BIOL 5260 Exam III
-What is a major discovery that has come through the use of sequence-based approaches to describe the diversity of life on Earth?
"groups of bacteria only revealed through sequenced based approaches and NEVER cultured, culture independent, have been identified by isolating DNA and comparing to other sequences" "candidate phyla radiation"-15% of bacterial diversity discovered this way, through finding their DNA and sequencing it only
Study Questions from Chapter 7 Genetic Plasticity -Name three examples of bacterial features affected by genetic plasticity and why it would be advantageous?
"pathogenicity, antibiotic resistance, metabolic processes, WHY? host evasion, and it depends on what you pick"-straight from Cobine
-Give a full description of how phase variation for E. coli Type1 fimbrae is achieved.
"regulate the direction of the promotor to face the invertases or the genes required for the pili" • E. coli type 1 fimbriae required for adhesion to host cells • Inverted Repeat facilitates inversion of a promoter sequence • FimA encodes the fimbriae, is on when promotor faces it • FimB and FimE encode invertase "In the 'ON' position the promoter is directed towards fimA and this gene is expressed. Two other genes in this system encode integrases, FimE and FimB, that can act upon the inverted repeats to flip this DNA region. If this occurs then the promoter is no longer directed towards fimA and expression of this gene no longer occurs. The inversion of this sequence is carefully controlled and at 37◦C the ON state is favoured." • At 37C "in host" fimA is expressed • More activation the fimB and fimE to have inversion • Upstream on FimA is a control gene that limits the expression of FimE. When you have both B and E you get OFF position
-What is the minimum components to be a mobile genetic element?
"selectable marker, transposase, inverted repeat" -dr cobine
Study Questions from Chapter 10.4 to 10.7: -What computer method enabled scientists to complete the first bacterial genome of Haemophilus influenzae
"shotgun sequencing" The Institute for Genome Research (TIGR), assembling dna through generating random sequence reads to try and generate all segments from the organisms to overlap
-How could you identify an auxotrophic mutant at greater frequency using a selective strategy?
1)Mutagenize the bacterial cells to increase mutation frequency 2)Grow cells in minimal medium containing all amino acids but NOT SERINE 3)When cells are in exponential growth phase, ADD PENICILLIN which will call off the actively growing cells 4)Then plate surviving cells on a medium containing serine 5)These colonies will be enriched for serine auxotrophs
-What is the approximate size range for genome among Bacteria and Archaea?
10^5-10^8 base pairs for bacteria 112kb to around 1300kbp
-What specific gene is most frequently used in microbiome studies?
16SrRNAgene, ribosome is conserved throughout all life
8)Using Table 1, how many listed enzymes produce blunt ends? 9)Compare and contrast forward and reverse genetics.Advanced level questions:
3 ("...cut in the centre of the recognition sequence, generating blunt-ended fragments.") Forward (classical) genetics • Phenotype is known (E.g. Huntington's disease, white eyes in Drosophilia)• Gene (or genes) are unknown. • How is this achieved experimentally? Forward vs. Reverse Genetics• Through application of a genetic screen• Apply a mutagen (radiological, chemical, or insertional)• Look for mutants that lack desired phenotype.• Separate into complementation groups, map chromosome locations, and ultimately, identify mutation. Forward vs. Reverse Genetics • Reverse genetics (post-genomics)• Gene (sequence) is known• Function/phenotype is not• How is this achieved experimentally?• Manipulate genetic sequence and measure phenotype• Targeted mutations (knockout/knockdown)• Overexpression (cloning) Forward vs. Reverse GeneticsStuckenholzC., et al. (2004) Curr.TopicsDev. Biol. 65. 47Morescoet al (2013) Am.J.Pathol. 182(5):1462"Unbiased approach to identify genes essential to defined biological phenomena.""Targeted approach to identify the phenotypic effects of a specific gene
==========================================================
==============================================
============================================================
=================================================
Study Questions from Chapter 9.1 to 9.2: -Define an auxotroph
A mutant that cannot grow on minimal medium, requires certain supplement(s) such as an essential amino acid.
-What are the two kinds of motility in M. xanthus and what are the specific mechanisms by which these two forms of motility occur?
Adventurous "A" Motility Mutants mapped to Slime Secretion SystemSocial "S" Motility Mutants mapped to Type IV Pili
-What is a bacterial paralog of the flagellar system?
An example of gene duplication and divergence in function (paralogous gene products): Type III secretion systems
7)Using Table 1, identify three PAIRS of restriction enzymes that produce cohesive compatible ends for cloning.
BAMHI, BGLL HINDIII,SacL SaLL,XHOL ex) G^CTGAT and C^CTGAC should be compatible!*** must cut at first base, last base doesn't need to match, 4 nucleotides from begining of cut much be identicle.
-Define the terms Bioinformatics and Genome Annotation
Bioinformatics: Storing and analyzing sequences(e.g.aminoacidandnucleotide)andstructures,forexamplerelatingsequencetopredictedfunction Genome annotation: converting raw sequence data into a list of genes present in the genome. Annotation is a "bottleneck" in genomics.
-What process is the Z ring important for in bacterial cells?
Cell division; z ring is division ring
-Give an example of a human pathogen that expresses a T3SS. Are the components of the T3SS in this pathogen similar to those described first in a plant pathogen?
Chlamydia, shigella, yersinia, yes? pseudomonas aeruginosa, yes they are similar
-What is a chromosomal island, and give an example of this-What is a metagenome? How have studies of metagenomes changed our view of the diversity of microbial life?
Chromosomalislands•clustersofgenesforspecializedfunctionsnotessentialforsurvival •Twostrainsmayshowsignificantdifferences in size. •presumedtobeof"foreign"origin(horizontaltransfer) •examples: disease-associated functions ,biodegradation, nitrogenfixation •virulencefactors: specialproteins,toxins,enzymesthatfacilitatediseasesymptoms •example:uropathogenic E.coli ----------------metagenome-complex microbial community not just a single genome, sampling enviromental community of microorganisms, then isolating DNA or RNA, NO CULTURE STEP-directly from environmental to nucleic acids, sequence this dna -------------instead of a single genome, you get huge diversity of microbial genomes, assemble genomes from microbial community, identified organisms that have never been previously known; culture independent metagenomic identifycation
-Give an example of for a way that PCR is biased? What is a key bias in using 16S rRNA genes for microbiome analyses?
Copy Number Bias for 16S rRNA gene sequences● underestimation of diversity, primer specificity may not be specific enough=false positive, pcr artifacts like chimeras because PCR products fuse together, Copy number bias distorts relative abundance, can be multiple copies of rRNA gene within a genome ------------------
-What happens in cut-and paste transposition? What is the alternative called?
Cut-and-paste transposition •only a small region or a patch of the Transposon insertion on the target replicated "Non-replicative transposition: the transposon is completely excised from the donor molecule before being attached to the target site." alternative: • Replicative transposition • a small region of the insertion and the whole Transposon is replicated, forms cointerate (large plasmid)
-Give an example of how DGGE can be used to examine changes in a microbial community.
DGGEisawaytoseparatemultiplePCRproductsofthesamesize.Theseproductscanbegeneratedbya16SrRNAgenePCRofmicrobialcommunityDNA.DGGEuseschemical(ortemperature)denaturinggradienttoseparatebandsonthebasisof theirG+Ccontent(differentPCRproductshavedifferentTm).Oncethebandsareseparated theycanbesequencedtoallowidentification.Thebandingpatternsthemselvescanbeusedtoevaluatewhetherchangesinthepopulationaretakingplace. Bacterial succession in the digestive tract of a newborn baby And so if you look at each lane each Lane in this case is a different sample. 01:00:27 So each one is a different microbial community. 01:00:30 And each band corresponds to a different bacterial population. 01:00:36 Now one of the things that's interesting is you can go into this gel, you can actually cut out that named you can sequences. 01:00:45 So it allows you to look at what's happening to the microbial community group sample the sample sample.
-Define GC content. How could you determine GC content for a bacterial genome?
DNA base ratio, %G+C •Comparisonofgenomestodetermine DNA base ratio •Looking at relative proportion of A:T and G:C bonding in DNA •Baseratioisexpressedin%G+Ccontent•If%G+Cdeviatesmorethanasmallpercentagethentheorganismsarenotrelated•BUT, similarityofbasecompositiondoesnotmeanrelatedness A melting curve of DNA reveals the %G+C content. Because G:C bonds are stronger than A:T bonds, the DNA of a high G+C content genome will denatureat a higher temperature. It is a plot of relative absorbance versus temperature. aph, the y axis is the relative observance at 260 nanometers. I think everyone already knows we should know that. Oh, the optical density at 260 00:25:30That DNA absorbed very strongly that optical density. So if you look at on the on the graph on the on the x axis is temperature now double stranded DNA will absorb at that at that God 00:25:47As DNA is melted and others as a teenager's going from a 70 on up to almost hundred degrees Celsius that DNA will obviously from double stranded.
-What does the acronym DGGE stand for? How is PCR for DGGE different from standard PCR?
Denaturing Gradient Gel Electrophoresis (DGGE) for Microbiome Analysis PCR DGGE:The first is you notice that these two primary sets are close together as to be a short PCR product, this doesn't work very well with longer PCR one of the primers has long stretch of Gs and Cs, a GC clamp-using polyacrmylide, have a gradient of denaturant, sseparates DNA based on increasing concentration of denaturant, higher GC will denature at lower point in gel! separates based on gc content and thus melting temp.
-What stops the incorporation of additional nucleotides in a Sanger sequencing reaction?
Dideoxy nucleotides (ddNTPS) are incorporated into the growing DNA strand but lack a 3'‐OH group; no extension is then possible labelled (P32 or fluorescent)
-Eukaryotic genomes have many introns, which are what?
Eukaryotic genomes contain a large fraction of noncoding DNA (introns), especially in large genomes.
-Describe the basic structure of the bacterial flagellum. Are all of the proteins in the flagellar structure required for its function?
Flagella structure has three basic parts: •Filament-Extends to exterior-Made of proteins called flagellin •Hook-Connects filament to cell •Basal body-Anchors flagellum into cell wall
-What structure in eukaryotic cells contains a homolog of FtsZ?
FtsZ, a bacterial homolog of tubulin used in eukaryotic (microtubules)
-You obtain a bacterial isolate and want to characterize it. What are some methods you would use? What might be a concern in interpretation of your results?
Growth characteristics - what growth medium? Conditions?Morphology - on an agar plate and based on Gram stain Biochemistry - enzymes and growth substrates -culture it, phenotype it,morphology/gram stain, biochemistry, -some biochemical/phenotypic tests are ambiguous, horizontal transfer can result in genes that are not as efficient so you get mixed results!
-What is codon bias? What is a hypothetical protein?
Hypotheticalproteins:uncharacterizedORFs;proteinsthatlikelyexistbutwhosefunctioniscurrentlyunknown •lacksufficientaminoacidsequencehomologywithknownproteinsforidentification codon bias: somecodonsusedmorefrequentlyinothers, some organisms may use different triple code to encode amino acid
-Describe how you would use a complementation strategy for an auxotrophic mutant.
If a gene on the chromosome is defective then it could be complemented using a plasmid: Introduce the genetic region carrying the gene(s) from the wild-type strain into the auxotrophic mutant and see if these restore growth in the absence of L-serine.
-What is the purpose of conducting cross-feeding experiments?
In this example, mutants require addition of the nutrient "P" but there are 3 different required enzymes. Cross-feeding experiments can establish which of the enzymes is mutated. None of these mutants is able to grow on a medium that lacks the essential nutrient P. However, if the plate is inoculated with each mutant in the pattern shown then intermediates accumulated by a mutant may stimulate the growth of the neighbouring mutant. For example, mutant I is unable to produce the intermediate A, but this is produced by mutant II. So the growth of mutant A is stimulated where it is near to mutant II. Similarly, growth of mutant II is stimulated by mutant III. A cross-feeding experiment can therefore categorize mutants in a way that corresponds to the steps in the biochemical pathway.
-What is IVET and describe how it is used?
In vivo Expression Technology (IVET) •Clone random promoter sequences in front of a promoterless gene that is required in a host//////// is a gene discovery method used to identify transcriptionally active portions of a microbial genome during interaction of the microorganism with a particular environment or host organism. /////////(like purA used in a purine auxotroph) and a reporter gene like lac Z •Integrationofthisvectorintothechromosomeofthepathogencreatesalibraryofrecombinantpathogens •Inahostlikeamouse,onlybacteriathathavepromotersequencesthataretranscribedinahost("expressed in vivo")are able to survive •ThenyouscreenforcoloniesthatdonotexpresslacZwhengrownunderlaboratoryconditions
4)How does insertional inactivation help cloning? 5)A Bacterial Artificial Chromosome does not require which of the following? ***a)Origin of replication (ori) ***b)Selectable marker ***c)Partitioning genes (par) d)cos site ***e)multiple cloning site (MCS)
Insertional Inactivation "Insertion of a DNA fragment will (usually) result in inactivation of the gene in which that site is found. If a DNA fragment is inserted into the multiple cloning site, it will (usually) prevent the production of β-galactosidase, either by interrupting transcription or by altering the reading frame; this is known as insertional inactivation. Genuine recombinants will therefore be white on a medium containing X-gal, and can be distinguished from blue colonies containing the original pUC18" • MCS is located within the ORF of a screening gene (e.g. LacZ) • LacZ(β-galactosidase) - intracellular enzyme that cleaves lactose into glucose and galactose. • Used with substrate X-gal (a chromotgenic substrate) that results in an insoluble blue dye • Disruption of the LacZ gene prevents expression, which results in NO BLUE dye • "Blue-to -white screening" DOES NOT NEED COS SITES
-Give an example of a reporter gene and indicate how its gene product can be detected.
Instead of generating mutants, reporter genes can indicate expression of genes under different conditions. That can enable discovery of genes that are regulated by the condition of interest (e.g. presence of a growth substrate) This involves attaching the regulatory region of the gene concerned to another gene that is more easily detected, so that we can then follow the regulation by proxy, looking at the expression of the reporter (Figure 9.4). For example, if we use a β-galactosidase reporter, and a medium containing the chromogenic substrate X-gal, the colonies will only turn blue when the promoter in question becomes activated and the reporter gene starts to be expressed. Beta-galactosidase (encoded by lacZ)acts on XGAL substrate
-What are the steps used in inverse PCR to identify a gene interrupted by a transposon?
Inverse PCR can be used to identify the gene sequences flanking the transposon insertion. •DNA is isolated from the transposon mutant •The DNA is digested with a restriction endonuclease •The restricted DNA is then ligated •The PCR is used with primers that are internal to the Transposon and will yield a PCR product (iftheregionisnottoolarge). Inverse PCR can be used to amplify the unknown sequences flanking any known sequence (Figure 9.12). In the case of the transposon mutant, restriction fragments, some of which would contain the intact transposon target sequence, are circularized using DNA ligase. The unknown sequences will have been artificially connected to the known sequence as the DNA sequences are now circular. These molecules are used as the templates in a PCR reaction using transposon-specific primers, that direct DNA synthesis away from each other so that the unknown sequence is amplified. The amplified fragments can be cloned and sequenced to determine the site of insertion.
Problems:You are a new student in Dr. Newguy's lab, and have been asked to use restriction cloning to move a gene of interest from its current cloning vector to another. The schematic of your gene of interest and the surrounding sequences is shown in Figure A. The MCS of the recipient vector is shown in Figure B.The plasmid you are cloning into is shown in Figure C . You have the enzymes listed in Table 1 (with their recognition sequence) available for use.Figures & Diagrams: Figure A. your gene of interest AAGAATTCTGCAGGTACCTA TTCTTAAGACGTCCAGGGATGTCGACCGGTGGATCCCGGGAAG CAGCTGGCCACCTAGGGCCCTTC Figure B - pUC18 MCSEcoRI SacIKpnISmaI BamHI EcoRV XbaISalIPstISphIHinDIIIEagI5' aaGAATTCGAGCTCGGTACCCGGGGATCCGATATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGGCCG 3' Figure C - recipient vector Sample Questions 1)Which two restriction enzymes would you use to clone your gene of interest in Fig. A into the MCS of the new vector (Fig B)?
Kpnl and BamHI; don't use recognition sites located in the gene of interest because obviously it will cut the gene. (located BEFORE BAM) KpnI. GGTAC^ C BamHI. G^GATCC memorize: cut at end (first enzyme), then beginning (second enzyme) --------------------------------------- RULES: in the 5' to 3' direction: first enzyme MUST BE cutter of LAST nuc. ex.)))) GGCTA^G SECOND enzyme MUST BE cutter of FIRST nuc. ex.)))) G^GCTAT kpnl->bamHI --------------------------------------- no idea what similarity between the cut sequences has to do, but stay away from nucleases that make COMPLEMENTARY ENDS!!! I.E., have the same 4 digit NUCLEOTIDE CODE in the middle like: A^TGCTT and T^TGCTT though I doubt this will be a problem. SACI and PSTL
Study Questions from Chapter 9.5: -What are some basic methods that microbiologists have used to identify microorganisms, throughout the history of microbiology?
Molecular taxonomy based on shared characteristics, microscopy, biochemical tests, cultivation, GC content, 16sRNA,
-What would be an example of a very high-resolution method to compare different strains based on sequence data?
Multi-Locus Sequence Typing for core genome phylogeny-straight from liles lecture
-What are some significant challenges involved in bioinformatics analysis of next-generation sequencing data?
NeedhugeamountsofCPUpower (Supercomputerinfrastructure) •Requiresmanagement •Parallelizationwithexistingsoftwareorredesign •Wholenewlevelofsoftwarecomplexity •EXPENSIVE($$$)...orcannowuseCloudbasedcomputingHUGEtextfiles(millionsoflineslong) •Can'talwaysusefamiliartools(Perl/Python) •HUGEamountsofmemoryusageandexecutiontime •Impossibleto"browse"forproblemsNeedsequenceQUALITYFILTERING •Technologyisbeingdevelopedfasterthanwecananalyzethedataandcheckformistakes.... •LedtofieldofBIOINFORMATICS(Verymarketablerightnow)
-How would you calculate the % relative abundance for different bacterial genera using 16S rRNA gene amplicon sequences?
Nowthatwecangeneratemanythousandsofsequencespersample,wecandeterminetherelativeabundanceforeachbacterialGenus(thatisthelimitofphylogeneticresolutionthat16SrRNA genesequencescanprovide)indifferentsamples.Butistherelativeabundanceofthesequencesthataregeneratedreflectthetruecellularrelativeabundance? --------- relative abundance=particular times a bacterial genus or species was observed over amount of sequences this gives you relative abundance Now, what I mean by relative abundance. It's the percentages basically out of 100% right what percent corresponds to each time each genus of bacteria. So I mentioned that you have to you, right. So each show to you or type 00:44:50You can then affiliate with specific vector or general and so you can just see based on the color that some of these are very different. I think sometimes you can see and this is 00:45:01Surfaces this time, right. You can see the each during fermentation. The there's a change and how the relative abundance of different bacteria occurs. 00:45:14During kimchi fermentation. So I don't know any of this. Right. I just want to add another principle of this. What does. And so relative abundance. I get it. The percentage of times that particular ot you say corresponding particular back to Jesus was observed over the total number of sequences. 00:45:36So it's a percentage of those sequence that were observed. Now, does this correspond to actual cellular relevant abundance. Remember that on Tuesday we talked about the bias eats inherently in PCR.
-Describe the steps involved in a microbiome analysis using 16S rRNA gene amplicons.
Operational taxanomic Unit, "bacterial types" percent identity, sort sequences (16s rRNA gene sequences) 97 percent or greater identity, group them together -DNA isolated from source -short bacoded PCR product generated -sequence reads using next gen sequencer -trim sequence for quality -sort sequence into OTUS -classify OTUs in database -rarefaction curve, OTU richness, cluster analysis
-Define a paralog and an ortholog
Paralogs:Similarityresultsfromgeneduplicationinanorganismduringevolution(e.g.,Flagellar proteinsandType3SecretionSystem). •Orthologs:similarityingenesbetweenorganismsbecauseofdescentfromcommonancestor(e.g.,humanandLactobacilluslactatedehydrogenases)
Study Questions from Chapter 9.3 to 9.4: -Define a Pathogenicity Island-Provide an example of a Pathogenicity Island and the specific way that the encoded genes contribute to the virulence of a pathogen.
PathogenicityIslandsthatencodebacterialvirulencefactors Genetic region(s) withinthegenomeofanorganismthatisresponsibleforitscapacitytocausedisease,inotherwordsitspathogenicity.Thevirulenceoftheorganismismodulatedbygenesharboredonthisisland,suchaswithVibriocholeraeandthetoxingenesintroducedbytheCTXphage.
Study Questions from Chapter 10.1 to 10.3: -How does PFGE differ from normal agarose gel electrophoresis? In what kind of analysis would you need to use PFGE rather than normal gel electrophoresis?
PulsedFieldGelElectrophoresis(PFGE)Allowsyouto resolve high molecular weight DNA (>20Kb) Use PFGE for Restriction Fragment Length Polymorphism (RFLP) for analysis of Genomic DNA ALTERING electrical currents at given directions are used instead of one current flowing in a single direction. this is how PFGE is different!
6)Describe the difference between selection and screening.
Selection•Allows only for growth of genetically marked cells•Positive selection - confer selective advantage (e.g.- antibiotic resistance)•Negative selection - eliminate or inhibit host growth (e.g. levensucrasefor sucrose sensitivity) Screening•Growth condition where both mutant and wild type are able to grow•HOWEVER - there is a phenotypic difference that discriminates between them•'produce and sort'•Can have an indicator •e.g. ability to ferment sugars (e.g. MacConkey) •Reporters (beta-galactosidase, luciferase, fluorescence)
-An auburn scientist has identified an enzymatic activity from the bacterial culture A. tigerensis that is highly useful because it breaks down the previously non-degradable plastic polylactic acid (PLA). The scientist names the enzyme PLAse and thinks the enzyme could be patented and highly valuable in degrading plastics, if only the gene for the PLAase could be discovered. But since no one has ever found a PLAase gene before, this is not obvious from the genome sequence. How could you use a transposon to identify the unknown gene responsible for the enzyme PLAse in A. tigerensis?
Signature tagged mutagenisis-------1)Introduceplasmidcontainingtransposonthatencodesantibioticresistanceintocell 2)Shifttemperatureto42oCsotheplasmidcannotreplicate,sotheonlycellsthatsurviveInthepresenceoftheantibiotichavetransposoninsertioninthegenomeThisisyourTn mutantlibrary 2a) Possibly: plate the mutants onto a medium with the substrate they break down with PLAse functional enzyme normally. Sequence the genomes of the colonies that do grow, and compare the unique DNA tags from these colonies to the ones that did not grow; this should indicate the approximate whereabouts of the PLAse gene. InversePCRcanbeusedtoidentifythegenesequencesflankingthetransposoninsertion. •DNAisisolatedfromthetransposonmutant •TheDNAisdigestedwitharestrictionendonuclease(e.g.BamHI orotherenzyme) •TherestrictedDNAisthenligated •ThePCRisusedwithprimersthatareinternaltotheTransposonandwillyieldaPCRproduct(iftheregionisnottoolarge)
-What are the steps involved in signature-tagged mutagenesis and describe why it is used?
Signature‐taggedmutagenesisAllowsyoutoidentifymutantsthatdon'tsurviveinvivo.SinceeachmutanthasauniqueDNAindex(or"signature")itispossibletoidentifymutantsthatdon'tsurviveinvivobutdogrowinthelaboratory.------------- signature-tagged mutagenesis (STM) has been invented. This is essentially a negative selection technique, derived from transposon mutagenesis (see above) in which each individual mutant is labelled with a unique DNA signature. By comparing the mutants present in the initial inoculum with those that are recovered after infection of the model, it is possible to identify those that did not survive and thus identify the genes that are required for virulence.
-What group of bacteria known to swarm as a wolfpack have some of the largest genomes of any bacteria? Why do some bacteria like this have larger genome sizes?
Somebacteriahavemoregenesduetocomplexlifecycles(differentiationlikesporesandmultiplecelltypes)andproductionofsecondarymetabolites(e.g.antibiotics) •Sorangium cellulosum (Bacteria)•largestprokaryoticgenometodateat14.8Mb it is a myxobacterium -complex lifecycles and lots of secondary metabolite creation
-Describe how a gene knockout by homologous recombination, or antisense RNA, can be used to study gene function
SpecificMutagenesis"Genereplacement""allelicreplacement""geneknockout"Homologousrecombinationbetweentheclonedgenethathasbeendisrupted,andatargetgeneonthechromosome.Inthisexample,aphencodeskanamycinresistanceInthisexample,theplasmidcannotreplicatesotheonlywaykanamycinresistantcellscanbeisolatedisifthedisruptedgenecarriedontheplasmidrecombineswiththewild‐typegeneonthechromosome AntisenseRNADavidP.Clark,NanetteJ.Pazdernik,inBiotechnology(SecondEdition)2016Geneknockoutscanbelethal.Yo ucanreducegeneexpressionbytranscribingtheantisenseRNAthatistheRNAproducedthatiscomplementarytothecodingsequence.TheantisenseRNAwillinterferewiththenormalcodingtranscript,dependingonhowmuchantisenseRNAisexpressed,andthiswillreducetheamountofproteinthatisproduced.
-What is the definition of the pangenome?
The pangenome is the entire gene set of all strains of a species. It includes genes present in all strains (core genome) and genes present only in some strains of a species (variable or accessory genome).
-Define a pan genome, and a core genome.
The"pan"/"core"concept:genomesofbacterialspeciesconsistoftwocomponents •coregenome:sharedbyallstrainsofthe species •pangenome:includescoreplusgenespresentinsomebutnotallstrainsofthe species
-What is a Hypersensitive Response in plants? And which bacterial species was first found to induce this response by virulence factors exported through a T3SS?
TheHypersensitiveResponseinplants=Adefensereactioninplantsagainstpathogensinwhichtheplantformsahypersensitivenecrosis(a)thatpreventsfurtherspreadofthepathogen. Pseudomonas syringae
-What is meant by the phrase "shrub of life" and how is that different from a "tree of life"?
TheShrubofLife"Dr.FordDoolittle,DalhousieUniversityLateralgenetransferisanimportantaspectofevolutionarychange The struggle of life encompasses this idea of lateral or horizontal gene transfer. For example, the origin of the mitochondria. The origin of chloroplasts as indo symbiotic bacteria. Shows horizontal gene transfer.
-What does RFLP an acronym for? How might you use the insertion sequences for a pathogen to fingerprint differences among pathogen strains?
Therecanbemanyinsertionsequenceswithinagenome,suchasIS6110inMycobacteriumtuberculosis.Youcangeneratea"fingerprint"ofabacterialisolatesbyPCRamplifyingtheIS6110elementsandthedigestingthemwitharestrictionenzyme.Therestrictionfragmentlengthpolymorphism(RFLP)patterncanbeveryunique betweendifferentstrains. restriction-fragment length polymorphism (RFLP). When a gene probe is hybridized to a Southern blot (see Chapter 2) of restriction-enzyme-digested DNA from different strains, the size of the fragment(s) detected may vary from one strain to another. This effect can arise from point mutations that remove (or create) restriction sites, or from the insertion or deletion of DNA fragments in the region detected by the probe (see Figure 9.17). Insertion sequences can be extremely useful for this purpose, since there are often multiple copies of the element in a strain (giving rise to a number of bands on the Southern blot), and also because the site of insertion in the chromosome is often highly variable (giving rise to extensive polymorphism). One element that is widely used for epidemiological purposes is the insertion sequence IS6110 in M. tuberculosis. With this probe, similar patterns (such as the arrowed tracks in Figure 9.18) are obtained only with strains from the same outbreak.
-What is the relationship between genome size and ORF content?
ThereisacorrelationbetweengenomesizeandORFcontent •Each megabase pair encodes~1000 ORFs. •As genome size increases, gene content proportionally increases.
-Define the terms sequence reads, contigs and scaffolds
This whole‐genome random sequencing strategy was made possible with new computer assembly programs that put together the overlapping sequence reads into larger contiguous genome regions (contigs) sequence reads are inferred sequences of nucleotide base pairs and are assembled into contiguous reads (contigs) Spades. program contigs assembled into scaffolds through PCR use a primer on one end and a primer on the other side and build larger and larger scafolds that could be linked into larger genomic scaffolds.
-What is meant by the phrase "molecular phylogenetic framework"?
ThisfigureshowsthesecondarystructureofthesmallsubunitribosomalRNA(16SrRNA)ofE.coli.Withinthe~1500bpofthe rRNA molecule are domains that are conserved among all known life ,as well as regions that are variable. By comparing a rRNA sequence from an unknown microbe to the 16SrRNA from known microbes, you can place your microbe within a "molecular phylogenetic" framework
-Which of the following non-composite transposons is larger Tn4 or Tn3?
Tn4
-What is the common region and what happens at there?
Transposons have region called common region (CR) • CR encodes a transposase like protein • By misreading the "end" of the element it incorporates new genes • Rolling circle replication means insertion "without Inverted Repeats allows the insertion of new genes into mobile genetic elements!!!!"-cobine
-What are the steps involved in transposon-site hybridization and describe why it is used?
Transposon‐siteHybridization•TheTransposoncarriesoutwardfacingpromoters•Transcriptionfromthesetransposonpromoterswillresultindifferentgenesbeingexpressed,dependingonthesiteoftransposonintegration•Byhybridizingthetranscriptstoamicroarraythatcontainseachgenesequence,thegenesessentialforgrowthundercertainconditionscanbeidentified. called transposon-site hybridization (TraSH). The overall approach of this technique is shown in Figure 9.14. This system utilizes a specially designed transposon that contains outward-facing RNA polymerase promoters which, when the DNA is isolated from the mutants of a transposon library, allows the DNA flanking the insertion sites to be transcribed as complementary RNA. Microarray mapping of transposon insertions can be used to quantify the relative abundance of different transposon mutants within a complex pool after exposure to selective pressure.
-What is the function of a Type 3 Secretion System (T3SS)?
Type3SecretionSystemdiscoveredintheplantpathogenPseudomonassyringae •"Molecularsyringes"thatdeliverseffectormoleculesintoeukaryoticcells •ParalogwithFlagellar System
2)How could you clone your gene of interest into a vector that did not have any compatible restriction sites?
Use PCR to amplify the gene of interest; add compatible restriction endonuclease sites
6)Primary Literature - Tucker et al. (2018). "Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries". Cell. 172 :618-628. Understand the methodology of the genetic screen. How was the screen performed? How were candidate peptides identified?
We have used this seeming dissonance to develop Surface Localized Antimicrobial Display (SLAY), a platform that allows screening of unlimited numbers of peptides of any length, composition, and structure in a single tube for antimicrobial activity Batch Screening of a Defined Peptide BATCH SCREENING, REMEMBER THIS Library with SLAY"Peptides are cloned into our surface display system and transformed into a gram-negative strain of interest. Peptide surface expression is then induced by IPTG. Bacteria expressing bactericidal or bacteriostatic peptides will decrease in abundance during the induction period. One PCR generates Illumina next-generation sequencing samples for sequencing from plasmid libraries pre- and post-induction. In silico translation and comparison identifies each peptide in the library and its abundance pre and post-induction to identify potential antimicrobial hits" Peptide library construction The surface display system was constructed on the broad host plasmid pMMB67EH. Random peptide sequenceswere generated using NNB codons in a 60-base nucleotide segment to produce 20 amino acid long peptides. Random sequences were cloned into the KpnIand SalIsites using primers with homology to the tether sequence on the reverse primer. The library was then transformed into C2987 competent cells (NEB) in batch and plated. Roughly 800,000 colonies were plated and pooled. Cells were harvested and aliquoted into glycerol stocks. Plasmid DNA was isolated from the library and re-transformed into the E.coli W3110 strain at 3 to 5 times coverage. Colonies were collected and frozen.
-Give an example of an application of how genome analysis is used in the discipline of microbiology
Well, if you have a complete genome sequence, you're able to then identify specific sequences that are allowing you then track that particular organism. 00:10:34 Throughout say a distribution network, right. So you get a chance, has been distributed workforce. Think about the story monster timings right outbreaks of Listeria in Blue Bell ice cream. So using those very specific sequences. 00:10:53To a genome investigators are able to track Listeria populations in different facilities around the world can use whole genomes in diagnostic tools in clinics and such, rapid testing in clinics if you have a. genome you can predict proteins expressed by the organisms giving drugs a target
10)You are a graduate student, and are studying the function of a human enzyme that may contribute to cancer (like everyone else in biomedical science). You need to generate a mammalian expression vector containing the cDNA of your gene in order to complete your studies. You hypothesize that inactivation of this enzyme may help treat certain tumors. You know the gene nucleotide sequence and the specific amino acid that serves as the catalytic reside for the enzyme. a)How do you make a human cDNA library and identify the clone with your gene? b)How do you use that clone to make a mammalian expression vector? c)How would you use site-directed mutagenesis to generate an expression vector containing an enzymatically-inactive version of your gene
a) make a gene library from mRNA, rather than from DNA. This requires synthesis of double-stranded DNA, using mRNA as a template. Use reverse transcriptase. The DNA produced (complementary DNA, or cDNA) can be ligated to a vector to produce a cDNA library. To locate the gene of interest b)If a gene from one organism is put into another, it may not be expressed very well, if at all. The most common reason is that the promoter may not be recognized by the RNA polymerase of the new host. So, if expression of the product is required, we would use an expression vector which contains an E. coli promoter adjacent to the cloning site. Insertion of a DNA fragment at this site, in the correct orientation, places it under the control of the promoter provided by the vector, thereby ensuring expression in the recombinant E. coli clone. c)A short synthetic oligonucleotide is made that contains the altered sequence, and this is hybridized to a plasmid containing the complementary strand of the old gene. Although the sequences are not identical, there is sufficient similarity for binding to occur. The synthetic oligonucleotide (the mismatch primer) can then prime synthesis of the complete DNA strand, which now contains the altered sequence. After transformation, the mismatched sequences will both be replicated, so that some cells will contain the new gene and some the original. In this case, or mutation wold result in inactivation of the gene and little to no expression of gene product.
-What domain of life is most closely related to the domain Eukarya (or Eukaryota)?
archaea
-What are the 3 domains of life? And who was the scientist who first proposed this?
bacteria, archaea, eukaryota, Dr. Carl Woese, UniversityofIllinois
-What other key function of a bacterial cell is paralogous with a T3SS?
bacterial flagellar system
-What would be a reason to select a particular kind of next-generation sequencing technology over others?
cost, time, fedelity, error rate,
-Describe how Illumina sequencing is conducted, contrasted with Sanger sequencing (basic steps). How is this an advantage in terms of total sequence yield and numbers of samples?
currently best in ngs tech, massively parrallel sequencing, millions of sequencing reactions happening at once=massive sequencing output -start with DNA isolated from organism -fragment the DNA -adapters have to be ligated onto ends of these fragments -adapter allows DNA to attach to glass surface, PCR on a surface, every fragment is copied via bridge amplification -creates clusters of dna sanger:The DNA sequence of interest is used as a template for a special type of PCR called chain-termination PCR. Chain-termination PCR.In the second step, the chain-terminated oligonucleotides are separated by size via gel electrophoresis.The last step simply involves reading the gel to determine the sequence of the input DNA. Because DNA polymerase only synthesizes DNA in the 5' to 3' direction starting at a provided primer, each terminal ddNTP will correspond to a specific nucleotide in the original sequence (e.g., the shortest fragment must terminate at the first nucleotide from the 5' end, the second-shortest fragment must terminate at the second nucleotide from the 5' end, etc.). m. MIT about 7 million separate clusters on that service. Then using us seniors, you can kind of process where you're flowing an individual for us a tag nucleotides. 00:25:38And then imagine a camera above us. That's imaging every single nucleotide it's incorporated and it's imaging the sequencing of each cluster simultaneously. 00:25:51So what's happening over the course of a couple days is that you can sequence the length of that DNA strand. To me, that's about 150 base pairs in one direction. 00:26:04Or the other direction. So you're sequencing each of those fragments and that's simultaneous so 7 million approximately sequencing reactions happening at the same time. 00:26:18And the computer. Basically, it's a PC that's been, you know, determining that sequence based on those reactions. It turns out that you 00:26:28Each of those reactions and so you have a sequence. Now, what really makes this technology powerful is that you can also arc 00:26:38So that you can. So when you're putting in your DNA. And this is what really makes aluminum very, very useful is that you can put in, not just one kind of sample, you can put in 10s or hundreds of different samples. Each one will have a different barcode and that barcode is 00:26:57A therapeutic sequence in the adapter. So let's say you had you're doing micro bio analysis, you don't want to just one Oh my word hundreds of different samples that you are sequencing. 00:27:09So barcoding means that you're able to keep track of which DNA corresponds to which sample. So at the end of the day you generate the sequences. 00:27:19For this process is over. 00:27:21The computer automatically source them. Here's the sequences for this sample and the same one. The sample. That means that you're generating millions and millions of sequences.
-Draw a figure to explain the integration of new DNA into an integron?
describe a figure: common regions, additional sequences are added into integron Many transposons carry a region known as an integron, which is an assembly platform for the integration of genes originating from other genetic elements. This region contains an integrase gene and a specific attachment site (attI) where additional genes are inserted (Figure 7.8). A typical integron also has a conserved sequence (3-CS) at the 3 end, containing genes for resistance to quaternary ammonium disinfectants (qacE) and sulphonamides (sul).The gene to be inserted is excised from elsewhere as a circular molecule containing just a single gene with an imperfect inverted repeat (the attC site) at its 3 end. This is known as a cassette. The integrase carries out site-specific recombination between the attI and attC sites, which results in integration of the cassette adjacent to attI. The attI site remains available for the insertion of further genes, enabling the build-up of an array of several cassettes within the integron. A further twist to the story is that the gene cassettes do not normally contain a promoter. However, there is a promoter region within the integron itself, upstream from the insertion site, so each gene cassette is transcribed from the integron promoter. Integrons are thus a naturally occurring analogy to the expression vectors that we will come across in Chapter 8 for obtaining expression of foreign genes by inserting them into a vector adjacent to a promoter.
-Describe some applications of next-generation sequencing technology in the life sciences or in microbiology. In other words, give examples of the "Who"? "What"? and "How"? Questions that could be answered using this technology
genomes, cDNAs, Metagenomics, community analysis, transcriptomes, low diversity bacterial metagenomics, novel gene discovery, comparison to reference genomes sequencing a graph Neanderthal genome. And so now, of course, we have 00:30:29Knowledge of specific gene sequences that were associated with the end or 12 genomes and you go to Twitter and me, which I've actually done. I know I have quite a bit of banter tall DNA thanks to that person. I was very happy to see that my father has more. So, that was awesome. 00:30:46So again, the technology now allows us to know more about ourselves, our ancestry. Our predisposition to genetic diseases and of course microbiology laws of different things you can ask the terms of 00:31:01microbial community analysis talking about next. 00:31:05Meta genomics, which I talked about on Tuesday. 00:31:08Obviously transcript Jones. There's no and numerous questions, you could you could ask using next gen sequencing technology. 00:31:15Right, so 00:31:18I now want to really focus on how do we use next generation sequencing technology for microbiome analysis other words how do you use this technology to look at the diversity of microbial communities. 00:31:31So when someone says they don't the microbiome analysis. That's what I'm gonna I'm gonna take it now. And the last lecture, we talked about using 16 S, for example, or an agent. That's the most common marker used for studying the diversity of different bacteria and other organisms now. 00:31:54The idea here is you have to have a market. So I mentioned that alumina can include lots of different samples. So you have a typically a small stretch of DNA. 00:32:06Each sample would have a different argument that way at the end of that sequencing reaction. 00:32:13You can sort them by computer does this for us. Okay. This barcode corresponds to the sample the sample sample so that you can then get all right here are the different sequences, corresponding to each sample. So you're taking
-How is it possible to include many different samples for NGS of 16S rRNA gene amplicons (PCR products) in a single NGS sequencing run?
have to have a barcode! use illumina, small stretch of DNA each sample has a different barcode and then you sort them, then get different sequences corresponding to sample,each sample corresponds to different sample of soil, then create rarefaction curve -------- 00:27:09So barcoding means that you're able to keep track of which DNA corresponds to which sample. So at the end of the day you generate the sequences. 00:27:19For this process is over. 00:27:21The computer automatically source them. Here's the sequences for this sample and the same one. The sample. That means that you're generating millions and millions of sequences.
-Can comparing 16S rRNA gene sequences (either by the sequence or by RFLP) conclusively identify the species?
identical rRNA RFLP patterns, or sequences, does not mean they are the same species! It will of course get you close to the identification, but more information is needed, such as genome sequences
-How could you use a reporter gene to ask a biological question? Provide a specific example.
it has been widely used to identify genes which are expressed, for example, in response to heat, starvation and osmotic shock, and during sporulation. lacZ can be used to indicate whether or not an insert is present in a plasmid (in which case the colony is white) or a gene fusion can be generated that indicates whether the expression of specific genes is "on" or "off Luciferase emits light Enzyme catalyzes oxidation of luciferin releasing a photon of light The firefly luciferase was the first described luciferase Other Reporter genesGreen Fluorescent Protein (GFP) Fluorescence•GFP exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range (UV excitation)•Can be a translation fusion
-How were Trees of Life biased in the early examples of these trees?
its what humans could view most easily at the time, had nothing to do with evolution of life on earth, weve switched to protein and genetic sequences
-Why does the % relative abundance obtained from a 16S rRNA gene amplicon study not provide a realistic estimate of the bacterial cellular relative abundance? In other words, how are these data potentially biased based on PCR biases, and the use of the 16S rRNA gene?
may not correspond to cellular abundance, 16s rrna copy number biases, and PCR biases affect relative abundance ----------
-What is a key first step in conducting a molecular phylogenetic analysis?
measure sequence differences from one organism to the next, might have thousands of different organisms; compare sequence from each organism, the more differences, the greater the phylogenetic distance, find sequence differences between a gene in all organisms, (usually 16s rRNA) GOOGLE: "The first step is to identify a protein or DNA sequence of interest and assemble a dataset consisting of other related sequences."
-Describe the different stages of the life cycle of Myxococcus xanthus.
myxospore,germination,vegetative growth and swarming,starvation and aggregation,mound,fruiting body
-Define the terms "root" and "node" in reference to a phylogenetic tree
node=common ancestor between different groups root=organism is distantly related, outgroup related to all the other organisms; essentially a common ancestor for all members involved (bottom of the tree) used as a base to compare the rest of the organisms
-How many primers are used in a Sanger sequencing reaction?
one primer
-What is the acronym OTU stand for and why is this term used instead of describing species when conducting a 16S rRNA gene amplicon study?
operational taxonomic units OTUs are cluster of similar sequence variants of the 16S rDNA marker gene sequence. "species" needs full genome sequence, were using 16s RRNA DNA ONLY, so were not using species.
3)Circle the feature in Figure B that is the vector origin of replication, and write its name here:
pMB1 is the replication of origin, located on the figure
-Describe phase variation by strand slipping?
phase variation by strand slipped misparing. A gene has 4 copies of a 4 base repeat; if one copy of this repeat were gained or lost during replication, the reading frame is altered leading to premature termination of protein synthesis in most cases. "Runs of a single nucleotide, for example AAAAAAAAAA (homopolymeric tracts), or repeated units of more than one nucleotide, called multimeric repeats (e.g. ATATATATATAT or GCCGCCGCCGCC), provide another mechanism for phase variation, through errors during DNA replication which result in the loss or gain of one or more of the repeat units. This process is called slipped-strand mispairing (Figure 7.19). When the chromosome replicates, whilst in many cases the sequence remains unchanged, a small population of cells arises which have a different number of repeat units. This can affect gene expression at either the translational or transcriptional level. If the repeat is within a coding sequence, the reading frame of the gene will be altered, leading to premature termination of translation." "the genetic sequence is identicle, it is the direction of the promotor that is driving expression."-cobine "strand slipping results in incorrect. 00:07:53Organization of your gene. And then this repeated sequences means that you end up with encoding something different."-Liles
-Describe how a transposon might regulate a gene or operon in a bacterial genome?
phase variation; a strong promoter pointing in or out of the transposon may affect genes, promotor pointing out may upregulate operon; may disrupt a site and result in repression of operon We have up to this point assumed that apart from the movement of any genes carried by the transposon, the only consequence of transposition will be the inactivation of the gene into which the element is inserted. With some transposable elements it is known that the converse effect can occur, i.e. insertion of the element actually promotes the expression of genes adjacent to the site of insertion. The reason is that some insertion sequences (such as IS10) contain a promoter (identified as pOUT in Figure 7.13) that is directed outwards, i.e. away from the transposase gene, and towards any genes that may be found in the flanking chromosomal DNA. These genes, if in the correct orientation, will therefore be turned on by the presence of IS10. -------------
-What is an ORF? How does a computer analysis identify an ORF?
portion of DNA that when translated into protein has no stop codons. bacterialandarchaealgenomescontainaseriesofopenreadingframes(ORFs)=predicted genes. •FunctionalORF:actuallyencodesaprotein,canbeidentifiedbycomputer •Identifying ORFs •locate start and stop codons and Shine‐Dalgarno/ribosome‐binding sequences •look for similarity to ORFs in other genomes •codon bias: some codons used more frequently in others •ORFs can be compared to ORFs in other genomes of known gene functions. can then have an annotated genome "1computer finds start codon, then stop codon 2computer finds rbs 3computer calculates codon bias 4computer decides of ORF likely to be genuine 5computer gives list of ORF" -from liles
-How could you detect the presence of gene sequences that had been horizontally transferred?
presenceofgenestypicallyfoundonlyindistantlyrelatedspeciessignalsgenesoriginatedfromhorizontaltransfer •presenceofaDNAwithGCcontentorcodonbiasthatdifferssignificantlyfromremainderofgenome •example:Thermotoga maritima, with400genes(20percent)archaeal origin •Phylogeneticdifferencemustbelargetobereadilydetectable(e.g., ChlamydiatrachomatiscontainshistoneH1‐likeproteins). •Horizontallytransferredgenestypicallydonotencodecoremetabolicfunctions.
-What are some disadvantages of Sanger sequencing compared to NGS?
sanger has lower sensitivity and lower ability of detection, takes longer because process is much slower,----------------Sanger method only sequences a single DNA fragment at a time, NGS is massively parallel, sequencing millions of fragments simultaneously per run.
-Give an example of a bioinformatics tool that helps in bioinformatic analysis.
silva, QIIME, Github, Mothur, all used to analyize microbial comminity sequence data
-What kind of life style among bacteria is associated with having a small genome? Give an example of this.
small genome size(~112‐140 Kb) (endosymbiont) obligate association with host=shrunken genome means such symbionts are totally dependent on host fornutrientsbutprovidehostwithessentialaminoacidsandothernutrientsthehostcannotsynthesize. •Mycoplasma genitalium (Bacteria)and Nanoarchaeum equitans(Archaea)have smallest genomes among parasitic prokaryotes.
-Describe the different stages of the life cycle of Streptomyces coelicolor. What stage of its life cycle are interrupted by bld mutants? What stage of its life cycle are interrupted by white mutants?
spore, germination,germinating spore,vegetative growth,vegetative mycelium, aerial growth, aeril hyphae,sporulation, spore chains vegetative hyphae--bld genes--aeril hyphae aeril hyphae--white genes--sporulation
-How do Min proteins affect the formation of a Z ring?
the min system prevents Z rings from assembling at the poles, thereby preventing minicell formation.
-Bacteria with smaller genomes would be more likely to have a higher percentage of genes involved in _______ processes, whereas bacteria with larger genomes would be more likely to have a higher percentage of genes involved in _______
translational, transcriptional regulation and signal transduction
-What does a rarefaction curve tell you? Draw a rarefaction curve and label the X and Y axis appropriately.
y=number of unique OTU's, x=number of sequences, a way of asking how well you sampled the diversity of the microbiome
3)Genetics of mutation What is the difference between forward and reverse genetics?What's the difference between selection and screening?
• Forward (classical) genetics • Phenotype is known (E.g. Huntington's disease, white eyes in Drosophilia)• Gene (or genes) are unknown Reverse genetics (post-genomics)• Gene (sequence) is known• Function/phenotype is not Selection•Allows only for growth of genetically marked cells •Positive selection - confer selective advantage (e.g.- antibiotic resistance) •Negative selection - eliminate or inhibit host growth (e.g. l even sucrase for sucrose sensitivity) Screening •Growth condition where both mutant and wild type are able to grow •HOWEVER - there is a phenotypic difference that discriminates between them •'produce and sort' •Can have an indicator •e.g. ability to ferment sugars (e.g. MacConkey) •Reporters (beta-galactosidase, luciferase, fluorescence)
-Define the components of a transposon
• Inverted repeat sequences • Transposase • selectable marker
Genetic Modification - Chapter 8 Study Guide Concepts -1)Restriction enzymes site recognition cleavage usage
• Restriction Enzymes catalyze the hydrolysis of phosphodiester bonds in DNA molecules at specific positions, designated by the sequence of the DNA base pairs. • Features of many (but not all) Type II enzymes • Palindromic recognition sequence • Recognition sequences usu. ranging from 4-8 nucleotides (e.g. '4- cutters' vs. '6-cutters')• CLEAVAGE USAGE? can leave sticky ends or blunt ends, ----------------------------- Q - What affect does the number of nucleotides have on the frequency of cut sites in a genome? "If each base occurs equally often in the DNA (i.e. the G + C content is 50%, which is approximately true for E. coli but not always for other organisms) and if the distribution of the bases is random, then a 6 base sequence would be expected to occur, on average, every 46 bases (=4096 bases). So an enzyme like EcoRI would be expected to cut the DNA into fragments with an average size of 4 kb. For enzymes recognizing a 4 base site, the expected average fragment size is 44 (=256) bases."
2)Plasmid Vectors What does a plasmid vector need to be useful? Different types of vectors (expression, BAC, etc)
• Symmetric vs. asymmetric cutting • Basic components of a plasmid vector? • Origin of replication • Selectable Markers • Cloning site • Accessories (BAC) system which is based on the F plasmid and is able to maintain inserts of greater than 300 kb. bacteriophage vectors, insertion vectors, replacement vectors, cosmids, bacterial artificial chromosome,bacteriophage M13 vectors
4)Gene Libraries Constructing a library 5) Screening Products from cloned genes & Making new genes Cloning PCR products - WHAT AND HOW? Site directed mutagenesis - WHAT and HOW? How would you combine cloning PCR products and site directed mutagenesis?
• gene library: Collection of recombinant clones each carrying a different piece of DNA from, or derived from, the organism of interest • Types • Genomic • cDNA • Random mutant • Others? site-directed mutagenesis. There are many ways of doing this; the basic concept of one method is shown in Figure 8.14. A short synthetic oligonucleotide is made that contains the altered sequence, and this is hybridized to a plasmid containing the complementary strand of the old gene. Although the sequences are not identical, there is sufficient similarity for binding to occur. The synthetic oligonucleotide (the mismatch primer) can then prime synthesis of the complete DNA strand, which now contains the altered sequence. After transformation, the mismatched sequences will both be replicated, so that some cells will contain the new gene and some the original.
