Biology 1610 Exam 1.1 UVU

Which of the following correctly reflects the process of science?

1. Observation 2. question 3. hypothesis formulation 4. experiment 5. support or refute hypothesis

In the DNA of certain cells, 20% of the nucleotides are adenine nucleotides. What are the percentages of the other nucleotides in the DNA?

20% thymine, 30% guanine, 30% cytosine

A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be _____.

3' AAA-GAA-TAA-CAA 5'

What anticodon in tRNAMet would pair with the mRNA codon 5'-AUG-3'?

5'-CAU-3'

b. Transcribe the DNA sequence into the final mRNA and select the correct sequence from the choices below. (Note: this DNA sequence is the same as in the previous question) 5' AATGAATC...CTCGTATGAAAGCATAATCTTGAGGGCTGACGTGTGGTATGC 3' 3' TTACTTAG...GAGCATACTTTCGTATTAGAACTCCCGACTGCACACCATACG 5'

5'CUCGUAUGAAAGCAUAUGAGGGCUGACGUGUGGU3'

An atom of oxygen has an atomic number of 8 and an atomic mass of 16 (16O). An isotope with an atomic mass of 18 (18O) is also stable. You would expect to find_____valence electrons and_____ neutrons in 18O?

6; 10

You have a mutant cell that is unable to perform translation and when you examine the cellular molecules you find that none of the alanine tRNAs are charged. Where do you think the likely defect in this cell is?

A defect in an amino-acyl tRNA synthetase so it cannot perform its function.

Looking at the structure of DNA below, the 5' end of DNA is represented by the letter________ , while a guanine-cytosine base pair is represented by the letter________.

A; C

Which of the following occurs in the E site of the ribosome during translation?

An uncharged tRNA is ejected from this site as the ribosome slides to the next codon.

This structure is specifically called a DNA nucleotide . The bonds that connect this monomer to another monomer of its kind are called phosphodiester bonds bonds.

Answer 1 DNA nucleotide Answer 2: phosphodiester bonds

[select ] is the measure of the tendency an atom has of pulling electrons closer to its nucleus. This "power" will determine if a bond between two atoms will be of equal sharing called [ Select ] bonds, or unequal sharing called [ Select ] bonds. When the "power" of one atom is very high compared to another atom, the stronger atom will strip the electron away from the weaker atom completely. This results in charges on the atoms. When these charges are attracted to one another, their resulting bond is a(n) [ Select ] bond.

Answer 1:Electronegativity Answer 2:nonpolar covalent Answer 3:polar covalent Answer 4:ionic

Below is a double stranded molecule of DNA. The promoter region is marked in bolded purple and the terminator region is the bold 5'TGGT3' sequence located at the right side of the top strand and includes the complimentary bases on the bottom strand. The underlined region represents an intron. Use this information to answer the question that follows. a. In the following DNA molecule the [ Select ] strand is the template and the [ Select ]strand is the coding strand. 5' AATGAATC...CTCGTATGAAAGCATAATCTTGAGGGCTGACGTGTGGTATGC 3' 3' TTACTTAG...GAGCATACTTTCGTATTAGAACTCCCGACTGCACACCATACG 5'

Answer 1:bottom Answer 2:top

d. The A-T nucleotide base pair marked with a teal highlight is mutated to a G-C base pair (the A is mutated to G and the T is mutated to C). Use the codon table below and answer the following questions (Note: this DNA sequence is the same as in the previous question). Will this mutation will have a large or small effect on the tertiary structure of this protein? [ Select ] Because of the mutation the amino acid changes from [ Select ] to [ Select ] Because of the mutation the amino acid changes from [ Select ] to [ Select ] Tertiary structure is defined as [ Select ] 5' AATGAATC...CTCGTATGAAAGCATAATCTTGAGGGCTGACGTGTGGTATGC 3' 3' TTACTTAG...GAGCATACTTTCGTATTAGAACTCCCGACTGCACACCATACG 5'

Answer 1:large Answer 2:lys Answer 3:glu Answer 4:positively charged Answer 5:negatively charged Answer 6:the final folded structure of a single peptide chain

Below is a molecule with several functional groups. Match the functional groups (A, B, C, D, E, F...) with their correct name. NOTE: There is one functional group missing from the molecule below. The chemical formula of the functional group -CH3 and is listed as "-CH3 Functional Group". Select the name that matches it.

Functional Group A Amino Group Functional Group B Phosphate Group Functional Group C Carbonyl Group Functional Group D Hydroxyl Group Functional Group E Sulfhydryl Group Functional Group F Carboxyl Group -CH3 Functional Group Methyl Group

Which of the following does not occur in prokaryotic gene expression, but does occur in eukaryotic gene expression?

Introns are removed from the RNA transcript through splicing A guanosine cap is added to the 5' end of the RNA transcript

c. Correctly translate this DNA sequence into the encoded protein. Use the codon table below. (Note: this DNA sequence is the same as in the previous two questions) 5' AATGAATC...CTCGTATGAAAGCATAATCTTGAGGGCTGACGTGTGGTATGC 3' 3' TTACTTAG...GAGCATACTTTCGTATTAGAACTCCCGACTGCACACCATACG 5'

MET-LYS-ALA-TYR-GLU-GLY-STOP

The function of a protein is dependent upon the shape into which the chain of amino acids folds. Many noncovalent interactions are responsible for maintaining the protein's shape. Assume you have isolated a protein from an organism in its proper shape, and you have treated it with an enzyme that selectively targets and breaks only the peptide bonds in the proteins. Would the protein retain its shape under these conditions?

No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together.

_____ are the subunits (monomers) of nucleic acids, and ____ are the subunits (monomers) of proteins.

Nucleotides; amino acids

During translation the ________ site within the ribosome holds the growing amino acid chain, while the___________ site holds the next amino acid to be added to the chain.

P...A

In the process of transcription, _____.

RNA is synthesized

The terms alpha helix and beta sheet are associated with which level of protein structure?

Secondary

Pyrimidines are ________________

Small, single-ringed nitrogenous bases such as cytosine, thymine, and uracil

What is meant by the description "antiparallel" regarding the strands that make up DNA?

The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand.

Several chemical properties make water uniquely suited for its role as a central "molecule of life." Which of the following is false?

The H and O atoms in the water molecule are held together by hydrogen bonds.

If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level?

The RNA polymerase would not know where to start transcription, so no RNA would be made.

You are investigating an abnormal eukaryotic cell line that makes all of its mRNAs much longer than the mRNAs from normal cells. Intrigued, you examine the proteins in these abnormal cells and note that many of them are either much longer or much shorter than the normal proteins from non-mutant cells. Assuming there is just one mutant defect in these cells, which of the below possibilities is most likely?

The spliceosome is nonfunctional so introns are not removed

Based on the structure below, which of the following statements is true?

This is a polar amino acid so it will be able to form hydrogen bonds with other polar R groups in the protein.

_________ regulate(s) which genes or subsets of genes will be transcribed in a particular cell type.

Transcription factors

When nucleotides polymerize (form polymers by joining monomers) to form a nucleic acid _______________.

a covalent bond forms between the sugar of one nucleotide and the phosphate of a second

The term "amphipathic" means ____________.

a molecule containing both hydrophobic and hydrophilic regions with the hydrophilic portions in contact with water

Which of the following descriptions best fits the class of molecules known as nucleotides?

a nitrogenous base, a phosphate group, and a sugar

The most commonly occurring mutation in people with cystic fibrosis is a deletion of a single codon. This results in _____.

a polypeptide missing an amino acid

You are studying a nucleotide macromolecule and determine that its structure contains a pyrimidine nitrogenous base and a five-carbon sugar with an -OH (hydroxyl) group attached to both the 2' and 3' carbons. What nucleotide is this?

an RNA nucleotide with a uracil base

This structure is a(n) [ Select ] The bond that connects this monomer to another monomer of its kind is called a [ Select ] bond.

answer 1:amino acid Answer 2:peptide

When carrying out a controlled experiment, it is important to:

change only one variable at a time

Sucrose is a _________ while glucose is a __ .

disaccharide...monosaccharide

A pair of atoms joined by a polar covalent bond:

has a slight positive charge on one atom and a slight negative charge on the other.

Many salmon return to the place where they were born to lay eggs. You hypothesize that they use visual cues to find their way back. To test your hypothesis, you put blinders on the salmon so they cannot see and then examine whether or not they are able to return to their birthplace. You find that they are unable to find their way back. From this experiment, you:

have supported your hypothesis.

Which of the following bonds rely on the attraction of positive and negative charges?

ionic and hydrogen bonds

In a eukaryotic cell, transcription occurs in the ____________ and translation occurs in the_______________.

nucleus....cytoplasm

A mutant bacterial cell has a defective aminoacyl-tRNA synthetase that attaches a lysine to tRNAs with the anticodon AAA instead of the normal phenylalanine. The consequence of this for the cell will be that _____.

proteins in the cell will include lysine instead of phenylalanine at amino acid positions specified by the codon UUU

Which level of protein structure does this statement describe? "There are multiple folded polypeptides interacting with each other using noncovalent interactions."

quaternary

Translation is the process by which:

ribosomes synthesize proteins from information in an RNA molecule.

The protein proteorhodopsin consists of a single polypeptide chain. What is the highest level of structure found in this protein?

tertiary

Transcription is sometimes described as a process in which RNA is "copied" from the template strand of a DNA. This statements is potentially misleading because: (select all possible answers)

the RNA transcript has a complementary sequence of bases to the template strand. RNA nucleotides contain ribose and so cannot be an exact copy of DNA. the RNA transcript and the DNA template strand are antiparallel. RNA molecules contain uracil instead of thymine

Why are hydrocarbons (chains of hydrogens and carbons) insoluble in water?

the majority of their bonds are nonpolar covalent

Which of the following components of an amino acid differs from one amino acid to another?

the side group