+

A folding domain of a polypeptide chain has a primary structure containing 5 phenylalanine residues, where F represents the side chain of phenylalanine. Consider the possible folding orientations. If this domain folds in one of the two orientations shown, which is more likely, the one on the left or the one on the right? the one on the left: has all 5 F's inside the circle the one on the right: has all 5 F's outside the circle

the one on the left

A genotype is:

the particular combination of alleles present in a given organism.

How much DNA is present in G1 phase compared to after cytokinesis after mitosis?

the same amount

Which of the following is the first event to take place in translation in eukaryotes?

the small subunit of the ribosome recognizing and attaching to the 5' cap of mRNA

What is responsible, in part, for keeping the cytoplasm of red blood cells isotonic with the blood plasma and thereby preventing either lysis or shrinking of the cells?

the sodium-potassium pump

Which of these events includes a checkpoint in the cell cycle?

the transition from G1 to S phase

Which statement accurately describes a polar covalent bond?

the unequal sharing of electrons between an atom with a partial positive charge and an atom with a partial negative charge

An explanation supported by a large body of observations and experimentation is referred to as a(n):

theory

Figure 5.2 shows a common biological phospholipid called phosphatidyl choline. Which of the following is NOT a component of phosphatidyl choline?

three fatty acids

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The arrows represent the 5'-->3' end. The promoter sequence is off the page to the LEFT. <-------------------------- Promoter -------------------------> Which strand is the template strand?

top strand

A replication fork is shown below. The leading strand would be on the _____ 3' is on the top right, smaller opening is to the left and huge opening to to the right

top, synthesized right to left

Which of the following is a product of the Calvin cycle of photosynthesis?

triose phosphate

Alleles are alternate molecular forms of a gene.

true

Amino acids with hydrophobic R groups are most often found in the interior of folded proteins.

true

An anabolic reaction decreases entropy within the system because the reaction results in a more ordered macromolecule.

true

An exon is considered a "coding sequence" of DNA, and its information is retained in the processed mRNA within a cell.

true

Even though the full oxidation of glucose is exergonic, some of the reactions in cellular respiration are endergonic.

true

See all study sets

BIOL 1610 Quizzes

Related study sets

ch. 10/11 quiz

Humanities Unit 2

Ch. 17 Quiz

Oslo

cranialfacial bones

Senses System Disorders

AP Chem Exam Multiple Choice

PS 261 Quiz 6

PowerPoint Review

ECON 1030 Exam 1 Recharge

Part 2: Thorax Pleural Cavities

Psychology

Chapter 11 Quiz

Econ Midterm 1-7

Internal Brain Structures

Control of blood flow

AD1: How far do you agree that the New Deal brought about significant improvement in the lives of racial minorities and women?

Bio 208 Chapter 42 HW

Unit Test, Cumulative Exam Review, Unit 1 World History, Unit 3 Test Review, Unit 2

Psychology quiz 16