Biology Final Exam Review
Red blood cells carry antigens on their surfaces coded for by alleles of the gene represented by the letter I. The allele I^A is dominant to i and produces antigen A on the surface of red blood cells. The allele I^B is also dominant to the i allele and produces antigen B on the surface of red blood cells. the I allele does not produce surface antigens. What are the possible genotypes of a person with type A blood? 1. I^A I^A 2. I^A I^B 3. I^A i
#1 and #3
What is the number of chromosomes on a normal human karyotype?
46
Lucille
A future child might suffer from cystic fibrosis if the father's genetic report is the same as lucille's report
Fungi affect humans in several ways, but NOT in which of the following ways?
All above are ways that fungi affect humans
Study the Punnett square shown here. It describes the potential offspring of a cross between two parents. What phenotypes will be shown by the offspring?
All offspring will show the dominant phenotype for this trait
An expected result of the simulation is that the frequency of mutagens under normal conditions is about 1 in every 10 million base pairs of DNA. In the presence of tobacco smoke or ultraviolet light, the frequency of mutations will increase
Answer 1.) 10 million Answer 2.) increase
In this pedigree chart there are 8 males and 4. Of all the individuals, 8 do express the trait of interest, and 4 do not. there are 4 generations included in the pedigree.
Answer 1.) 8 Answer 2.) 4 Answer 3.) 8 Answer 4.) 4 Answer 5.) 4
This figure shows a section of a double-stranded DNA molecule. What aspects of the structure of DNA are explained by this model? select three answer choices.
Answer 1.) Adenine is paired with thymine and guanine is paired with cytosine. Answer 2.) Paired nucleotides are held together by hydrogen bonds. Answer 3.) The two strands of DNA each have phosphate - sugar backbones
What happens to the two cells formed at the end of meiosis 1? Choose two correct answers
Answer 1.) Four haploid daughter cells are formed during meiosis 2. Answer 2.) Chromosomes do not replicate and the paired chromatids separate.
Red blood cells carry antigens on their surfaces coded for by alleles of the gene represented by the letter I. The allele I^A is dominant to i and produces antigen A on the surface of red blood cells. The allele I^B is also dominant to the i allele and produces antigen B on the surface of red blood cells. the I allele does not produce surface antigens. 1. I^A I^A 2. I^A I^B 3. I^B I^B 4. I^A i 5. I^B i 6. i i What type of pattern of inheritance is represented by the genetic of human blood types? Select all answers that apply.
Answer 1.) IA and IB show codominance because both alleles are equally expressed in blood type AB. Answer 2.) The human blood type gene is an example of a gene with multiple alleles: IA, IB, i.
In Great Smoky Mountains National Park
Answer 1.) a. temporal isolation: The species remain separate because the period of most active mating differs Answer 2.) c. Behavioral isolation: Each species exhibits a unique flash pattern that allows males and females to recognize each other.
In DNA, thymine always pairs with adenine and cytosine always pairs with guanine by forming hydrogen bonds across complementary strands.
Answer 1.) adenine Answer 2.) guanine Answer 3.) hydrogen bonds
Most prokaryotes reproduce by means of the process of binary fission, which is a form of asexual reproduction.
Answer 1.) binary fission Answer 2.) asexual reproduction Answer 3.) conjugation Answer 4.) better Answer 5.) survive
Meiosis is a process that ___________ chromosomes to the ___________ number, provides genetic variability, and ensures the correct distribution of chromosomes into gametes.
Answer 1.) decreases Answer 2.) haploid Answer 3.) variability Answer 4.) chromosomes Answer 5.) gametes
A human cell carries a double set of chromosomes is called a diploid cell. The cell contains 2N = 46, number of chromosomes. One allele of each gene is located on each heterologous chromosome. In sexuall reproduction, meiosis produces haploid gametes with one of each kind of chromosome. In humans, these cells contain N= 23 number of chromosomes.
Answer 1.) diploid Answer 2.) allele Answer 3.) gene Answer 4.) homologous Answer 5.) haploid Answer 6.) 23
Changes in water pressure within the _________ cause the_________ to open and close. When water is plentiful, it flows into the leaf, which increases the pressure in the guard cells, which separate. Then, carbon dioxide can enter the leaf.
Answer 1.) guard cells Answer 2.) stomata Answer 3.) increases Answer 4.) carbon dioxide
The figure shows both aswexual and sexual reproductive cycles.
Answer 1.) haploid Answer 2.) zygospore Answer 3.) fertilization
The enzyme DNA polymerase joins nucleotides to synthesize a new shared DNA strand.
Answer 1.) polymerase Answer 2.) nucleotides Answer 3.) complementary
a population is a group of individuals
Answer 1.) population Answer 2.) phenotypes Answer 3.) gene pool Answer 4.) alleles Answer 5.) natural selection
The karyotype supports the following explanation of events. During the process of gamete formation in one parent of the patient, one pair of chromosomes failed to separate during a stage of meiosis.
Answer 1.) separate Answer 2.) meiosis
some protist life cycles switch between diploid and haploid phases.
Answer 1.) spores Answer 2.) diploid Answer 3.) gametes Answer 4.) haploid
The diagram shows the concentration of a plant hormone in a growing plant shoot. Which statement explains the role of this plant hormone?
Auxins collect on the side of a shoot that is shaded from the sun, causing the cells on that side of the plant to elongate, and the plant to curve toward the sun
Marisol
Capillary action and transpiration
When must DNA replication occur during the cell cycle for each daughter cell to receive a complete copy of DNA?
DNA replication must occur during S.
The epiglottis is a little flap in the throat that closes the esophagus while you breath
False
The major organ of the excretory system is the large intestine
False
The table shows data that Chargaff collected on nitrogenous bases in the DNA in five organisms. Which statement did Chargaff conclude based on these data ( Note: A letter in brackets, such as [A] or [C], refers to the concentration of one of the nitrogenous bases.
In DNA molecules, [A] = [T], and =[C] = [G]
A scientist has identified a protein that she claims is the product of a sex-linked gene. To gather evidence to support this claim, which action would be MOST useful for the scientist to take?
Locate the gene on the X or Y chromosome.
Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?
Many amino acids, although not all of them, may be encoded by more than one codon.
A point mutation changes a codon in an mRNA molecule. Will the mutation affect the protein that forms? Why?
Maybe. Some sets of codons are translated into the same amino acid.
A person tests positive for a retrovirus. Does this prove that they are exhibiting the symptoms of an illness?
No, because viral genes can replicate with the host's genome for many generations without harming the cell and causing illness
The model of the double-helix model of the DNA molecule resembles a twisted ladder. What makes up the rungs of the twisted ladder?
Paired nitrogenous bases
What is the primary function of ground tissue
Producing and storing sugars
The diagram shows a model of DNA replication Which of the following labels should NOT be added to the model?
RNA polymerase
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for robert to follow?
Separate the list into three-letter "words"
Which of the following disorders does NOT result from a nondisjunction in meiosis?
Sickle cell anemia
List three functions of the skeletal or muscular systems.
Skeletal- structure movement/function shape
The simulation is able to model the natural selection of a beetle population. Which statement explains why the model is useful?
Some beetle variants were more likely to survive and reproduce than other variants.
Which process explains the movement of water between the xylem and phloem?
Sugars are pumped by active transport, and water travels by osmosis between the xylem and phloem
A molecule of tRNA includes a sequence of three nitrogenous bases called anticodon. What is the role of the anticodon in the process of translation
The anticodon binds to a codon on mRNA
While examining a sample of water under the microscope, laura noticed two bacteria that appeared to be attached by a narrow tube. What is laura observing?
The bacteria are in the process of conjugation
Root systems are classified as fibrous root systems and taproot systems. Which property distinguishes the two types of root systems from each other?
The branching pattern of the roots
What happens during translation?
The cell uses messenger RNA to code and make proteins.
Which problem arises when the same crop is grown year after year in the same field
The crop has an increasing need for fertilizers, herbicides, and pesticides
Alvin is studying a mode of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of 4 nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin's observation most strongly supports which of these conclusions?
The nucleic acid is a form of RNA, and is not DNA.
Which conclusion about the patient do the karyotype data most strongly support?
The patient has an abnormal number of autosomes that likely is causing severe symptoms.
What is the independent vairable of the simulated experiment?
The presence of mutagens
Which of the following is true of all protists
They are all eukaryotes
Mendel studied 7 traits in pea plants. One of the monohybrid crosses he made was between plants with round seeds (R) and plants with wrinkled seeds (r). All of the seeds in the F1 generation had a round shape. Next, Mendel allowed the peas in the F1 generation to self-pollinate, forming the F2 generation. What describes Mendel's observations and conclusion about the F2 generation.
Three-fourths of the F2 plants show the round seed phenotype and carry the dominant allele for roundness
Cardiac muscle and smooth muscle are both involuntary.
True
Tendons connect muscle to bones
True
The right ventricle pumps "blue" blood out to the lungs
True
How could the experiment be altered to test for another type of tropism? choose the most reasonable modification
Turn the plants upright and place a bamboo stick at varying distances from each plant, to test thigmotropism.
Vascular tissues make up a plant's circulatory system. How are the two types of vascular different from each other?
Xylem carries water to leaves; phloem carries sugars from leaves
These homologous chromosomes carry different alleles of the wild type and mutant type in the fruit fly drosophila. A cell with the homologous chromosomes undergoes meiosis, and gametes are produced. is it possible for a chromosome of a gamete to contain the alleles for gray body and brown eyes?
Yes, because homologous chromosomes may exchange segments by crossing over during meiosis
A karyotype is assembled from the cell of a human donor who has a genetic disorder. Which disorder can be determined by studying the karyotype?
a chromosomal disorder, such as Down syndrome
Polyploidy is a condition in which organisms have extra sets of chromosomes. Scientists have observed many examples of polyploidy in plants, including crop plants such as bananas, lines, and strawberries. What BEST describes polyploidy in these plants?
a chromosomal mutation that may provide benefits to an an organism
A bacterial cell is infected by a virus
a lytic infection
Artificial selection has provided a wide variety of crop plants, livestock, and pets. Which characteristic of artificial selection makes it different from natural selection?
a. Humans, not the environment, select which organisms survive and reproduce
Western and Eastern meadowlarks
a. Reproductive isolation occurred through behavioral isolation.
Corn plants cannot be separated into discrete types or classes by their height. What does the graph show?
a. The graph shows the distribution of polygenic phenotypes that are expected for a trait in which two or more genes contribute to the trait.
The wing of a bird and the front limb of a mammal have a similar number and arrangement of bones. How would an evolutionist explain these similarities?
a. The wing and front limb are homologous structures; each evolved from a common ancestor
What is the main function of the organ discussed above?
absorbing water and compacting digestive waste
Where on a plant are apical meristems found? Choose two correct answers
at the tips of stems at the tips of roots
Which type of hormone allows plants to respond to this kind of tropism
auxins
Charles Darwin collected and studied a variety of fossils. The fossils provided clues to ancient organisms. As Darwin concluded, how did ancient organisms compare to modern species
b. The ancient organisms were similar to modern species, but differed in several ways.
fifteen iguanas survived a hurricane
b. The island iguanas are geographically isolated from the original population.
A population of male and female goats
b. certain ear shapes help the goats survive and reproduce on the island
Horace is using a computer model to study the relationship between the genes and phenotype of an individual sequence in one of the model genes. In response, the computer shows that the eye color of the individual changes from brown to blue. How did the change in the gene cause the change in phenotype?
by affecting the amino acid sequence of a protein
Edwin
c. A new predator tends to hunt more white rabbits than gray or brown rabbits.
A scientist might claim that the wings of ostriches are examples of vestigial structures. What would that mean?
c. An ancestor of ostriches had useful wings
a geneticist collected data of a population of mice. of the population of 50 mice, 12 were homozygous black (BB), 24 were heterozygous black (Bb) and 14 were brown (bb). What are the allele frequencies for this population?
c. B=0.48; b= 0.52
In the late 19th century, scientists began to classify bacteria based on phenotypic markers
c. Scientists became able to analyze DNA and derive better understandings of evolutionary relationships
Which conclusion about the simulated beetle population does the data support?
c. The fitness of the beetle variants changed during the simulation
A variety of plants and animals live in a meadow ecosystem. According to Darwin's ideas about evolution, which of these meadow organisms has the greatest fitness?
c. a female mouse that has many offspring
According to Darwin's theory of evolution, each beak shape is the result of the process of natural selection. Which statement is MOST USEFUL for explaining why different beak shapes evolved in each of the four finch species?
d. The food supply selected for beak shape as the finch species descended from a common ancestor.
The adaptations of a pelican include its long, pouch-like beak. Why is the beak of the pelican an example of an adaptation?
d. The shape and structure of the beak are inherited and help improve the pelican's sitness in its environment.
A scientist suggests that the first sinch species to arrive on the galapagos islands wan an insect-eating finch, similar to the modern warbler finch (certhidea olivacea). If the scientist's suggestion is correct, then how many of the four finch species shown in the diagram could have evolved from the first finch species?
d. all 4 species
Both of the previous organs are apart of which system?
digestive
Raul is using a computer model to investigate meiosis. He directs the model to show a nondisjunction of chromosome 21 during meiosis 1. How many copies of chromosome 21 should the model display in each gamete that is produced?
either 2 copies of no copies
Nathaniel is visiting his city's plant conservatory, which is a giant old greenhouse
evaporation of water from the soil transpiration by plants
Raj is using a microscope to examine protists
flagellum
Which tropism is this experiment designed to test?
gravitropism
Which event occurs in prophase 1 of meiosis, but not prophase of mitosis
homologous chromosomes pair to form a tetrad, and may cross over
What does the diagram explain about transport in plants?
it explains how sugars can be stored in the root
in which structure of the plant does gas exchange occur most frequently
leaves
There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). Which type or types of Rna contain a copy of the instructions that a gene carries
mRNA only
A genetic disorder is caused by an allele of a sex-linked gene, located on the Y chromosome. How is the disorder inherited?
only from the father to a son
Which of the following are found in both DNA and RNA?
phosphate groups, guanine, and cytosine
Fungi have cell walls made with chitin. This is an indication that fungi are most closely related to which group of organisms?
plants
Mycorrhizae are symbiotic between fungi and organisms of which group?
plants
What is the name for a mutation that involves one nucleotide only?
point mutation
The previous organ is a muscle, but for which system does it perform its main function?
respiratory
Which of the following are the world's four major food crops
rice, corn, soybeans, wheat
What kind of muscle cells are found in the walls of the organ discussed above?
smooth
robins typically lay four eggs
stabilizing selection
Steven develops a pedigree for earlobe attachment in a large family. Earlobes can be either free or attached. What information about earlobe attachment can steven MOSt LIKELY determine by analyzing the pedigree?
the dominant and recessive forms of the trait
A sequence of mRNA contains the following bases, which are translated as three codons. ACUACGACA Which amino acids are produced by this sequence? Select all of the amino acids that apply.
threonine only
Ribosomes are tiny "factories" in the cell that do all of the following EXCEPT
translate DNA into RNA
Enrique notices a sign saying that flu shots are available in the pharmacy
viruses constantly change and evolve, and the new shot will be more effective against this year's viruses.
