Biology - Homework Ch 12
There is only one codon, 5'-UGG-3', for the amino acid tryptophan (trp), therefore the anticodon in the tRNA for tryptophan must have the sequence
3'-ACC-5'
The complimentary messenger RNA strand that would be synthesized from the DNA base sequence of 5'-CTGAC-3' would be
3'-GACUG-5'
A 5'-CUA-3' codon in an mRNA could be recognized by which of the following anticodon sequences in a tRNA?
3'-GAU-5'
Part of a gene sequence on the DNA reads 5'-ATGCGC-3'. The mRNA will therefore read _____ in that region
3'-UACGCG-5'
Which type of RNA is involved in protein synthesis?
All of the answers are correct
Which of the following statements about RNA splicing is FALSE?
All of the answers are correct.
Which of the following statements about tRNA molecules is TRUE?
Bases in the tRNA loops do not pair with any other bases
A molecule found in the nucleus of cell that contains the cell's genome.
DNA
In DNA replication, the goal is synthesis of
DNA
Which of the following best describes transcription?
DNA -> RNA
The enzyme that is involved in replication but not transcription is _____
DNA polymerase
During _____, both strands of the DNA will function as a template.
DNA replication
Which of the following statements about termination is TRUE?
No tRNA can recognize a stop codon. It is recognized by a release factor protein.
How does the ribosome recognize the proper tRNA to bind?
Only a tRNA with an anticodon that is complementary to the codon will bind in the A-site
The initiating transfer RNA, carrying formylmethionine, binds to which site?
P site
Which of the following is not involved in the initiation of translation?
RNA polymerase
During the process of transcription in a eukaryote
RNA polymerase synthesizes new nucleotide chains in the 5' to 3' direction.
The enzyme that accomplishes transcription is termed
RNA polymerase.
Why is RNA synthesis called "transcription" and protein synthesis called 'translation?'
RNA synthesis makes a complementary copy of the DNA using nucleic acid and protein synthesis requires the information in the RNA to be changed into a different type of molecule.
A single point mutation has occurred in a gene causing a stop codon to appear early in the translation of the protein. What effect will this have on the protein?
The early stop codon will cause termination to occur earlier, and the protein will be abnormally short.
If there is an error during the transcription of a gene, what will be the consequence?
The final protein might not be functional
What stimulates the ribosome to move down one codon?
The formation of a bond between the peptide in the P site and the amino acid in the A site.
A mutation occurred in the third codon position of a gene, but the protein still functions normally. How is this possible?
The genetic code is redundant, so that mutations in the third position of the codon often result in the same amino acid being specified.
The rough endoplasmic reticulum (rough ER) and the smooth ER differ in which of the following structural characteristics?
The rough ER has many ribosomes bound to it.
How does a eukaryotic ribosome initially bind to the mRNA?
The small subunit binds to the 5' guanine cap
Look at the sequence of DNA in the normal and diseased individual. Using the Genetic Code, which amino acid has replaced which?
Valine has replaced glutamic acid.
RNA polymerase is able to open the DNA double helix as it moves down the template. What type of enzymatic activity does this mean RNA polymerase must possess?
helicase activity
A difference between bacterial and eukaryotic transcription
in eukaryotes, there are different RNA polymerases (I, II, and III).
Where does the greatest variability among codons specifying the same amino acid occur?
in the third nucleotide of the triplet
Which of the following statements about peptidyl transferase is TRUE?
it catalyzes the formation of peptide bonds and It is present in the 50S ribosomal subunits.
Which of the following is correct regarding sigma factor?
it recognizes the promoter region
The molecule that carries information from the DNA specifying a polypeptide to ribosomes
mRNA
During the process of translation in a eukaryote
mRNA interacts with ribosomes in the cytoplasm.
A tRNA with anticodon 3'-UAC-5' would be attached to the amino acid
methionine (met)
A difference between bacterial and eukaryotic translation is
modifications to the 5' end of mRNA help it to bind to ribosomes only in eukaryotes
The amino acids carried by the transfer RNA are joined by
peptide bonds
A mature mRNA will have a _____ added
poly A tail
A tRNA with anticodon 3'-GGG'-5' would be attached to the amino acid
proline (pro)
The transcription enzyme first attaches to the ________ of the gene.
promoter
The segment of the DNA molecule where messenger RNA synthesis begins is called the
promoter region
Translation is the synthesis of
proteins from mRNA
The protein that promotes translation termination is called
release factor.
The snRNPs are also called
snurps
The reason that the genetic code can correctly specify the order of amino acids in a polypeptide is
specific tRNAs become attached to specific amino acids.
In the cytosol, the poly A tail is important for ____ of the mRNA.
stability
The Rho protein is involved in the _____ stage of transcription.
termination
Which of the following best describes translation?
RNA -> Protein
Of which type of molecules are spliceosomes composed?
RNA and Protein
If there is an error during translation of a gene, what will be the consequence?
The protein might not be functional.
Arrange the following in the proper sequence in which they occur during RNA splicing. 1. Lariat is formed 2. U2 binds to branch site 3. 3' splice site is cut
2, 1, 3
The carboxyl terminus of a polypeptide will contain amino acids whose codons are closer to the ______ end of the mRNA.
3'
RNA polymerase and primase both add nucleotides to a
3' OH
The amino terminus of a polypeptide will contain amino acids whose codons are closer to the _____ end of the mRNA.
5'
Which of the following do snRNPs bind to?
5' and 3' ends of the intron
Shortly after RNA polymerase begins to transcribe a pre-mRNA, a ____ is added.
5' cap
The template strand of a gene includes the sequence 3'-AGT-5'. The mRNA will therefore have the sequence _______in the same position.
5'-UCA-3'
The genetic code consists of ____ codons that specify amino acids, and ____ codons that do not specify amino acids.
61; 3
New amino acids (other than the initial f-Met) enter at which site?
A
Translation is terminated when a stop codon is presented at the ________ site.
A
Which of the following statements below is TRUE?
A complex disease like sickle cell anemia is due to the substitution of a single amino acid in a single protein.
What is the difference in the amino acid sequence (and therefore the protein) of the normal individual and that of the individual with sickle cell anemia?
A single amino acid has been changed.
What is the difference in the DNA sequence of the normal individual and that of the individual with sickle cell anemia?
A single base has been changed.
Which of the following statements is TRUE?
A single point mutation in the DNA sequence leads to a change in the protein structure, which leads to a change in the protein's function and causes sickle cell anemia.
Translation is terminated when a stop codon is presented at the
A site
The terminator of a gene is located upstream of the coding region.
False
The three base sequence on the transfer RNA is the codon.
False
Introns are generally considered 'free to mutate,' meaning that if a mutation occurs within the intron, it will not effect the functional protein. What is an exception to this axiom?
If there is a mutation in the 3' or 5' splice site, the snurp won't recognize it, and it will not be removed from the mRNA.
What is a difference between DNA replication and RNA transcription?
In DNA replication the helix is never closed after it is opened by helicase, but once RNA polymerase has finished transcribing a region, the double helix closes.
Which of the following does not occur during translation in eukaryotes?
Introns are removed by the ribosome.
How is GTP used during elongation?
It aids in the binding of the incoming tRNA to the A site of the ribosome AND It aids in translocating the ribosome one codon down the mRNA.
What is unusual about the initiator tRNA in prokaryotes?
It carries a modified amino acid AND it does not bind to the ribosome at the A site
In transcription, the goal is synthesis of
RNA
A molecule made of amino acids that correspond to the genetic information in a structural gene
Polypeptide
Why do eukaryotes require a 5' cap and a poly-A tail but prokaryotes don't?
Prokaryotes don't need to transport their RNA out of the nucleus, so they don't need these features.
Below is an alignment of DNA sequences from the same locus in 5 different species. From this information, which of the following statements is TRUE? 1. gatttcttttggggtccccacatgtactca 2. gatttctctccgggtaacgacatgtattcc 3. gatttctctccgggtaacgacatgtattcg 4. gatttctctt--ggtcccgacatgtaatcg 5. gatttctctt--ggtccggacatgtaatcc
Species 2 and 3 are probably the most closely related because they are the most similar.
How do you know that the gene being transcribed in the animation is in a prokaryote?
The initiation of transcription involves a sigma factor.
If an aminoacyl-tRNA synthetase added the wrong amino acid to a tRNA, what would happen?
The tRNA would carry the worng amino acid, and it would be incorporated into the growing protein.
Why are nucleotide triphosphates used to polymerize RNA?
The triphosphate is a high energy molecule so that polymerization is spontaneous.
Which of the following statements about the segment of DNA below is TRUE? 5'-CTATGGGCCATTTTTTAACGGGAGGCCCATGAA-3'3'-GATACCCGGTAAAAAATTGCCCTCCGGGTACTT-5'
There are two possible transcripts that are transcribed on opposite strands of the helix.
What changes would a scientist want to make to a eukaryotic gene before they insert it into a bacterial chromosome to be expressed?
They should remove the introns.
Which of the following statements about a structural gene is TRUE?
Transcription of structural genes requires DNA sequences that are not part of the gene itself.
Eukaryotic transcription factors include activators and coactivators.
True
The amino acid sequence of a protein determines its shape and specific function.
True
At what point in gene expression do molecules go from being information storage molecules to metabolic and structurally functional molecules?
When RNA is translated into protein.
Which of the following statements about eukaryotic mRNA is TRUE?
a cap is added to their 5' end, a poly-A tail is added to their 3' end, and each usually specifies only a single protein
Which of the following does not occur during the processing of eukaryotic mRNA?
a ribosome recognition sequence is added.
Islet cells in the pancreas secrete the protein insulin in a step by step process. Reconstruct the correct sequence of events
export of mRNA to cytoplasm --> translation on ribosomes on rough ER --> processing of polypeptide in Golgi
In the nucleus, both 5' and 3' modifications to mRNA are important for
export of the mRNA to the cytosol.
There is only one start codon, AUG. This means that
all newly-made polypeptides have a methionine at their amino end.
In eukaryotes, transcription to produce an mRNA must occur in
the nucleus, where the chromosomal DNA is found.
Which of the following occurs as a result of translocation?
the tRNA that was in the P site moves into the E site
Which of the following occurs as the ribosome shifts down the mRNA by a distance of three nucleotides?
the tRNA that was in the P site moves into the E site
A characteristic shared by eukaryotic mRNA, tRNA, and ribosomal RNA is that...
they are all transcribed from DNA
Which of the following statement(s) about basal transcription factors is(are) TRUE?
they are essential for transcription and they cannot increase the rate of transcription by themselves
During _____ , only one strand of the DNA will function as a template.
transcription
The synthesis of an RNA copy of a gene
transcription
The structure that causes the synthesis of RNA to cease is known as the
transcription terminator.
At the E site
transfer RNA is released
In the cytosol, the 5' cap is recognized by proteins that enable the mRNA to be
translated
The synthesis of a specific sequence of amino acids on a ribosome.
translation
Splicing joins together
two exons
The assembly of transcription factors begins
upstream from the transcription start site