biology 100 final

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of

gene cloning

Which are products of cellular respiration?

carbon dioxide, water, and ATP

Enzymes like DNA an RNA polymerase are made (translated) here

(free) ribosomes in cytoplasm

What DNA elements do we need to have ion the recombinant DNA (vector + insert) if we want to (conditionally) express the gene? What are needed on the vector side, and what are needed on the insert side?

-On the vector there has to be an ori (replication origin) and an antibiotic resistant gene. There needs to be a site for insertion (restriction enzyme site) -On the insert side the gene needs to be flanked by a promoter and a terminator

Please provide two examples of how recombinant DNA has been used (in industry, to improve human life quality/health, etc.)?

-create pest-resistant plant -create bacteria cleaning up oil polution -manufacture recombinant insulin (humulin) -manufacture recombinant proteins dissolving blood clots.

Name four examples of proteins and their functions

1.) enzymes: Maltase 2.) structural: keratin 3.) transport: carrier proteins 4.) contractile: myosin

Glucose-6 phosphate dehydrogenase deficiency (G6PD) is inherited as an X-linked recessive allele in humans. A woman whose father suffered from G6PD marries a normal man. What proportion of their sons is expected to be G6PD

1/2

Cinnabar eye color is a sex-linked, recessive characteristic in fruit flies. If a female having cinnabar eyes is crossed with a wild-type male, what percentage of the f1 males will have cinnabar eyes?

100%

PCR amplifies target segments by a factor of _______ each cycle

2

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. Hoe many times would the HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

2 times

The human genome contains approximately _________ genes

21,000

Which of the following pairs of base sequences could from a short stretch of a normal double helix of DNA 1. 5′-AGCT-3′ with 5′-TCGA-3′ 2. 5′-GCGC-3′ with 5′-TATA-3′ 3. 5′-ATGC-3′ with 5′-GCAT-3′ 4. All of these pairs are correct

3. 5′-ATGC-3′ with 5′-GCAT-3′

In a double-stranded DNA, T accounts for 20% of all nucleotides. Then numbers of G should be:

30% of all nucleotides

Which statement is true? 1. Individuals evolve through natural selection 2.Individual organisms evolve structures that they need 3. Natural selection works on non-heritable traits 4.Natural selection works on variation already present in a population

4. Natural selection works on variation already present in a population

which of the following statements about the 5' end of a DNA strand is correct? 1. The 5' end is identical to the 3' end 2. The 5' end is the fifth position on one of the nucleobases. 3. The 5' end has an open hydroxyl group. 4. The 5' end is attached to a cap structure. 5. The 5' end has an open phosphate group.

5. The 5' end had an open phosphate group

Which of the following organelles contain(s) two layers of lipid-bilayer membrane? 1. smooth ER 2. rough ER 3. Golgi 4. ribosome 5. mitochondrion 6. nucleus 7. lysosome

5. mitochondrion 6. nucleus

which equation best summarizes photosynthesis?

6 CO2 + 6 H2O → C6H12O6 + 6 O2

The size of a haploid human genome is approximately 10^x bp, where x is

9

Approximately what percentage of the human genome consists of noncoding DNA?

98.5%

What compound DIRECTLY provides energy for cellular work?

ATP

The Calvin cycle requires ___________ and __________ from the light reactions in order to operate

ATP; NADPH

The pedigree below traces the inheritance of alkaptonuria, a biochemical disorder. Affected individuals, indicated here by the colored circles and squares, are unable to metabolize a substance called alkapton, which colors the urine and stains body tissues. Does alkaptonuria appear to be caused by a dominant allele or by a recessive allele? Fill in the genotypes of the individuals whose genotypes can be deduced. What genotypes are possible for each of the other individuals?

Alkaptonuria appers to be caused by a recessive allele. The genotypes of the individuals are as follows George: Aa, Arlene:aa, Sandra: AA or Aa, Tom:aa, Sam:Aa, Wilma:aa, Ann: Aa, Michael: Aa, Daniel: Aa, Alan:Aa, Tina:AA or Aa, Christopher:Aa or AA, Carla:aa

A promoter is essential for transcription initiation and has a consensus sequence TATAA and hence it is often called the 'TATA' box. In the diagram we see a double-stranded DNA and a promoter sequence TATAA on the top strand of the double-stranded DNA. With a structure like this, do we expect to see transcripts on the right, on the left, or both? Why?

Because TATA box is on the top strand the transcription will only be initiated on its right side (downstream) (2 pts). It will not be transcribed to the left because the reverse complement sequence of the TATAA is TTATA at the bottom strand, and is not a TATA box sequence (and hence not a promoter at the bottom strand) (1 pt).

Transgenic animals are currently produced for many different reasons. Choose an example of a transgenic animal that currently does not exist. 1. chickens that have been modified to be able to lay eggs in very hot temperatures 2. pigs that carry a roundworm gene to produce omega-3 fatty acids 3. dairy cows that carry an Angus cattle gene so that they do not grow horns 4. Atlantic salmon that have been modified to grow twice as fast as normal

Chickens that have been modified to be able to lay eggs in very hot temperatures

The Calvin cycle makes direct use of _________ to make _______

CO2, ATP and NADPH; sugar

When body temperature is too low, what occurs? A. Blood vessels at the body surface dilate and fill with blood. B. fluid intake increases C. Sweat glands are activated. D. Blood vessels in the skin constrict.

D. Blood vessels in the skin constrict

The central rule of molecular biology states that

DNA is transcribed into RNA, which is translated into protein

Transport vesicles move proteins from the endoplasmic reticulum to what other organelle?

Golgi

Transport vesicles move proteins form the endoplasmic reticulum to what other organelle?

Golgi apparatus

The endomembrane system includes ________

Golgi apparatus, lysosomes, vacuoles, and the endoplasmic reticulum

Which molecule is the source of electrons for the light reactions?

H2O

________ is the source of the oxygen gas released by a photosystem

H2O

In photosynthesis, redox reactions ultimately transfer electrons from _________ to ______

H2O ; CO2

Professor X identified a hormone that could help boost human immunity. What could be this hormone made of (carbohydrates, lipids, proteins, or nucleotides)? Assuming your first guess is not correct, what would be your next guess and why?

Hormones could be protein (insulin), or lipid (steroid). (2 +1 points)

The world's first genetically engineered pharmaceutical product was

Humulin

Below is the 5' end (the beginning) of the human alpha-tubulin mRNA. Please use the codon table to translate the first six amino acids. 5'-AGUUCUCACUGAGACCUGUCACCCCGACUCAACGUGAGACGCACCGCCCGGACUCACCAUGCGUGAAUGCAUCUCAGUCCACGUGGGGCAGGCAGGUGUCCAGAUGGGCAAUGCCUGCUGGGAGCUCUAUUGCUUGGAACAUGGGAUUCAGCCUGAUGGGCAGAUGCCCAGUGACAAGAC...

Met - Arg - Glu - Cys - Ile - Ser

Which of the following statements about the DNA in one of your brain cells is true? 1. Most of the DNA codes for protein. 2. It is the same as the DNA in one of your liver cells. 3. The majority of genes are likely to be transcribed. 4. Each gene lies immediately adjacent to an enhancer.

It is the same as the DNA in one of your liver cells

which part of cellular respiration produces the most NADH?

citric acid cycle

Of these steps, which one occurs earliest in the process of producing recombinant DNA?

Restriction enzymes ate used to isolate the gene of interest and to cut the plasmid DNA

The first electron acceptor of cellular respiration is

NAD+

The first electron acceptor of cellular respiration is __________.

NAD+

Professor Chang said in the class that when growing Tetrahymena thermophila we do not need to specially provide lipids. Indeed, most lipids can be synthesized from carbohydrates (glucose). Can we synthesize amino acids or nucleic acids from glucose? Why or why not?

No, we can not synthesize amino acids or nucleic acids from glucose because we are missing some key ingredients. Glucose does not have nitrogen or phosphorus while both nucleic acids and amino acids are built using nitrogen and nucleic acids also use phosphorus.

In a species certain codons are preferentially used. This phenomenon is called

codon bias

Which molecule is produced during the light reactions of photosynthesis?

O2

In addition to providing humans a stable source of proteins, what is the other important nutrient salmons provide that is essential to humans?

Omega-3 and omega-6 oil

Describe one emergent property

One emergent property is the cardiovascular system. Muscle cells make up cardiac tissues which make up our heart, an essential organ of the cardiovascular system. The heart then makes it possible to oxidize blood and pump it throughout the body to other area that need it to allow ones entire being to function/live. In summery a muscle cell allows for cardiac tissue, which creates the heart (organ), which is the a fundamental piece for the vascular system, which allows humans (organism) to function.

What is the method that Hamilton is using to detect the presence of Covid-19 virus

PCR

The best (most cost-effective) way to run a metagenomic project is to use

PacBio sequencing

Provide 3 differences between prokaryotic and eukaryotic cells

Size: eukayrotic cells are much larger than prokaryotic ones. Membrane-bound organelles are found in eukaryotes, but not prokaryotes. Eukaryotic DNA is mostly linear whereas prokaryotic one is mostly circular. Other possibilities: prokaryotic cells often have (peptidyl-glycan) cell wall. mRNA structures are different.

To introduce foreign genes into mouse embryo cells, the best method is?

The best is microinjection because this way you can be sure if every cell receive the foreign genes. (4 pts)

A man with type A blood marries a woman with type B blood. Their child has type O blood. What are the genotypes of these individuals? What other genotypes, and in what frequencies, would you expect in offspring from this marriage?

The blood type of the man would be AO. The blood type of the female would be Bo. The other genotypes I would expect in offspring from this marriage would be OO, AO, Bo, and AB. Their frequencies would be 1/4 for all.

The similarity of the embryos of chickens and humans is evidence of ____

common ancestry

Which of the following is an example of post-transcriptional control of gene expression? 1. the binding of transcription factors to a promoter 2. gene amplification contributing to cancer 3. the removal of introns and alternative splicing of exons 4. the addition of methyl groups to cytosine bases of DNA

The removal of introns and alternative splicing of exons

You are attempting to link an individual to a crime. The only evidence you have is a tiny drip of blood. How can you use this drop of blood to DEFINITIVELY make the association?

You can use PCR to increase the amount of DNA available for STR analysis

The nuclear envelope is composed of ___________

a double membrane

Cystic fibrosis is a serious respiratory disease that is caused by the expression of a mutant form of the cystic fibrosis transmembrane regulator (CFTR) protein. Suppose that gene therapy was being used to attempt to treat cystic fibrosis. What biological component would be required for this treatment?

a virus that contains the healthy form of the CFTR gene in its genome

A hormone that is secreted form a cell is manufactured by ribosomes___________

attached to the rough endoplasmic reticulum

Which animal is an ectotherm? a. field mouse b. spiny lobster c. parrot d. elephant e. human

b. spiny lobster

For most people, blood sugar levels rise to over 7 mmol/L after ingesting a meal. What is most likely responsible for the return of blood sugar levels to 5 mmol/L a) type 2 diabetes b) a homeostatic mechanism based on negative feedback c) a homeostatic mechanism based on positive feedback d) the use of the sugar as an energy source by your cells

b.) a homeostatic mechanism based on negative feedback

In what type of organism was the CRISPR-Cas9 system discovered?

bacteria

Restriction enzymes are obtained from

bacteria

The antigenic part the determines the ABO blood type is

carbohydrates

Where in the cell does glycolysis occur?

cytoplasm

The urinary system is responsible for the elimination of urea. the reabsorption of valuable solutes, and reabsorbing water. Which of those processes occur in the kidney? a) reabsorbing waterb) elimination of ureac) reabsorption of valuable solutesd) all three processes occur in the kidney d) all three processes occur in the kidney

d.) all 3 processes occur in the kidney

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this animal practices homeostasis with respect to the salt concentration of its body fluids, its salt concentration will show _________. a) no variations b) a cyclic variation identical to that of the surrounding water c) slight variations, but only when the external salinity is changing rapidly d) slight, continuous fluctuations

d.) slight, continuous fluctuations

What name is given to this reaction: galactose + glucose --> lactose + water

dehydration

When plasmids are used to produce a desired protein, the ...

desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium

STR analysis is a DNA profiling technique that makes use of the fact that different people have __________

different numbers of repeats of shirt DNA sequences at certain sites in the genome

Glycerol from the membrane lipids are often attached to three fatty acid chains

false

Human genome is about 10 times larger than that of nematode. We can assume humans have 10 times more genes than nematode does?

false

there are only 20 different kinds of amino acids

false

Which process describes the forcing of water and other small molecules from the blood into a kidney tubule?

filtration

Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by __________

gel electrophoresis

The scientific field that studies complete sets of genes is called

genomics

Carbohydrates can provide energy (like glucose), or structural support (like cellulose). Can you provide two other functions associated with carbohydrates and corresponding molecules?

glycogen/starch - energy storage artificial sweetener - xylitol (sugar alcohol) heparin - blood thinner materials to build soft bone (cartilages) - structural

One difference between eukaryotic and prokaryotic cells is that eukaryotic cells __________ prokaryotic cells

have membrane-enclosed structures called organelles, which are lacking in

DNA and RNA base pairings are mediated through

hydrogen bonds

The side chain of threonine is

hydrophilic

The side chain of isoleucine is ___________

hydrophobic

A protist that contractile vacuoles most likely lives __________

in fresh water

Gel electrophoresis separates DNA fragments on the basis of differences in their _______.

length

Function of the smooth endoplasmic reticulum include ____________

lipid synthesis and drug detoxification

Functions of the smooth endoplasmic reticulum include ____________.

lipid synthesis and drug detoxification

Based on its function in detoxifying drugs, one would expect to find a large amount of smooth endoplasmic reticulum in _________ cells

liver

Tay-sachs disease results from _________ lacking a specific type of lipid-digesting enzyme

lysosomes

A codon

may code for the same amino acid as another codon

Electron transport takes place in the ___________

mitochondria

The TCA cycle takes place in the _____________

mitochondria

Which characteristic of mitochondria suggests they might have evolved from free-living bacteria?

mitochondria have their own DNA

Please rank the following biological organization, from small to large

molecule, cell, tissue, organ, body system, organism, population, community, ecosystem

In human gene therapy

normal versions of human genes are transferred to patients who carry a mutated allele

Which structure manufactures the components of ribosomes?

nucleolus

Where does protein synthesis take place?

on ribosomes

A process is referred to as aerobic if it requires

oxygen

In a fish (the real one swimming in the water) the final electron acceptor of aerobic respiration is

oxygen

Why does measuring oxygen consumption estimate how a Burmese python generates body heat?

oxygen is consumed during cellular respiration, which generates heat

When RNA is synthesized (transcription) nucleotides are linked by

phosphodiester bonds

________ are the major lipids of plasma membranes

phospholipids

_________ are the major lipids of plasma membranes

phospholipids

You find a cell of a type you have never seen before. The cell has both a nucleus and a cell wall. Therefore, you conclude that it is likely to be a(n) ________ cell

plant

During his trip on the Beagle, Darwin found that....

plants and animals living on a continent seemed more closely related to each other than to plants and animals living in similar regions on other continents

Photosynthetic organisms are __________.

producers that make their own organic matter from inorganic molecules

Respiration describes the exchange of gas between your blood and the air. Cellular respiration ________.

produces ATP

For a eukaryotic protein-coding gene, please arrange the following elements in the correct order: coding sequence, promoter, first AUG, terminator, UAG (stop codon), 5' UTR, 3'UTR, transcription start site (TSS), and poly-adenylation signal. After you arrange these features, what will be the structure of the mRNA? Please remember to add mRNA features not found in DNA.

promoter-TSS-5'UTR-AUG-coding sequence-stop codon-3'UTR-poly A signgal-terminator (4 pts) 5'cap- TSS-5'UTR-AUG-coding sequence-stop codon-3'UTR-poly A signgal-PolyA tail (4 pts)

What is a function of the Golgi apparatus?

protein modification

Which is a function of the Golgi apparatus?

protein modification

The study of the full protein sets that genomes encode is _________

proteomics

A product of glycolysis is ________

pyruvic acid

Which is a function of the plasma membrane?

regulate traffic of chemicals in and out of the cell

Natural selection _____________

results in evolutionary adaptation

When an RNA virus infects a cell, this virus most likely will go to ________ after entering the cell

ribosome

The best way to sequence a single gene is to use

sanger sequencing

Photosynthesis contributes to plant growth by ___________

taking in carbon dioxide and making sugars (carbohydrates)

glycolysis results in _________

the conversion of glucose to pyruvic acid

The specificity of PCR is provided by

the primers

The ultimate source of energy in food is

the sun

In humans, goosebumps are a vestige of a mammalian adaptation related to ____________.

thermoregulation

One reason plants have accessory pigment molecules, like chlorophyll b and carotenoids, is __________

to absorb energy in parts of the electromagnetic spectrum that chlorophyll a cannot

What is the main function of the CRISPR-cas9 system?

to alter the nucleotide sequences of specific genes in a living cell

The most abundant elements in human genome are?

transposon related sequences (transposable elements)

Carbohydrates, lipids, and proteins can all be oxidized (broken down) to generate ATPs through the TCA cycle and electron transport chain

true

In modern human DNA we can detect Neanderthal and Denisovan specific genes. This observation indicates that these three human species interbred with each other a long time ago

true

Mitochondria have their own ribosomes and translate some proteins they need

true

Translation requires mRNA, tRNA and rRNA

true

The best way for viewing living cells in the ___________.

use of light microscope

The waste products of cellular respiration include ____________

water and carbon dioxide