Biology Exam 3
Which of the following statements about convergent evolution is true? Multiple Choice: (a) It demonstrates how similar environments can lead to different physical structures. (b) It demonstrates how similar environments can lead to the same physical structures. (c) It demonstrates that similarity of structures is due to descent from a common ancestor. (d) It demonstrates that similarity of structures is due to random chance.
(b) It demonstrates how similar environments can lead to the same physical structures.
A particular person is said to be a carrier of a genetic trait. What does this tell you about the person's phenotype? Multiple Choice: (a) The person physically shows the trait. (b) The person physically shows the trait more than a noncarrier would. (c) The person physically shows a partial version of the trait. (d) The person does not physically show the trait.
(d) The person does not physically show the trait.
natural selection
- Discovered by Darwin and Wallace - species "descend with modification" from ancestor species (new species arise from previous species). - Evolutionary change occurs when allele frequencies in a population change over time. - the process by which a population gains one or more alleles that enable it survive better than other populations (acts on the phenotype). - favorable traits become increasingly common in future generations because unfavorable traits are lost when organisms die or fail to reproduce. - the process by which individuals with advantageous genetic characteristics for a particular environment survive and reproduce at a higher rate than do individuals with other, less useful characteristics
base
1. A chemical compound that accepts hydrogen ions (H+) in aqueous surroundings. 2. The nitrogen-containing component of nucleotides. 3. The four nitrogen bases of DNA are Adenine (A), Cytosine (C), Guanine (G), or Thymine (T). In RNA, thymine is replaced by uracil.
Differences between DNA and RNA
1. RNA is single-stranded 2. RNA uses uracil instead of thymine 3. RNA uses ribose for its sugar
If given the DNA sequence TTACAGCGTACG on a template strand of DNA, what would be the base sequence of the new strand? Choose one: A. AATGTCGCATGC B. AAUGUCGCAUGC C. CCGTGATACGAA D. GGCACTATGCTT
A. AATGTCGCATGC
Given the template DNA sequence GCAGCATGTT, identify each of the following mutations to the complementary strand as an insertion, a deletion, or a substitution. A. CGTCGTACA B. CGTGGTACAA C. CGTCGTACTAA
A. deletion B. substitution C. insertion
Over the last 45 years, the average global temperature has risen 1.71ºF (0.95ºC), with land temperatures rising faster than ocean temperatures. Sort the responses to global warming as they relate to artificial selection or natural selection. Responses: A. A seed company genetically modifies soy beans to be drought resistant. B. A researcher discovers that the endangered Quino checkerspot butterfly is reproducing north of its historical habitat. C. Corals that live in warm pools survive and reproduce better than corals that live in cooler water. D. Ranchers switch to growing a breed of cow that is less susceptible to heat stress. E. A farmer plants corn seed she kept from all the plants that survived a particularly hot summer last year.
Artificial Selection: D. Ranchers switch to growing a breed of cow that is less susceptible to heat stress. A. A seed company genetically modifies soy beans to be drought resistant. Natural Selection: B. A researcher discovers that the endangered Quino checkerspot butterfly is reproducing north of its historical habitat. C. Corals that live in warm pools survive and reproduce better than corals that live in cooler water. E. A farmer plants corn seed she kept from all the plants that survived a particularly hot summer last year.
Which of the following karyotypic sex chromosome abnormalities results in a male phenotype? (select all that apply). A. XO B. XXY C. XXX D. XYY E. XXXY F. XY with the complete deletion of the SRY gene
B, D, E
Hemophilia is a sex-linked disorder that is caused by a recessive allele. If the mom is a carrier of hemophilia and the dad doesn't have hemophilia, what is the chance that they will have a child with hemophilia? Choose one: A. 100% chance B. 25% chance C. 50% chance D. 75% chance
B. 25% chance
The typical number of chromosomes in a human is ______. Choose one: A. 23 B. 46 C. 69 D. 92
B. 46
Given the template strand of DNA, select the correct complementary strand. TTACGAGCCCGTT Choose one: A. TTACGAGCCCGTT B. AATGCTCGGGCAA C. GGCATCTAAATCC D. AACGGGCTCGTAA
B. AATGCTCGGGCAA
How does DNA support the theory of evolution? Choose one or more: A. DNA is first transcribed into mRNA before it is translated into proteins. B. All living things universally use DNA as their genetic material. C. DNA sequences in closely related organisms are more similar to each other than sequences in distantly related organisms. D. The genetic code used by all living things to make proteins is based on the information contained in DNA. E. DNA can be used with different genetic codes by different organisms.
B. All living things universally use DNA as their genetic material. C. DNA sequences in closely related organisms are more similar to each other than sequences in distantly related organisms. D. The genetic code used by all living things to make proteins is based on the information contained in DNA.
The purpose of constructing a pedigree for a patient with a genetic disorder and their family is Choose one: A. to try to determine the best course of treatment for the disorder. B. to try to determine how the disorder may have been inherited. C. to track down family members who might have the disorder and don't know it. D. to predict the inheritance of the disorder in future generations.
B. to try to determine how the disorder may have been inherited.
How do cells minimize the accumulation of mutations?
Built in backup and proofreading systems, just like in mitosis and meiosis
A bacterial gene is inserted into a plant cell. What is the most likely plant response? Choose one: A. The DNA remains untranscribed in the cytoplasm. B. The plant destroys the foreign DNA. C. The plant produces a new protein. D. The plant's immune system kills the bacterium.
C. The plant produces a new protein.
Like all mammals, whales are warm-blooded, have backbones, breathe air, and nurse their young from mammary glands that produce milk. Why do whales, which are aquatic, have so much in common with a land-dwelling mammal like a deer? Choose one: A. As a result of convergent evolution, both animals developed similar characteristics. B. Although they do not share a common ancestor, whales and deer share many similarities in their genetic code. C. They share a common ancestor; over time, populations diverged into separate lineages with one ultimately leading to whales and the other to deer. D. Genetic mutations occur randomly; therefore, it is a random chance that the two animals share many characteristics.
C. They share a common ancestor; over time, populations diverged into separate lineages with one ultimately leading to whales and the other to deer.
Biological evolution is a change in allele frequencies in _________ over time Multiple Choice: A. an individual B. a species C. a population D. a community
C. a population
Example of modern day biogeographical evidence for evolution?
Certain species of animals can only be found in areas where they were originally found in before Pangea split.
CRISPR/Cas9
Clustered regularly interspaced short palindromic repeats. An RNA sequence that guides molecular machinery to a DNA sequence through complementary base-pairing.
How does the ribosome in translation know when to start and stop?
Codon and Anticodon (bases are read in groups of 3)
Put the following steps of gene therapy in order: Steps: A. the virus is mixed with the patient cells. B. The genetically altered cells are injected back into the patient. C. A healthy copy of the missing or damaged gene is inserted into the virus. D. Cells are removed from the patient. E. The cells integrate the new gene into their genomes. F. In the laboratory, a virus is altered so that it is unable to cause disease. G. Thanks to the new gene, the cells now produce the desired protein.
Correct order: D. Cells are removed from the patient. F. In the laboratory, a virus is altered so that it is unable to cause disease. C. A healthy copy of the missing or damaged gene is inserted into the virus. A. the virus is mixed with the patient cells. E. The cells integrate the new gene into their genomes. B. The genetically altered cells are injected back into the patient. G. Thanks to the new gene, the cells now produce the desired protein.
In 2005, a human clinical trial began in Germany to test gene therapy as a treatment for the recessive X-linked disease Wiskott-Aldrich syndrome. The syndrome affects blood cells and causes recurrent infections, pneumonia, bleeding, and rashes. Patients often develop leukemia or lymphoma and die of complications due to infections. Felix, a boy with the syndrome, entered the trial in 2009. Blood cells were removed from his body and genetically engineered using a virus to express a functional copy of the gene that is defective in the syndrome. The genetically engineered cells were reintroduced into Felix's body where they produced the protein that he was lacking. A year after the treatment his body was producing healthy, functional blood cells and most of his symptoms were resolved. Felix was cured! Now that he is cured, what are the chances of Felix passing the Wiskott-Aldrich syndrome allele to his children? Choose one: A. 100 percent chance of passing it to his sons B. 100 percent of passing it to all of his children C. zero percent chance of passing it to any of his children D. 100 percent chance of passing it to his daughters
D. 100 percent chance of passing it to his daughters
If a mature mRNA is 522 bases long, how many amino acids will be in the protein? Choose one: A. 522 amino acids B. 1,566 amino acids C. 174 amino acids D. 173 amino acids
D. 173 amino acids
Fill in the blanks with the correct terms: ________________ occurs in all living organisms prior to mitosis. The double helix unwinds, and the two strands break apart. Each strand of DNA serves as a template from which a new strand is copied. _____________ builds each new strand of DNA using _________ located near the _______________________. This mode of replication is known as ___________________ because one "old" strand (the template strand) is retained, or "conserved", in each new double helix.
DNA replication, DNA polymerase, primers, origins of replication, semiconservative replication
nucleosome
DNA wrapped around histone proteins that, in multiples, form the beads-on-a-string complex in a chromatin fiber
Fill in the blanks with the correct terms: Genes are composed of ________, which consists of two parallel strands of repeating units called ______________ twisted into a _____________.
DNA, nucleotides, double helix
Single base insertions and deletions example: The red fox was red and tan What is the deletion and insertion?
Deletion: The edf oxw asr eda ndt an Insertion: The ree dfo xwa sre dan dta n
DNA
Deoxyribonucleic acid, the genetic code of life, consisting of two parallel strands of nucleotides twisted into a double helix. DNA is the genetic material that transfers information from parents to offspring.
What are the requirements for evolution via natural selection?
Differential reproduction and survival (competition; lots of individuals)
Match the correct definition with the pattern of natural selection. Definitions: A. Intermediate phenotype has advantage over both extremes. B. One extreme phenotype has advantage over other phenotypes. C. Extreme phenotypes have advantage over intermediate phenotypes. Patterns of natural selection: Directional Selection Stabilizing Selection Disruptive Selection
Directional Selection: B. One extreme phenotype has advantage over other phenotypes. Stabilizing Selection: A. Intermediate phenotype has advantage over both extremes. Disruptive Selection: C. Extreme phenotypes have advantage over intermediate phenotypes.
Which amino acid sequence will be generated during translation from the following small mRNA: ...CCC-AUG-UCU-UCG-UUA-UGA-UUG...? Multiple Choice: A. Met-Glu-Arg-Arg-Glu-Leu B. Met-Ser-Ser-Leu-Leu C. Pro-Met-Ser-Ser-Leu-Leu D. Pro-Met-Ser-Ser-Leu E. Met-Ser-Ser-Leu
E. Met-Ser-Ser-Leu
Sickle cell disease is inherited as a recessive genetic disorder in humans; the normal hemoglobin allele (H) is dominant to the sickle cell allele (h). For two parents of genotype Hh (carriers), construct a Punnett square to show the possible genotypes of their children. What are the possible genotypes? What are the possible phenotypes? Given that the normal hemoglobin allele (H) is dominant to the sickle cell allele (h), each time two Hh individuals have a child together what is the chance that the child will have the sickle cell disease?
Hh CROSSES with Hh Possible Genotypes: HH, Hh, Hh, hh (1/4 HH, 1/2 Hh, 1/4 hh) Possible Phenotypes: 3/4 normal, 1/4 sickle cell disease Chance child will have sickle cell disease: 1/4 = 25% chance
Select the correct terms: To work on removing PERV DNA from the pig genome, researchers first replicated the DNA many times, using (PCR / CRISPR). This process increases the amount of DNA so that they are able to run experiments to edit the genome, using (PCR / CRISPR).
PCR, CRISPR
The volleyball player was prescribed a 10-day course of methicillin to treat her infection. By day 7, her wound appeared to have healed and was no longer inflamed and warm to the touch, so she stopped taking the methicillin thinking that the infection had been eradicated. While most of the bacteria had been killed, there were some still lingering in the wound site. Once she stopped taking the antibiotic, they started multiplying and within two weeks, the wound was once again inflamed, warm to the touch, and very painful. The population had once again reached 1,000 individuals, with 350 of them the SS type and 650 of them the FT type. There were no bacteria left that were fully susceptible to methicillin. Now what is the percentage of each bacterial type?
SS: 35% FT: 65%
homologous chromosomes
Same chromosomes in a set or pair - One from mom, one from Dad
Sort the following statements according to whether they are scientifically testable statements or nontestable observations. Statements: A. Long hair is more beautiful than short hair. B. Red birthday candles burn longer than green birthday candles. C. The Mona Lisa is the most significant work of art ever created. Animal testing is wrong. D. The Democratic Party is more environmentally minded than the Republican Party. E. Ghosts roam forests near Seattle, Washington at night. F. It is hot in the classroom. G. Using fertilizer containing only phosphorus causes the tallest tomato plant growth.
Testable Observations: B. Red birthday candles burn longer than green birthday candles. G. Using fertilizer containing only phosphorus causes the tallest tomato plant growth. Nontestable Observations: A. Long hair is more beautiful than short hair. C. The Mona Lisa is the most significant work of art ever created. Animal testing is wrong. D. The Democratic Party is more environmentally minded than the Republican Party. E. Ghosts roam forests near Seattle, Washington at night. F. It is hot in the classroom.
stop codon
The codon UAA, UAG, or UGA; the point on an mRNA strand at which the ribosomes end translation
Example of modern day embryology evidence for evolution?
The embryos of possums, chickens, cats, snakes, bats, and humans are all similar in their developing stages.
Example of modern day evidence for evolution with homologous structures?
The limbs and bones of humans, frogs, bats, porpoises, and horses are all similar in structure
semiconservative replication
The mode of replication by which DNA is duplicated, where one "old" strand (the template strand) is retained (conserved) in each new double helix.
complementary base-pairing
The relationship between two nucleic acid strands in which each purine on one strand hydrogen-bonds with a specific pyrimidine on the opposite strand. A pairs with T or U, and C pairs with G.
genetic drift
a change in allele frequencies produced by random differences in survival and reproduction among the individuals in a population - a change in allele frequencies in a population due to random differences in survival rates. - Always happening, but not always apparent.
evolution
a change in the overall inherited characteristics of a group of organisms over multiple generations
pedigree
a chart similar to a family tree that shows genetic relationships among family members over two or more generations of a family's medical history
gentic disorder
a disease caused by an inherited mutation, passed down from a parent to a child
founder effect
a form of genetic drift that occurs when a small group of individuals establishes a new population isolated from its original, larger population Example: Dutch colonists in South Africa - In South Africa a population of people called Afrikaners descended primarily from a few Dutch colonists. - The Afrikaner population has an unusually high frequency of the allele that causes Huntington disease.
transitional fossils
a fossil that displays physical characteristics in between those of two known fossils in a family tree
deletion
a mutation in which a base is deleted from the DNA sequence of a gene
insertion
a mutation in which a base is inserted in the DNA sequence of a gene
substitution
a mutation in which one base is substituted for another in the DNA sequence of a gene
point mutation
a mutation in which only a single base is altered
mutation
a random change to the sequence of bases in an organism's DNA
mutation
a random change to the sequence of bases in an organism's DNA • All evolutionary change depends ultimately on mutation. • Mutation: A change in the sequence of any segment of DNA in an organism. - The raw material for selection - Not produced on demand, variation is there or its not - Generates new alleles in species • New alleles are created at random, providing the raw material for evolution. - Stimulates the rapid evolution of populations by providing new genetic variation. - Provides differences in genotypes between individuals in populations - Natural selection and other mechanisms of evolution act on resulting phenotypes.
exon
a stretch of DNA that carries instructions for building a protein
Transfer RNA (tRNA)
a type of RNA that facilitates translation by delivering specific amino acids to the ribosomes as codons are read off of an mRNA - brings the appropriate amino acids to the ribosome
Ribosomal RNA (rRNA)
a type of RNA that is an important component of ribosomes - comprises part of the ribosome
Messenger RNA (mRNA)
a type of RNA that is complementary to a DNA template strand - contains the transcribed information from the DNA molecule
genetic carrier
an individual who has only one copy of a recessive allele for a particular disease and therefore can pass on the disorder allele but does not have the disease
common ancestor
an organism from which many species have evolved
Use these following terms correctly in the following sentence: alleles, chromosomes, genes, loci Two homologous _________ contain the same _________, found at the same _________, but may have the same or different copies of _________.
chromosomes, genes, loci, alleles
Fill in the blanks with the correct terms: Ribosomes read the mRNA information in sets of three bases at a time called ___________. There are 64 possible codons, including a ______________ and three possible ___________________.
codons, start codons, stop codons
convergent evolution
evolution that results in organisms that have different genetics but appear very much alike - results in orginisms that appear very much alike despite vastly dissimilar genetics - not common descent from common ancestor
Fill in the blanks with the correct words: Darwin and Wallace's hypothesis is _____________ via _________________.
evolution; natural selection
Link each term with the correct definition: Terms: gene expression gene regulation transcription translation Definitions: 1. The production of RNA, using the information in the DNA sequence of a gene. 2. The flow of information from gene to protein. 3. The control of gene expression in response to internal or environmental cues. 4. The production of a protein, by linking amino acids in the precise sequence dictated by an mRNA base sequence.
gene expression: 2 gene regulation: 3 transcription: 1 translation: 4
RNA splicing
processing of mRNA in which the introns are snipped out of a pre-mRNA and the remaining pieces of mRNA -- the exons -- are joined to generate the mature mRNA
DNA replication
the duplication of a DNA molecule
DNA polymerase
the enzyme that builds new strands of DNA in DNA replication
gene flow
the exchange of alleles between populations Examples: • Horizontal gene transfer through conjugation in bacteria is one form of gene flow. • Sexually reproducing individuals that migrate among populations cause gene flow.
biogeography
the geographic locations where organisms or fossils of a particular species are found
genetic code
the information specified by each of the 64 possible codons
disruptive selection
the least common pattern of natural selection, in which individuals with either extreme of an inherited trait have an advantage over individuals with an intermediate phenotype
fossil
the mineralized remains or impression of a formerly living organism
directional selection
the most common pattern of natural selection, in which individuals at one extreme of an inherited phenotypic trait have an advantage over other individuals in the population
Fill in the blanks with the correct terms: During __________, which occurs in the nucleus, ________________ binds the ______________ of a gene and produces an RNA version of the gene sequence from free nucleotides.
transcription, RNA polymerase, promoter
Place the correct steps of translation in the correct order by numbering them from 1 to 9: A. A tRNA molecule carrying the amino acid methionine binds at its anticodon site to the mRNA start codon. B. The ribosome links the first amino acid to the second amino acid to begin the amino acid chain. C. The ribosome continues to link each amino acid to the growing amino acid chain. D. The ribosome reaches a stop codon. E. An mRNA binds to a ribosome. F. The mRNA as well as the completed amino acid chain separates from the ribosome. G. The first tRNA, separated from its amino acid, releases from the mRNA. H. A tRNA molecules carrying the second amino acid binds to the second mRNA codon. I. Each tRNA releases from the mRNA after it is separated from its amino acid.
A. 2 B. 4 C. 6 D. 8 E. 1 F. 9 G. 5 H. 3 I. 7
Place the following steps of DNA replication in the correct order by numbering them from 1 to 5: A. A template strand begins to be replicated. B. If the incorrect base is not identified and replaced, it remains as a point mutation in the DNA. C. DNA polymerase identifies and replaces most incorrect bases with the correct base, complementary to the base on the template strand. D. An incorrect base is added to the growing strand of DNA. E. Proteins identify and replace any incorrect bases missed by DNA polymerase.
A. A template strand begins to be replicated.D. An incorrect base is added to the growing strand of DNA. B. 5 C. 3 E. 4
Which of the following are ways that DNA can undergo mutation? Choose one or more: A. A virus inserts its DNA into the DNA of another organism. B. During DNA replication, the wrong base is added to the strand as it is being built. C.A repair DNA polymerase fixes a damaged DNA strand. D. High-energy waves like UV light or radiation physically damage the DNA.
A. A virus inserts its DNA into the DNA of another organism. B. During DNA replication, the wrong base is added to the strand as it is being built. D. High-energy waves like UV light or radiation physically damage the DNA.
The following nucleic acid is an entire primary transcript (pre-mRNA is not processed): ACGCAUGCGaugaugccccucagGUCUguuuccgugaUGCCGUUGACCUGA. The nucleotides in capitals are exons; the nucleotides in lowercase type are introns. Appropriately splice this primary transcript to produce a mature mRNA. Multiple Choice: A. ACGCAUGCGGUCUUGCCGUUGACCUGA B. augccuuucagguuuccguga C. augccuuucagGUCUguuuccguga D. ACGCAUGCGaugGUCUUGCCGUUGACCUGA E. ACGCAUGCGaugccuagGUCUguuuccgugaUGCCGUUGACCUGA
A. ACGCAUGCGGUCUUGCCGUUGACCUGA Explanation: get the answer by removing the introns (the lowercase letters), as occurs during RNA splicing
CRISPR is a very powerful, versatile tool that can be used to edit almost any DNA sequence in almost any organism. Theoretically, it could be used to disrupt any of the genes described in the following questions. What would be the most direct effect on the cell if CRISPR were used to inactivate the genes that encode histone proteins? Choose one: A. DNA packaging would be disrupted. B. DNA replication would be disrupted. C. The cell's ability to defend itself against viruses would be diminished. D. The hydrogen bonds between base pairs would not be broken prior to replication. E. More mutations would occur in the genome.
A. DNA packaging would be disrupted.
CRISPR is a very powerful, versatile tool that can be used to edit almost any DNA sequence in almost any organism. Theoretically, it could be used to disrupt any of the genes described in the following questions. What would be the most direct effect on the cell if CRISPR were used to inactivate the genes that encode DNA polymerase? Choose one: A. DNA replication would be disrupted. B. The hydrogen bonds between base pairs would not be broken prior to replication. C. The cell's ability to defend itself against viruses would be diminished. D. More mutations would occur in the genome. E. DNA packaging would be disrupted.
A. DNA replication would be disrupted.
Which of the following explain the presence of gill slits in the embryos of fish, reptiles, birds, and humans? Choose one or more: A. Fish, reptiles, birds, and humans share a common ancestor. B. They evolved separately and independently from each other in response to Earth being mostly covered by water. C. They all share similar DNA that codes for the similar early development of this feature. D. Early development occurs in an aqueous environment, so embryos need gills for oxygen transport.
A. Fish, reptiles, birds, and humans share a common ancestor. C. They all share similar DNA that codes for the similar early development of this feature.
Which group of vertebrate species should be easiest to distinguish from each other at an early stage of embryonic development? Choose one: A. Fish, tortoise, and human B. Mouse, human, and pig C. Human, chimpanzee, and gorilla
A. Fish, tortoise, and human
Manufacturing vaccine proteins in plants, or "biopharming," has several advantages over using chicken eggs for vaccine production. One advantage is that allergic risks are minimized when vaccines are produced using plants such as tobacco. What is the most likely reason why people with egg allergies may have an allergic reaction when an influenza vaccine is produced using chicken eggs? Choose one: A. In addition to producing an influenza protein from an inserted gene, the egg cells will produce proteins that cause an allergic reaction in some people. B. When influenza proteins are produced from egg cells, the proteins are not identical to the proteins produced by the influenza virus, and the new proteins cause allergic reactions. C. Chicken eggs are more likely to become contaminated with unwanted DNA, and the expression of these genes produces proteins that cause allergies. D. Vaccine production takes much longer in eggs than it does in plants; proteins that are produced more slowly often take on a shape that causes allergic reactions.
A. In addition to producing an influenza protein from an inserted gene, the egg cells will produce proteins that cause an allergic reaction in some people.
Sickle-cell disease is caused by a point mutation in the gene that codes for hemoglobin. In individuals with two copies of the sickle cell allele, their abnormal hemoglobin causes their red blood cells to have a sickle shape. These sickle-shaped red blood cells stick to each other and get caught up in small blood vessels, causing blockages, cell death, and pain. Individuals that have one copy of the sickle cell allele are less likely to die from malaria, an often fatal disease caused by a protist that infects red blood cells. Is the sickle cell allele the result of a beneficial or harmful mutation? Choose one: A. It depends. If you live in an area of the world where malaria is very common, it could be considered beneficial but it still causes a very serious disease. B. It is beneficial. People with one copy of the allele are resistant to a fatal disease. C. It is harmful. People with sickle-cell disease die earlier and have severe health problems. D. All mutations are harmful, so the sickle cell mutation is harmful.
A. It depends. If you live in an area of the world where malaria is very common, it could be considered beneficial but it still causes a very serious disease.
Why is Tiktaalik considered a transitional fossil? Choose one: A. It has traits that are found in both fish and tetrapods. B. It lived millions of years ago. C. It was found on a beach, between the water and the land. D. During its lifetime, it transitioned from a fish to a tetrapod.
A. It has traits that are found in both fish and tetrapods.
CRISPR is a very powerful, versatile tool that can be used to edit almost any DNA sequence in almost any organism. Theoretically, it could be used to disrupt any of the genes described in the following questions. What would be the most direct effect on the cell if CRISPR were used to inactivate the genes that encode DNA repair proteins? Choose one: A. More mutations would occur in the genome. B. DNA packaging would be disrupted. C. DNA replication would be disrupted. D. The hydrogen bonds between base pairs would not be broken prior to replication. E. The cell's ability to defend itself against viruses would be diminished.
A. More mutations would occur in the genome.
In order to contribute to evolution, why must mutations in sexually reproducing organisms occur in the sex cells and not somatic cells? Choose one or more: A. Mutations in somatic cells only affect the individual with the mutation. B. Only the DNA in sex cells gets passed to offspring in sexual reproduction. C. Mutations must occur in both the sex cells and somatic cells to be inherited. D. To contribute to evolution, the trait produced by the mutation(s) must be passed to offspring.
A. Mutations in somatic cells only affect the individual with the mutation. B. Only the DNA in sex cells gets passed to offspring in sexual reproduction. D. To contribute to evolution, the trait produced by the mutation(s) must be passed to offspring.
Which statements describe appropriate strategies for preventing antibiotic resistance? Choose one or more: A. Practice good hand hygiene, and get recommended vaccines. B. It is acceptable to occasionally skip doses when you take antibiotics. C. As soon as you feel better, you can stop taking your prescribed antibiotics and save the remainder for your next illness. D. Do not ask for antibiotics when your doctor thinks you do not need them. E. Antibiotics can treat a wide variety of infections, so it does not matter which one you take.
A. Practice good hand hygiene, and get recommended vaccines. D. Do not ask for antibiotics when your doctor thinks you do not need them.
How does embryology support the theory of evolution? Choose one or more: A. The early stages of embryonic development may mirror early developmental stages of ancestral forms. B. Early embryonic stages are very dissimilar in species with a common ancestor, making it easier to classify organisms and determine their evolutionary lineage. C. Embryonic development patterns provide evidence of a common ancestry. D. The order in which new structures appear and disappear during embryonic development can correspond to the way these structures evolve in the fossil record. E. Embryonic development is driven by DNA, the universal inherited genetic material.
A. The early stages of embryonic development may mirror early developmental stages of ancestral forms. C. Embryonic development patterns provide evidence of a common ancestry. D. The order in which new structures appear and disappear during embryonic development can correspond to the way these structures evolve in the fossil record. E. Embryonic development is driven by DNA, the universal inherited genetic material.
The environment changes and a mutation that was once beneficial to survival and reproduction in a population is now very harmful. Predict what you think will happen to the number of individuals with the mutation in the population over time. Choose one: A. The number of individuals with the mutation will decrease over time. B. The number of individuals with the mutation will stay the same over time. C. The number of individuals with the mutation will increase over time. D. The number of individuals with the mutation will first increase and then level off over time.
A. The number of individuals with the mutation will decrease over time.
Unfortunately, the volleyball player had to be hospitalized to have her infection treated to avoid any permanent damage to her elbow and to prevent the infection from entering her bloodstream. Once in the bloodstream, the infection could cause sepsis, which is life-threatening inflammation as a reaction to the systemic infection. However, after several days of intravenous antibiotics (a combination of methicillin and vancomycin), she is finally cured and on the road to recovery. Which statement best describes what happened to this population? Choose one: A. The population evolved as a result of natural selection by the environment the volleyball player accidentally created. Only the somewhat susceptible and full treatment bacteria survived and reproduced in the new conditions, causing her infection to recur. B. The population evolved as a result of artificial selection by the volleyball player. Although she did it unknowingly, by not taking the full course of antibiotics, she directly selected which bacteria would survive and reproduce in the next generation. C. Part of the population was already immune to the antibiotic methicillin, so they were the individuals that survived and reproduced. D. Antibiotic resistance is inevitable; the population changed because of new mutations that provided resistance to the antibiotic methicillin.
A. The population evolved as a result of natural selection by the environment the volleyball player accidentally created. Only the somewhat susceptible and full treatment bacteria survived and reproduced in the new conditions, causing her infection to recur.
Which statement best describes why there would be more red (MRSA) bacteria in the population after passing through the sieve (antibiotic treatment)? Recognize that the sieve is an analogy for the presence of an antibiotic killing some cells (those collected in the sieve) and not killing others (those that pass through the sieve). Choose one: A. The yellow bacteria represent bacteria that are NOT resistant to antibiotic treatment, leaving the purple bacteria (resistant) to survive and reproduce. B. The red bacteria divide more quickly so that they become the predominant population. C. The yellow bacteria are repelled by the antibiotic treatment. D. The yellow bacteria are resistant to antibiotic treatment, leaving them to survive and reproduce.
A. The yellow bacteria represent bacteria that are NOT resistant to antibiotic treatment, leaving the purple bacteria (resistant) to survive and reproduce.
Which of the following are examples of artificial selection? Choose one or more: A. Your grandma keeps seeds to plant the following year from a flower with an especially vivid flower color that she likes. B. A dog breeder who owns Labrador retrievers crosses two parent dogs to get the maximum number of yellow puppies in a litter. C. Scientists breed soybeans that are resistant to glyphosate, a chemical found in certain herbicides. D. White mice in a plowed field are eaten more than brown mice by the local red-tailed hawk.
A. Your grandma keeps seeds to plant the following year from a flower with an especially vivid flower color that she likes. B. A dog breeder who owns Labrador retrievers crosses two parent dogs to get the maximum number of yellow puppies in a litter. C. Scientists breed soybeans that are resistant to glyphosate, a chemical found in certain herbicides.
Which of the following are possible reasons that a cell would regulate its expression of a gene? Select all that apply: A. an increased need for a particular enzyme. B. a decreases need for a particular enzyme C. increasing temperature in the external environment D. changing needs as an organism ages E. death
A. an increased need for a particular enzyme. B. a decreases need for a particular enzyme C. increasing temperature in the external environment D. changing needs as an organism ages
A genetic disorder is a disorder Choose one: A. caused by a genetic mutation that can be inherited by offspring from their parents. B. caused by an outside agent that changes the genes of the affected individual. C. that causes a mutation in a gene. D. that is present at birth.
A. caused by a genetic mutation that can be inherited by offspring from their parents.
When a group of organisms shares a common ancestor, they share similar features. Recall what you have learned concerning eukaryotic cells. Which cellular traits are shared by a human, a purple coneflower, and a yeast cell. Select all that apply. Choose one or more: A. plasma membrane B. nucleus C. deoxyribonucleic acid (DNA) D. chloroplast
A. plasma membrane B. nucleus C. deoxyribonucleic acid (DNA)
The DNA of different species differs in the... Multiple Choice: A. sequence of bases B. complementary base-pairing C. number of nucleotide strands D. location of the sugar phosphate portion of the DNA molecule
A. sequence of bases
Unlike natural selection, _________ is not related to an individual's ability to survive and may result in offspring that are less well adapted to survive in a particular environment. Multiple Choice: A. sexual selection B. convergent evolution C. directional selection D. genetic drift
A. sexual selection
For each of the following terms, identify the type of RNA involved (mRNA, rRNA, or tRNA). A. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. B. Is a major component of ribosomes. C. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons. D. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. E. Assists in making the bonds that link amino acids together to make a protein.
A. tRNA B. rRNA C. mRNA D. tRNA E. rRNA
Lactose persistence, which is the ability to digest lactose in dairy products as adults, is which of the following? Choose one: A. the result of a mutation B. a trait that all human adults have C. harmful to survival and reproduction of humans D. an ancestral trait in humans
A. the result of a mutation
In order for mutations to be passed to offspring in sexually reproducing organisms, the mutation(s) must occur in sex cells. Why is this NOT true for bacteria like Staphylococcus? Choose one or more: A. Bacteria can pass on mutations in somatic cells. B. Bacteria do not have sex cells. C. Bacteria reproduce asexually, so the offspring are genetic copies of the parent and inherit all mutations that occur. D. Bacteria reproduce sexually but exchange genetic information through conjugation.
B. Bacteria do not have sex cells. C. Bacteria reproduce asexually, so the offspring are genetic copies of the parent and inherit all mutations that occur.
How does tRNA "know" where to deliver the amino acid in the growing amino acid chain? Choose one: A. By matching the amino acid to the codon on the mRNA B. By matching its anticodon to the correct codon on the mRNA C. By matching its codon to the anticodon on the mRNA D. By matching its anticodon to the surface of the rRNA
B. By matching its anticodon to the correct codon on the mRNA
Which of the following statements applies to biological evolution? Select all that apply. Choose one or more: A. Individuals evolve, populations do not. B. Evolution describes a change in the overall inherited characteristics of a population. C. Evolution can occur in one generation. D. Evolution occurs over multiple generations. E. Evolution ONLY occurs over millennia.
B. Evolution describes a change in the overall inherited characteristics of a population. D. Evolution occurs over multiple generations.
During transcription, what RNA molecule will be made from the DNA template CGTTACG? Multiple Choice: A. CGTTAGC B. GCAAUGC C. GCATTGC D. CGUUAGC
B. GCAAUGC
2017 saw two major hurricanes move through the Caribbean, Hurricane Irma and Hurricane Maria, both of which were Category 5 hurricanes. The force of the winds from the hurricanes stripped fruit trees bare of their leaves and fruits. After a major stress event like this, it can take two or more years before the trees produce fruit again. Which population would most likely experience genetic drift as a result of a genetic bottleneck after a hurricane? Choose one: A. flying foxes, large bats commonly called "fruit bats" that eat fruit and are seen on multiple islands in the Caribbean and the Pacific B. Puerto Rican parrot, a critically endangered bird that primarily eats fruits but also eats flowers, seeds, and nectar C. Adelaide's warbler, a small songbird that favors caterpillars as the main staple of its diet D. vervet monkeys, an introduced species from South Africa that tend to favor fermented fruits and have become highly urbanized
B. Puerto Rican parrot, a critically endangered bird that primarily eats fruits but also eats flowers, seeds, and nectar
A population of mice lives year-round in an Illinois cornfield. Different mice have different fur colors, ranging from white to brown to black. Red-tailed hawks hunt for mice in and around this field, and they visit the field more often in the fall and winter after the corn crop has been harvested. Select which phenotype is best adapted for each season described in the cornfield. Some seasons may have more than one answer. Seasons: A. Fall. The corn has been removed, and the ground is bare with no snow. B. Winter season. The ground is completely covered in snow. C. Early winter. The first light snow covers the ground in patches. D. Spring season. The ground has recently been plowed, and there is no vegetation. E. Summer. It is the growing season, and corn is present. Phenotypes: Solid White Solid Brown White and Brown Brown, Green, Black
B. Solid White A & D. Solid Brown C. White and Brown E. Brown, Green, Black
Before gene therapy, Arabella Smygov suffered from spinal muscular atrophy due to a mutation in an allele of a gene that produces a protein critical for muscle function. A similar disorder can occur when a genetic mutation occurs on chromosome 2 leading to intellectual disability and delayed development, among other traits. Sometimes this can occur even when neither of the parents carry any mutations on chromosome 2, and the affected child has the mutation on only one copy of chromosome 2. Which of the following would describe such a disease? Choose one: A. sex-linked B. dominant C. recessive D. heterozygous
B. dominant
Which of the following are examples of events that could cause genetic drift in a population? Choose one or more: A. a 1,000-year shift in climate that favors drought-resistant plant species in North America B. eruption of a volcano C. a group of wolves leaving their pack to create a new pack D. the appearance of a new allele in a population that helps individuals with that trait survive and reproduce better than other individuals E. annual spring flooding on the Mississippi River
B. eruption of a volcano C. a group of wolves leaving their pack to create a new pack E. annual spring flooding on the Mississippi River
Match the mutation type to its description. Descriptions: A. An extra base is added in the sequence. B. One base is replaced by another. C. A base is removed. Mutation Types: substitution insertion deletion
B. substitution A. insertion C. deletion
Which of the following are examples of biological evolution? Choose one or more: A. a rose bush mutating and producing an allele that makes it resistant to aphid bug infestation B. the extinction of certain song bird species due to the loss of forest habitat C. the deaths of thousands of bats from white-nose fungus, leaving only those immune to the fungus able to survive and reproduce D. the flu virus mutating year to year, producing new strains that require different vaccines than those administered the year before E. the loss of pesticide susceptibility in a population of mosquitos after being sprayed with the same pesticide for 3 years in a row
B. the extinction of certain song bird species due to the loss of forest habitat C. the deaths of thousands of bats from white-nose fungus, leaving only those immune to the fungus able to survive and reproduce D. the flu virus mutating year to year, producing new strains that require different vaccines than those administered the year before E. the loss of pesticide susceptibility in a population of mosquitos after being sprayed with the same pesticide for 3 years in a row
Down syndrome and cri du chat syndrome are both examples of chromosomal abnormalities in humans. Down syndrome results from having _____ while cri du chat syndrome results from ______. Choose one: A. four copies of chromosome 21; an inversion of part of chromosome 5 B. three copies of chromosome 21; a deletion of part of chromosome 5 C. one copy of chromosome 21; duplication of part of chromosome 5 D. two copies of chromosome 21; translocation of chromosome 5
B. three copies of chromosome 21; a deletion of part of chromosome 5
What information can you gain from the karyotype that can help explain why an individual having trisomy 13 (Patau's syndrome) has more health issues and a very limited life span compared to someone with trisomy 21 (Down syndrome)? Choose one: A. The genes located on chromosome 13 are all recessive and are more likely to cause disease. B. Chromosome 13 has genes that are more important to the functioning of the body than those on chromosome 21. C. Chromosome 13 is larger than chromosome 21 and has more genes that will be affected. D. The copy found on chromosome 13 must be related to aging. Having more copies of these genes will cause an individual to have a shorter life span.
C. Chromosome 13 is larger than chromosome 21 and has more genes that will be affected. Explanation: If the chromosome is larger more genes will be affected.
At Medicago, scientists remove a specific genetic sequence that codes for a hemagglutinin protein from an influenza virus and insert this gene into an Agrobacterium genome. After the hemagglutinin gene is inserted into Agrobacterium, tobacco plants are infected with the Agrobacterium and the hemagglutinin gene is transferred into the tobacco plants. Which of the following allows the tobacco plants to express the hemagglutinin gene and produce the hemagglutinin protein? Choose one or more: A. the presence of a complete influenza virus genome in the tobacco plants B. All living organisms produce at least low levels of the hemagglutinin protein. C. a universal genetic code D. promoters that allow the tobacco plants' RNA polymerase to recognize the gene
C. a universal genetic code D. promoters that allow the tobacco plants' RNA polymerase to recognize the gene
Species that undergo sexual selection often have males and females that differ dramatically in phenotype, a phenomenon called sexual dimorphism. Since sexual dimorphism is a result of selection for the two extremes of a phenotypic trait, what pattern of selection is this? Choose one: A. directional B. stabilizing C. disruptive
C. disruptive
DNA replication results in.... Multiple Choice: A. two DNA molecules - one with two old strands and one with two new strands. B. two DNA molecules, each of which has two new strands. C. two DNA molecules, each of which has one old strand and one new strand. D. none of the above
C. two DNA molecules, each of which has one old strand and one new strand.
A university volleyball player suffers a serious scrape on her elbow after diving to return a serve. Within a week, the scrape becomes red, inflamed, and hot to the touch. After going to the doctor for treatment, she is diagnosed with a Staphylococcus aureus infection. She is prescribed the antibiotic methicillin to treat the infection. Her bacterial population has the following genetic makeup:1,000 individuals total:900 are fully susceptible (FS) to methicillin, meaning they die early in the course of treatment.90 are somewhat susceptible (SS) to methicillin, meaning they have some resistance to methilicillin.10 are killed only by a full treatment with methicillin (FT), meaning they have the greatest degree of resistance. What is the percentage of each type of S. aureus? Choose one: A. 90% FS, 10% SS, 1% FT B. 900% FS, 90% SS, 10% FT C. 0.99% FS, 0.09% SS, 0.01% FT D. 90% FS, 9% SS, 1% FT
D. 90% FS, 9% SS, 1% FT
Which part of the tRNA binds to the mRNA strand? Choose one: A. Ribosome B. Codon C. Amino acid D. Anticodon
D. Anticodon
Which of the following best describes gene regulation? Choose one: A. Gene regulation is a way for organisms to change which stretches of DNA undergo replication and at what rate. B. Gene regulation is the ability for cells to turn off all genes resulting in cell death. C. Gene regulation is a way to control which genes are mutated and how to fix these mutations. D. Gene regulation is the ability to control which genes are expressed and how much in response to internal or external signals.
D. Gene regulation is the ability to control which genes are expressed and how much in response to internal or external signals.
Do antibiotics create resistant strains of bacteria? Choose one: A. Yes, overuse of antibiotics causes the DNA of bacteria to mutate and the bacteria becomes resistant. B. No, antibiotics can work only on the strain they were tested for. C. Yes, overexposure to antibiotics causes the proteins on the surface of the bacteria to change. D. No, to become resistant to antibiotics, individual(s) in a population must randomly mutate, and that mutation, if heritable, causes the bacterial population to become resistant to antibiotics.
D. No, to become resistant to antibiotics, individual(s) in a population must randomly mutate, and that mutation, if heritable, causes the bacterial population to become resistant to antibiotics.
The disease discussed in the animation is caused by a recessive allele. Recessive alleles frequently do not produce a protein product. Dominant alleles, on the other hand, may produce a harmful protein. How might treating a dominant disorder with gene therapy differ from treating a recessive disorder with gene therapy, as discussed in the video? Choose one: A. A healthy allele needs to be inserted into the patient's cells with a virus. B. The healthy allele inherited by the patient from his parents needs to be activated. C. The recessive disease allele needs to be inactivated so that it does not produce the harmful protein. D. The dominant disease allele needs to be inactivated so that it does not produce the harmful protein.
D. The dominant disease allele needs to be inactivated so that it does not produce the harmful protein.
What is meant by the term "gene expression"? Choose one: A. The process of using genetic information to cure genetic disorders B. The process of mutating genetic information C. The process of taking genetic information from one organism and putting it into another to make a product D. The process of using genetic information to build proteins in cells
D. The process of using genetic information to build proteins in cells
Mutation... Multiple Choice: A. can produce new alleles B. can be harmful, beneficial, or neutral C. is a change in an organism's DNA sequence D. all of the above
D. all of the above
Before she received gene therapy treatment, Jennelle suffered bone and joint pain from sickle cell disease. Like sickle cell, thalassemia is a blood disease caused by a mutation in one gene. In the case of thalassemia, the mutated gene is the one that codes for alpha globin, resulting in a lack of (or reduction in) alpha globin production. When two parents are heterozygous for thalassemia, they are unaffected. Among their children, there is a 25 percent chance that a child will be homozygous for thalassemia and will express thalassemia as a major trait, a 25 percent chance that a child will not carry the gene for thalassemia, and a 50 percent chance that the child will be heterozygous, and an unaffected carrier like the parents. Which of the following describes thalassemia? Choose one: A. homozygous B. sex-linked C. dominant D. recessive E. heterozygous
D. recessive
All mammals have tailbones and muscles for moving a tail. Even humans have a reduced tailbone and remnant tail-twitching muscles, though these features have no apparent usefulness. These traits in humans would be best described as... Multiple Choice: A. convergent structures B. fossil evidence C. evidence from biogeography D. vestigial traits
D. vestigial traits
primers
a short stretch of RNA or DNA that is complementary based paired to a DNA template to provide a 3'-hydroxyl group for polymerase to initiate DNA replication or the polymerase chain reaction (PCR), respectively
intron
a stretch of DNA that does not code for anything
Ploymerase Chain Reaction (PCR)
a technique for replicating DNA that can produce millions of copies of a DNA sequence in just a few hours from a small initial amount of DNA
Match each of the following terms with the correct definition: Terms: gene therapy in vitro fertilization preimplantation genetic diagnosis (PGD) chorionic villus sampling (CVS) amniocentesis Definitions: 1. A procedure in which cells are gently suctioned from a pregnant woman's uterus to test for genetic disorders in the fetus. 2. A procedure in which a small amount of fluid, including the fetal cells within it, is carefully extracted from a pregnant woman's uterus to test for genetic disorders in the fetus. 3. A treatment approach that seeks to correct a genetic disorder by inserting healthy copies of the mutated genes responsible for the disorder. 4. A procedure in which one or two cells are removed from a developing embryo and tested for genetic disorders; embryos that are free of genetic disorders may then be implanted into a woman's uterus. 5. A procedure in which an egg is fertilized in a petri dish, after which one or more embryos are implanted into a woman's uterus.
gene therapy: 3 in vitro fertilization: 5 preimplantation genetic diagnosis (PGD): 4 chorionic villus sampling (CVS): 1 amniocentesis: 2
Choose the correct term: The founder effect is a type of (genetic drift / gene flow) in which a small group of individuals from a larger population (establish a new, distant population / are the only survivors) and then reproduce.
genetic drift; establish a new, distant population
stabilizing selection
the pattern of natural selection in which individuals with an intermediate values of an inherited phenotypic trait have an advantage over other individuals in the population
genetic engineering
the permanent introduction of one or more genes into a cell, tissue, or organism
locus
the physical location of a gene on a chromosome
Conjugation
the physical process of horizontal gene transfer between bacteria. - In the case of VRSA, Staphylococcus Aureus acquired the vancomycin-resistance gene through gene flow from Enterococcus.
artificial selection
the process by which individuals display specific traits through selective breeding
translation
the process by which ribosomes convert the information in mRNA into proteins - Amino acids are linked to one another at the ribosome to create the protein encoded by the mRNA. - From RNA to protein - Occurs at the ribosome - One mRNA can be translated many times
common descent
the sharing of a common ancestor by two or more different species
double helix
the spiral formed by two complementary strands of nucleotides that is the backbone of DNA
transcription
the synthesis of RNA based on a DNA template - any mRNA copy of the gene is made in the nucleus
horizontal gene transfer
the transfer of genes on plasmids from one bacterium to another • Accelerates the rate of evolution • Conjugation: the physical process of horizontal gene transfer between bacteria. - In the case of VRSA, Staphylococcus Aureus acquired the vancomycin-resistance gene through gene flow from Enterococcus.
origin of replication
A DNA sequence where DNA replication is initiated
analogous trait
A feature that is shared across species because of convergent evolution, not because of modification by descent from a recent common ancestor.
homologous trait
A feature that is similar across species because of common descent. Homologous traits may begin to look different from one another over time.
genetic bottleneck
A form of genetic drift that occurs when a drop in the size of a population causes a loss of genetic variation. - a drop in the size of a population, for at least one generation, that causes a loss of genetic variation Example: Florida Panther
Dominant genetic disorder
A genetic disorder that is inherited as a dominant trait on an autosome.
recessive genetic disorder
A genetic disorder that is inherited as a recessive trait on an autosome.
gene therapy
A genetic engineering technique for correcting defective genes responsible for disease development.
The DNA of cells is damaged... Multiple Choice: A. consistently B. by collisions with other molecules, chemical accidents, and radiation. C. not very often and only by radiation D. both a and b
D. both a and b
x-linked
found solely on the X chromosome
sex-linked
found solely on the X or Y chromosome
y-linked
found solely on the Y chromosome
Fill in the blanks with the correct terms: The __________________ is redundant because there are 64 codons and only 20 amino acids and universal because nearly all organisms on Earth use the same code.
genetic code
Cooking Analogy You assemble the ingredients, follow the recipe, and make cookies? How would this be similar to Translation?
mRNA goes to the ribosome, tRNA brings the amino acids, and a protein is assembled
Fill in the correct words to the sentence: The nucleotide bases on the codon are on a ___________ molecule, while the bases on the anticodon are on a __________ molecule.
mRNA, tRNA
sexual selection
natural selection in which a trait increases an individuals chance of mating even if it decreases an individuals chance of survival
allele frequency
percentages of a specific allele in a population
Fill in the blanks with the correct terms: During ____________, which occurs in the cytoplasm, ribosomes convert the sequences of bases in a ________________ molecule to the sequence of amino acids in a protein, with the help of ______________ composed of ____________________ and proteins, and associated with ____________________.
translation, messenger RNA, ribosomes, ribosomal RNA, transfer RNA
The Central Dogma
• From DNA to RNA • From RNA to protein
If two different organisms are closely related evolutionarily, then they will... Multiple Choice: (a) share a recent common ancestor. (b) be similar in size. (c) have very different DNA sequences in their genes. (d) be randomly located throughout the world.
(a) share a recent common ancestor.
In a population, which individuals are more likely to survive and reproduce? Multiple Choice: (a) The individuals that are most different from the others in the population (b) The individuals that are best adapted to the environment (c) The largest individuals in a population (d) The individuals that can catch the most prey
(b) The individuals that are best adapted to the environment
Transitional fossils... Multiple Choice: (a) share some similarities with their ancestral group. (b) share some similarities with their descendant groups. (c) both of the above (d) none of the above
(c) both of the above
If two different organisms are very distantly related evolutionarily, then... Multiple Choice: (a) they should have extremely similar embryonic development. (b) they must share a very recent common ancestor (c) the sequences of DNA in their genes should be less similar than those of two more closely related organisms (d) they should share more homologous traits than two more closely related organisms share
(c) the sequences of DNA in their genes should be less similar than those of two more closely related organisms
Background of Charles Darwin
- Early 1800 - dad was rich - he loved to be outside - this is where he discovered the origin of species
Example of modern day evidence for evolution with vestigial structures?
- Snakes have reduced hind legs in their bodies - Rarely, some humans are born with tails
The DNA molecule of hereditary was discovered in the __________, while the structure of DNA was discovered in the ____________.
1940's; 1950's
The percentage of specific alleles within a population is referred to as Choose one: A. allele frequency. B. population frequency. C. gene frequency. D. species frequency.
A. allele frequency.
If the target sequence for PCR on one strand of DNA is ATGCAAATCCTGG, what is the sequence of each of the two strands of the double-stranded DNA produced?
ATGCAAATCCTGG and TACGTTTAGGACC
adaptive trait
Also called an adaptation. A feature that gives an individual improved function in a competitive environment.
adaptation
An evolutionary process by which a population becomes better matched with its environment over time.
If a DNA template has the nucleotide sequence AATCGGAT, the complementary mRNA transcript will have which sequence? Choose one: A. AAUCGGAU B. UUAGCCUA C. TTAGCCTA D. AATCGGAT
B. UUAGCCUA
Alleles are... Choose one: A. the same genes in different species. B. different versions of the same gene produced by mutation. C. different versions of different genes. D. different genes on the same chromosome.
B. different versions of the same gene produced by mutation.
The twelve-spotted skimmer, eastern pondhawk, and widow skimmer are species of dragonflies identified as living around a pond on the Wichita Mountains National Wildlife Refuge in Oklahoma. The twelve-spotted skimmer likes warm, still water and tends to live at or near the edge of ponds and lakes. The eastern pondhawk is an aggressive defender of its territory, preferring warm, still water at the edge of ponds and lakes. The widow skimmer also likes warm, still water and tends to rest in shrubs and nearby plants at the water's edge. Based on habitat preference only, which pair would you hypothesize is the most closely related? Choose one: A. widow skimmer and eastern pondhawk B. twelve-spotted skimmer and eastern pondhawk C. twelve-spotted skimmer and widow skimmer
B. twelve-spotted skimmer and eastern pondhawk
If a codon has the bases GUA, what anticodon will pair with it?
CAU
In a lab, the polymerase chain reaction (PCR) is used to ______, while gene sequencing is used to _____. Choose one: A. cut DNA into pieces; separate pieces of DNA. B. separate pieces of DNA; make copies of DNA. C. determine the order of bases in a gene; separate pieces of DNA. D. make copies of DNA; determine the order of bases in a gene.
D. make copies of DNA; determine the order of bases in a gene.
In a eukaryotic cell, the process of transcription takes place in the _____, while translation occurs in the _____. Choose one: A. ribosome, nucleus B. mitochondria, nucleus C. cytoplasm, nucleus D. nucleus, cytoplasm
D. nucleus, cytoplasm
What if DNA is damaged?
Enzymes (DNA polymerase) can fix mistakes
Below are some traits found in fish and tetrapods. Based on what you learned from the interactive, match the traits to the correct animal groups. Traits: A. eyes on top of a flat head B. scales C. limbs with digits D. fins E. neck F. eyes on the side of the head
Fish: D. fins B. scales F. eyes on the side of the head Tetrapods: C. limbs with digits E. neck A. eyes on top of a flat head
The complementary base of CAGT is...
GTCA
Is the evolution of more wolf-like traits in the stray dogs of Moscow an example of artificial selection? Why or why not?
It is NOT an example of artificial selection. It is an example of natural selection.
French scientist prior to Darwin. Traits could be pasted down to generation to generation, inheritance of acquired characteristics.
Lamark
base-pairing rules
The rules that govern the pairing of nucleotides in DNA. Adenine (A) on one strand can pair only with thymine (T) on the other strand, and cytosine (C) can pair only with guanine (G).
Match each event or molecule in the correct location within a eukaryotic cell. Events and Molecules: A. ribosome B. RNA polymerase C. DNA D. translation E. transcription Locations: Nucleus Cytoplasm
Nucleus: B. RNA polymerase C. DNA E. transcription Cytoplasm: A. ribosome D. translation
Complete the sentence: Transcription moves the information found in DNA to RNA _____________.
One gene at a time
histone proteins
One of a class of specific proteins that, together with DNA, form nucleosomes.
Example of modern day evolution in action?
Over 150 years in Moscow, Russia, stray dogs can now be seen with a lost spotted coloration, wagging tails, and friendliness. In general they have more wolf-like traits. The dogs have 4 groups. 1. Guards - follow security personnel 2. Scavengers 3. Wild Dogs 4. Metro Dogs
Example of modern day biochemical evidence for evolution?
Protein data can be used to test for evolutionary relationships - example: The percentage difference in the cytochrome c sequence protein of Chimpanzees is 0% to that of humans. It is 8.7% different from that of mice to humans.
Chromosomes
The DNA + structural proteins that contain both genetic information and the instructions for making protein - Located in the nuclei of cells
start codon
The codon AUG; the point on an mRNA strand at which the ribosomes begin translation
How are directional, stabilizing, and disruptive selection all similar?
They all operate by the same principle. - Individuals with certain forms of an inherited trait have better survival rate and produce more offspring than do individuals with other forms of that trait.
If a DNA sequence is AATTCCGG, what is the reciprocal RNA sequence?
UUAAGGCC
codon
a unique sequence of three mRNA bases that either specifies a particular amino acid during translation or signals the ribosomes where to start or stop translation
Fill in the blanks with the correct terms: When a population evolves to be better suited to its environment, this is an example of ___________, which is bought about by the process of ______________.
adaptation, natural selection
Fill in the blanks: Migrants can move _________ from one population to another.
alleles
What are the ingredients for making a protein?
amino acids
RNA polymerase
an enzyme that recognizes and binds a gene's promoter sequence and then separates the two strands of DNA during transcription
chromosomal abnormality
any change in the chromosome number or structure, compared to what is typical for a species
autosome
any chromosome that is not one of the sex chromosomes
Fill in the blanks with the correct terms: The four nucleotides of DNA contain the __________ adenine (A), cytosine (C), guanine (G), and thymine (T). The nucleotides exhibit _____________________ according to _______________: base A can pair only with T, and C can pair only with G.
bases, complementary base-pairing, base-pairing rules
Punnet Square
can be used to calculate the probability of inheriting a particular genetic trait
Mutations can be: Multiple Choice: a. good b. bad c. neutral d. beneficial e. all of the above
e. all of the above
Fill in the blanks with the correct terms: DNA is wrapped around ____________, forming ____________. The nucleosome structures can further compact the DNA by coiling around themselves to form a _________________. Chromatin fibers further coil around themselves to form chromosomes.
histone proteins, nucleosomes, chromatin fiber
Link each term with the correct definition: Terms: nucleotide base pair DNA molecule base Definitions: 1. Two complementary bases joined by hydrogen bonds. 2. One component of a nucleotide; there are four variants of this component. 3. A string of nucleotides linked together by covalent bonds between a sugar and a phosphate; two strands are linked by hydrogen bonds between complementary bases. 4. A unit consisting of sugar deoxyribose, a phosphate group, and a base (adenine, cytosine, guanine, or thymine).
nucleotide: 4 base pair: 1 DNA molecule: 3 base: 2
sex chromosomes
one of the two chromosomes (X and Y) that determine gender
Select the correct terms: The genetic code is (unambiguous / redundant) because some amino acids are coded by more than one codon. At the same time, the genetic code is (unambiguous / redundant) because each codon codes for only one amino acid.
redundant, unambiguous
RNA
ribonucleic acid; a single-stranded nucleic acid transcribed from DNA and consisting of the ribonucleotides adenine, guanine, cytosine, and uracil.
Complete the sentence: RNA moves to the ___________, where the direction on the gene (for making a protein) are followed.
ribosomes
stem cells
unique, unspecialized cells that can make identical copies of themselves for long periods of time and can be used in gene therapy
chromatin fiber
A chromosome in relaxed form, made up of DNA and nucleosomes.
What are some examples of convergent evolution?
- Plants with similar characteristics of that of a cacti have very different genetics. - The fins of a shark and dolphin are very similar in characteristics but they have very different genetics.
vestigial trait
A feature that is inherited from a common ancestor but no longer used. Vestigial traits may appear as reduced or degenerated parts whose function is hard to discern.
Scientist who proposed the same ideas at approximately the same time with similar experiences as Charles Darwin
Alfred Russel Wallace
Reduces tailbones and the associated remnant muscles in humans are an example of what type of evidence for common descent? Multiple Choice: A. artificial selection B. homologous traits C. biogeography D. fossil evidence
B. homologous traits
If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence... Multiple Choice: A. ATTCGCGCA B. GCCCGCGCT C. GCCATATAG D. TAACGCGCT
C. GCCATATAG
Voyage of the Beagle (1831-1836)
Charles Darwin's famous global voyage, where he found his first evidence of evolution
nucleotide
The basic repeating subunit of DNA, composed of the sugar deoxyribose, a phosphate group, and one of four bases: Adenine (A), Cytosine (C), Guanine (G), or Thymine (T).
If one strand of DNA has the bases ATAGGACCC, what will the bases of the complementary strand have?
TATCCTGGG
gene regulation
The changing of the genes that are expressed in response to internal signals or external cues that allows organisms to adapt to their surroundings by producing different proteins as needed
embryonic development
The process by which an embryo develops. Common patterns of embryonic development across species provide evidence of evolution.
promoter
a segment of DNA near the beginning of a gene that RNA polymerase recognizes and binds to begin transcription
DNA sequence similarity
the degree to which the sequences of two different DNA molecules are the same - a measure of how closely related two DNA molecules are to each other
gene expression
the process by which genes are transcribed into RNA and then translated to make proteins
selective breeding
the process by which humans allow only individuals with certain inherited characteristics to mate
