Biotech Exam 2
After amplification of DNA fragment by PCR using 10 cycles the amount of target DNA will increase: a.) 10 fold b.) 10x10=100 fold c.) (10+10)x10=200 fold d.) (10x10)x10=1000 fold e.) 1x2x2x2x2x2x2x2x2x2x2=1024 fold
1x2x2x2x2x2x2x2x2x2x2=1024 fold
PCR amplicon of insulin gene from a human chromosomal DNA: a.) Will contain intron sequences b.) Can be used for the proinsulin expression in bacterial cells c.) Can be used for the preproinsulin expression in bacterial cells d.) Can be used for the insulin part A expression in bacterial cells e.) Can be used for the insulin part B expression in bacterial cells
Will contain intron sequences
One statement about PCR is WRONG. Which one is it? a.) 95dC step temperature is optimal for Taq polymerase b.) the longer the sequence of PCR primer the higher it's annealing temperature is c.) GC rich primers have the higher melting temperature d.) if the annealing temperature for PCR primer is set about Tm, the PCR will not start e.) if the annealing temperature for PCR primer is set below Tm, the amplification will not be efficient
a.) 95dC step temperature is optimal for Taq polymerase
PCR is the "Xerox machine" of the molecular biology and modern medicine. Amplification of the target DNA in this reaction is achieved by synthesis of the amplicon (DNA) using small amount of initial source DNA, the DNA polymerase (Taq), and nucleotides. During PCR: a.) All components are mixed before PCR and only temperature changes lead to the accumulation of the target amplicon. b.) Source DNA is added before each cycle. c.) Taq polymerase is added during each cycle. d.) Nucleotides are added before each cycle. e.) The amount of DNA increases in arithmetical progression.
a.) All components are mixed before PCR and only temperature changes lead to the accumulation of the target amplicon.
Illumina NGS technology (massive parallel sequencing) utilizes chips for the whole genome sequencing. Only one statement below incorrectly describes the NGS chip. Which one is it? a.) Each spot on the chip has different sequence and no spots have identical DNA sequences. b.) Each spot contains thousands of identical DNA strands c.) Each spot is a result of PCR (bridge) amplification starting from a single DNA strand d.) In each spot new DNA strand is synthesized in parallel with other spots during sequencing e.) Occasionally different spots contain identical sequences.
a.) Each spot on the chip has different sequence and no spots have identical DNA sequences.
Only one statement about monoclonal antibody is incorrect. Which one is it? a.) For production of monoclonal antibody the lab animals are genetically modified. b.) After injection of antigen the animal react by producing a polyclonal antibody response. c.) The white blood cells producing antibody can be maintained outside of the animal's body only for several cell generations. d.) Hybridizing the antibody-producing white blood cells and mice tumor cells allows to create the hybridoma cell culture that produces desired antibody and is immortal. e.) The monoclonal antibody are call so because the entire hybridoma cell culture is the progeny of a single event of hybridization of one white blood cell and one tumor cell.
a.) For production of monoclonal antibody the lab animals are genetically modified.
Only one statement about the in vitro oligomediated mutagenesis is incorrect. Which one is it? To create a mutation using a plasmid and an oligo ... a.) One need an oligo that has full complementarity to a specific region of the plasmid. b.) This oligo is annealed to one strand of the plasmid and serves as a primer for DNA polymerase. c.) After the completion of the complementary strand synthesis by DNA polymerase the resulting double stranded DNA plasmid is cloned. d.) The result of cloning is colonies containing either WT or mutant plasmid copies. e.) At the final stage the colonies are screened and those containing mutation are selected.
a.) One need an oligo that has full complementarity to a specific region of the plasmid.
Only one statement about NGS (Illumina) is INCORRECT. Which one is it? a.) only Sanger sequencing procedures require the DNA polymerase, while for NGS it is the chemical synthesis b.) during NGS hundreds of millions of DNA fragments are sequenced simultaneously c.) the amount of sequenced (read) letters will be the same for all DNA fragments d.) each letter color for each fragment (hundreds of millions of fragments) is registered by the CCD camera attached to a computer during the synthesis e.) to assemble the whole genome sequence after NGS it is necessary to have overlaps between sequenced fragments
a.) only Sanger sequencing procedures require the DNA polymerase, while for NGS it is the chemical synthesis
The temperature steps for PCR that we discussed in the class are 95C, 60C, and 72C. What step and how will be affected by switching to more AT rich primers for PCR? a.) 72C step needs to be performed at higher temperature. b.) 60C step needs to be performed at lower temperature. c.) 95C step needs to be performed at higher temperature. d.) 60C step needs to be performed at higher temperature. e.) 95C step needs to be performed at lower temperature.
b.) 60C step needs to be performed at lower temperature.
The bridge amplification during cluster generation of the Illumina NGS workflow has the same steps as:\ a.) Sanger sequencing b.) Conventional PCR c.) DNA sticky ends generation d.) Recombinant ligation e.) Plasmid construction
b.) Conventional PCR
Which statement(s) CORRECTLY describes the Sanger sequencing reaction? a.) Two primers can be used as in PCR. b.) The mixture for each sequencing reaction contains all four unmodified nucleotides. c.) All four dideoxynucleotides together are used as part of the mixture in each sequencing reaction. d.) DNA fragment size is registered after addition of each consecutive nucleotide. e.) One set of sequencing reactions (four) with a single primer is enough to read the whole chromosome.
b.) The mixture for each sequencing reaction contains all four unmodified nucleotides.
Out of 5 statements below, one is false. Which one is it? Conventional PCR and real-time PCR both: a.) utilize Taq polymerase. b.) rely on measurement of amplified DNA after each PCR cycle. c.) have limitation for the size of the amplified fragment. d.) require at least two primers. e.) have amplification of the target DNA in geometrical progression.
b.) rely on measurement of amplified DNA after each PCR cycle.
Which statements(s) correctly describes the Sanger sequencing reaction? a.) two primers can be used b.) the mixture for each reaction contains all four unmodified nucleotides c.) all four dideoxy nucleotides together are used as part of the mixture in each sequencing reaction d.) DNA fragment size is registered after addition of each consecutive nucleotide
b.) the mixture for each reaction contains all four unmodified nucleotides If you don't use normal nucleotides, you just generate a stop and generate just one fragment. You want to generate many.
Both old (Sanger) and new (NGS) sequencing techniques are used for diagnostic purposes. Consider the following statements which either correctly or incorrectly describe common points for these two sequencing approaches. Only one statement is INCORRECT. Which one is it? a.) Both use DNA polymerase for synthesis of a new DNA strand. b.) Both use one strand of DNA as a template. c.) Both use dideoxynucleotides to terminate strand synthesis. d.) Both use computer technology to register newly sequenced DNA fragment(s). e.) Both use the nucleotide mix from which a correct nucleotide (based on complementarity rule) is used for addition of any single nucleotide of the growing DNA strand.
c.) Both use dideoxynucleotides to terminate strand synthesis.
The patient's sample used for PCR amplification of the Huntigtin gene resulted in a single band corresponding to 40 CTG repeats. One of the interpretations of results and/or prognosis for this patient is/are INCORRECT. Which one is it? a.) Symptoms of Huntington disorder will be mild and are likely to appear in second half of the lifespan. b.) Parents of the patient were carriers of the Huntington mutation. c.) PCR did not work correctly and did not produce second band. d.) The patient is homozygous for the Hantingtin gene. e.) Both alleles of Huntingtin gene are identical.
c.) PCR did not work correctly and did not produce second band.
If you aplify by PCR the insulin coding region from the cDNA library, insert ii into the expression vector and express the protein from this vector in bacteria, than the resulting protein will be: a.) Insulin partA fused to Gal b.) Insulin partB fused to Gal c.) Preproinsulin d.) The insulin protein with additional sequences correseponding to introns. e.) Proinsulin
c.) Preproinsulin
If during the COVID PCR test the threshold amplification level is reached on 18th cycle instead of 23rd cycle, then... a.) the individual has 5x higher COVID titer (amount of COVID DNA) b.) the individual has 5x lower COVID titer c.) the individual has 32x higher COVID titer d.) the individual has 32x lower COVID titer e.) it is likely false positive result
c.) the individual has 32x higher COVID titer
To determine a DNA sequence using the Sanger method one needs... a.) to perform four independent chemical reactions with the same DNA fragment, in each case cleaving DNA at one of four nucleotides (G,A, T ,and C). b.) to design a DNA primer which will block DNA polymerase at one of four nucleotides (G,A, T ,and C). c.) to use the same single primer in four different letter specific sequencing reactions. d.) to fragment chromosomal DNA into pieces so that the enormous chromosomal DNA size does not interfere with the sequencing reaction. e.) To take images of the running electrophoresis gel after addition of each nucleotide.
c.) to use the same single primer in four different letter specific sequencing reactions.
To determine a DNA sequence using Sanger method one needs... a.) to perform four independent chemical reactions with the same DNA fragment, in each case cleaving DNA at one of four nucleotides (G, A, T, and C) b.) to design a DNA primer which will block DNA polymerase at one of four nucleotides (G, A, T, and C) c.) to use the same single primers in four different letter specific sequencing reactions d.) to fragment chromosomal DNA into pieces so that the chromosomal DNA size does not interfere with the sequencing reaction e.) to make images of the running electrophoresis gel after addition of each nucleotide
c.) to use the same single primers in four different letter specific sequencing reactions Only use one primer because you want to have the same starting point for all four of them. Can't be (a) or (d) because you BUILD DNA in Sanger, not cleave or fragment it
Considering following conditions: (i) human genome has 25,000 genes, (ii) each gene is 10,000 nucleotide long, (iii) NGS can read reliably 500 nucleotide fragments. To read the entire sequence of all genes one needs to generate how many spots on the NGS chip? a.) 25,000 b.) 250,000 c.) 500,000 d.) 10,000,000
d.) 10,000,000
The sequence that was amplified by PCR is ATTGCGTAGAGACTTTCAACACACGCGCTCTCA.....GCTCAAATTGGCCATACGTACCCTGAACCA (Realize that only one strand out of two is typed, and you need both strands to answer the question. Recall also that strands are antiparallel.) The sequence of primers that were used for PCR amplification are: a.) 5'TAGAGAC and 5'ATACGTAC b.) 5'TAACGCA and 5'CTGAACCA c.) 5'ATTGCGT and 5'CTGAACCA d.) 5'ATTGCGT and 5'TGGTTCA e.) 5'TAACGCA and 5'TGGTTCA
d.) 5'ATTGCGT and 5'TGGTTCA
The sequence cut by the Hind III restriction enzyme is 5'AAGCTT3' 3'TTCGAA3' Following are PCR primer sequences: AAAATGCTTCTCGATTGACCT AAAATGCTTCTCGATTGACCT AAAAAGGTTCTCGATTGACCT AAAAAGCTCCTCGATTGACCT AAATTAAGCTTCTCGATTGACCT If one of the above primers is used for PCR, the resulting amplified DNA fragment will contain Hind III site. Which one is it? a.) AAAAAGGTTCTCGATTGACCT b.) AAAATGCTTCTCGATTGACCT c.) AAAATGCTTCTCGATTGACCT d.) AAATTAAGCTTCTCGATTGACCT e.) AAAAAGCTCCTCGATTGACCT
d.) AAATTAAGCTTCTCGATTGACCT
The quantitation of DNA using real-time PCR approach showed that for the investigated sample it takes 25 cycles to reach the same level of amplicon generation as a control (reference) sample. For the control sample it takes only 22 cycles. The interpretation of this result is: a.) The investigated sample has 3 times more DNA than reference b.) The investigated sample has 8 times more DNA than reference c.) The investigated sample has 3 times less DNA than reference d.) The investigated sample has 8 times less DNA than reference e.) The reactions have to be done in the same tube to be compared.
d.) The investigated sample has 8 times less DNA than reference
Only one statement about PCR is WRONG. Which one is it? a.) During 95dC step of PCR all double stranded DNA fragments are separated (melted) into single stranded fragments b.) During 60dC step of PCR primers anneal to target sequences c.) During 72dC step of PCR Taq polymerase starts to extend primers d.) All synthesized fragments after PCR have the same length e.) After 30 cycles of PCR the theoretical amplification rate is 2^30 = 1,074,741,824, however in reality it is lower simply because there is not enough building blocks (nucleotides) in the tube
d.) all synthesized fragments after PCR have the same length
If during the COVID PCR test the threshold amplification level is reached on 28th cycle instead of 23rd cycle, then... a.) the individual has 5x higher COVID titer (amount of COVID DNA) b.) the individual has 5x lower COVID titer c.) the individual has 32x higher COVID titer d.) the individual has 32x lower COVID titer e.) the individual does not have COVID
d.) the individual has 32x lower COVID titer
Only one statement about Sanger sequencing is CORRECT. Which on is it? a.) the amount of bands in each sequencing line (individual letter reaction) for all four reaction is the same b.) if the DNA fragment is GC rich you will see more bands in the A and T lines c.) the mutation that is a deletion of one nucleotide will be seen as an alternative band (peak) in the sequencing lines d.) the mutation that is deletion of one nucleotide will be seen as a shift of bands in all four lines starting at the mutation point e.) two primers can be used for sequencing similar to PCR
d.) the mutation that is deletion of one nucleotide will be seen as a shift of bands in all four lines starting at the mutation point
Only one description below regarding Sanger sequencing using Taq polymerase is incorrect. Which one is it? a.) Adding individual dideoxynucleotides (ddG, or ddC, or ddT, or ddA) to four different reaction mixtures b.) Heating the mixtures to 95C for DNA denaturation. c.) Annealing the primer at 60C d.) DNA synthesis at 72C e.) Denaturation, annealing, and DNA synthesis steps are done only for PCR.
e.) Denaturation, annealing, and DNA synthesis steps are done only for PCR.
Which statement is correct? a.) During a Sanger sequencing reaction two primers are used: one for the top strand and another for the bottom (complementary) strand. b.) Primers are not used in sequencing reactions, they are necessary only for PCR. c.) For a sequencing reaction using Taq polymerase, one needs to use two primers complementary to two different strands of DNA. d.) Human DNA polymerase can be used for PCR the same way as Taq polymerase, if the primer extension step of PCR cycle is done at 37C. e.) During bridge-amplification stage of Illumina NGS, individual DNA clusters are generated by PCR reaction. f.) No answer text provided.
e.) During bridge-amplification stage of Illumina NGS, individual DNA clusters are generated by PCR reaction.
Only one statement about transgenic animals is INCORRECT. Which one is it? a.) Embryonic stem cells can be modified using CRISPR-Cas9 technology. b.) The initial injection of modified cells in the embryo leads to birth of the offsprings, which are also only partially modified. c.) Only if modification (edited gene) gets into the part that includes germ cells, the second generation offspring will be fully transgenic. d.) The second generation can be either fully transgenic or fully non-trasgenic. e.) If the transgenic animal is not detected in the second generation, the breading has to continue with the hope to get the fully transgenic animal in third, fourth or following generations.
e.) If the transgenic animal is not detected in the second generation, the breading has to continue with the hope to get the fully transgenic animal in third, fourth or following generations.
Only one statement about CRISPR-Cas9 is CORRECT. Which one is it? a.) Cas9 is the DNA polymerase. b.) Eukaryotic cells contain Cas9 as a part of their defense system against viruses. c.) The guiding oligo has complementarity to chromosomal region to be edited and also the desired sequence modification. d.) When Cas9 is guided to a specific chromosome locus, it cuts it and creates a desired mutation. e.) The patching oligo has complementarity to the specific chromosome site and caries the desired sequence modification.
e.) The patching oligo has complementarity to the specific chromosome site and caries the desired sequence modification.
Only one statement about the RNAi technology is INCORRECT. Which one is it? a.) RISC complex is the RNAase. b.) Eukaryotic cells contain RISC complex as a part of their gene regulation sytem. c.) The guiding oligo has complementarity to specific mRNA. d.) When RISC complex is guided to a specific mRNA, it cuts it, which leads to the mRNA degradation. e.) The patching oligo helps to save the mRNA from degradation.
e.) The patching oligo helps to save the mRNA from degradation.
Only one statement about COVID PCR test is INCORRECT. Which one is it? For the COVID PCR test... a.) swabs from areas most likely containing virus particle has to be obtained b.) virus RNA has to be extracted and converted into DNA by reverse transcriptase c.) DNA has to be extracted and purified d.) if virus nucleic acid sequence is present it will start the amplification e.) false positive PCR is result of amplification of other virus DNA
e.) false positive PCR is result of amplification of other virus DNA False positive caused by contamination or presence of your own DNA and accidental annealing of primers to some regions that are similar
Only one statement about COVID PCR test is INCORRECT. Which on is it? For the COVID PCR test... a.) swabs from areas most likely containing virus particles has to be obtained b.) virus RNA has to be extracted and converted into DNA by reverse transcriptase c.) DNA has to be extracted and purified d.) primers complementary to the virus DNA has to be used e.) if virus nucleic acid sequence is present it will block the amplification by PCR
e.) if virus nucleic acid sequence is present it will block the amplification by PCR
Only one statement about Sanger DNA sequencing is INCORRECT. Which one is it? For Sanger sequencing... a.) to read the sequence of one DNA fragment one needs to do four separate DNA polymerase reactions b.) in each reaction the synthesis is terminated by a specific dideoxy nucleotide c.) the amount of fragments generated in each sequencing reaction i proportional to the amount of letters causing termination d.) each reaction mix contains deoxy and dideoxy nucleotides e.) reading on the sequencing gel goes top to bottom, because bands on the top correspond to letters closest to the sequencing primer.
e.) reading on the sequencing gel goes top to bottom, because bands on the top correspond to letters closest to the sequencing primer.
What is the CORRECT (only one) statement about Huntington's disease PCR test? a.) the Huntington's PCR amplicons from a particular patient have always the same size b.) the test is positive if PCR product is detected c.) Huntington's disease is recessive d.) the amount of CTG repeats detected by PCR is about 37 for the unaffected person e.) the amplicons for PCR test can form either one or two bands
e.) the amplicons for PCR test can form either one or two bands One bands is really two bands overlapping. Always amplification from two parental chromosomes
Only one statement about NGS (Illumina) is INCORRECT. Which one is it? a.) our individual genome sequence determines most of the traits we have in our life including predispositions to specific diseases b.) the price tag for genome sequencing dropped a million fold during last two decades and is ~$1000 now c.) knowing you own genome sequence can have both positive and negative consequences, as the traits can be actionable or not d.) it is highly beneficial for an insurance company to know the genome sequences of its clients. This knowledge can be obtained for a fraction of the annual premium the individual pays e.) the size of human genome is such that you cannot store this information on the hard drive of an individual computer
e.) the size of human genome is such that you cannot store this information on the hard drive of an individual computer
What is the INCORRECT (only one) statement? During allele0discriminating Real-time PCR... a.) three oligonucleotides are used b.) both 5' to 3' and 3' to 5' exonuclease activities of Taq polymerase are being utilized c.) one oligonucleotide is destroyed for each amplicon molecule synthesized d.) reporter and quencher are separated by Taq polymerase during amplicon synthesis e.) the yield of the PCR amplicon is measured after 30 cycles of PCR
e.) the yield of the PCR amplicon is measured after 30 cycles of PCR
What is the correct (only one) statement about Huntington's disease PCR test? a.) the Huntington's PCR amplicons from a particular patient have always the same size b.) the test is positive if PCR product is detected c.) Huntington's disease is recessive d.) the amount of CTG repeats detected by PCR is about 37 for the unaffected person e.) two amplicons often detected during the Huntington's disease PCR test are the result of human sexual reproduction
e.) two amplicons often detected during the Huntington's disease PCR test are the result of human sexual reproduction
Only one statement about NGS (Illumina) is INCORRECT. Which one is it? For Illumina NGS... a.) long DNA has to be fragmented in short overlapping fragments b.) the identical left and right side adaptor DNA sequences has to be appended to each individual fragment c.) the adaptor sequences are used to form hydrogen bonds with complementary oligos attached to the surface of the chip d.) once individual fragments are attached, they are amplified on the surface of the chip by PCR (bridge amplification) e.) during the sequencing step one out of four added colored nucleotides is added and registered for each fragments according to the nucleotide complementarity rule f.) the DNA synthesis reaction is terminated by dideoxy nucleotides
f.) the DNA synthesis reaction is terminated by dideoxy nucleotides
What is the INCORRECT (only one) statement? During allele discriminating real-time PCR... a.) three oligonucleotides are used b.) both 5' to 3' and 3' to 5' exonuclease activities of Taq polymerase are being utilized c.) one oligonucleotide is destroyed for each amplicon molecule synthesized d.) reporter and quencher are separated by Taq polymerase during amplicon synthesis e.) the yield of the PCR amplification is measured after each cycle of PCR f.) COVID test is done by real-time PCR g.) if primers anneal to wrong DNA sequence they will produce false positive amplification
g.) if primers anneal to wrong DNA sequence they will produce false positive amplification