BLY-302 Exam 2 [Ch. 14/15]

Which statement is true of splicing? A. Exons are spliced to exons, and the 5' end of the intron is attached to the branch point. B. The 5' end of the intron is attached to the branch point. C. Exons are spliced to introns. D. Introns are spliced to introns, and exons are spliced to exons. E. Exons are spliced to exons.

A. Exons are spliced to exons, and the 5' end of the intron is attached to the branch point.

What is the difference between polyribosomes in eukaryotic and bacterial cells? A. In bacterial cells, polyribosomes can attach while the mRNA is being transcribed. B. In eukaryotic cells, polyribosomes only occur in the nucleus. C. In bacterial cells, polyribosomes only occur in the nucleus. D. Polyribosomes do not occur in eukaryotic cells.

A. In bacterial cells, polyribosomes can attach while the mRNA is being transcribed.

What is the purpose of the mechanism of alternative splicing? A. It increases protein diversity. B. The function of alternative splicing is currently unknown. C. It increases gene diversity. D. It allows rapid genetic evolution in bacteria.

A. It increases protein diversity.

A nontemplate strand of bacterial DNA has the base sequence 5′−ATGATACTAAGGCCC−3′5′−ATGATACTAAGGCCC−3′ Determine the amino acids that will be encoded by this sequence. Add the amino acids from left to right in the order the amino acids will be translated.

(Left to Right order): Met, Ile, Leu, Arg, Pro

In the diagram below, which letter indicates the 3' end of the leading strand? A B C D

*D*

What is the function of single-strand-binding proteins? A. connect Okazaki fragments by sealing nicks in the sugar-phosphate backbone B. unwind the double helix by breaking the hydrogen bonding between the two strands at the replication fork C. reduce the torsional strain that builds up ahead of the replication fork as a result of unwinding D. bind to onC and cause a short section of DNA to unwind E. prevent the formation of secondary structures within single-stranded DNA

*E. prevent the formation of secondary structures within single-stranded DNA*

The ribosome in the diagram is in the process of synthesizing a protein using directions transcribed from the DNA. Use the labels to identify each of the structures involved in translation and protein synthesis. *see labeled image*

*see labeled image*

Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA‑to‑amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. *see table*

*see table*

Identify the general features of an amino acid.

- Orange ball = R group - Gray ball below orange ball = alpha-carbon atom - Blue ball with 3 H attached = amino group - Gray ball with 2 O attached = carboxyl group

Match each definition and example to the level of protein structure.

- Primary = polypeptide chain, N-terminal to C-terminal sequence - Secondary = local hydrogen-bond pattern, alpha-helices - Tertiary = three-dimensional structure, zinc finger domain - Quaternary structure = multiple-polypeptide interactions, microtubule complex

Identify the true statements about RNA interference. - miRNAs suppress gene expression by interfering with transcription. - Small RNAs interfere with gene expression by interacting with mRNA, bringing about mRNA degradation. - Duplex RNA (dsRNA) can suppress the expression of a gene. - miRNAs are short, single strands approximately 21 nucleotides long. - miRNA targets the gene from which it was transcribed.

- Small RNAs interfere with gene expression by interacting with mRNA, bringing about mRNA degradation. - Duplex RNA (dsRNA) can suppress the expression of a gene. - miRNAs are short, single strands approximately 21 nucleotides long.

The example shows the splicing of a hypothetical, premature mRNA (pre‑mRNA) transcribed from the gene for yellow fluorescent protein (YFP). Two different YFP mRNAs, isoform A and isoform B, are produced by alternative splicing.What are the possible outcomes of the alternative splicing shown? What are the possible outcomes of the alternative splicing shown? - The alternative splicing of YFP pre‑mRNA prevents polyadenylation. - The protein translated from isoform B is stable but lacks a functional domain. - Isoform‑A mRNA is degraded faster than isoform‑B mRNA is. -Exon 2 will be added to isoform B later to correct the mistake in splicing. - The protein translated from isoform‑A mRNA possesses an additional functional domain.

- The protein translated from isoform B is stable but lacks a functional domain. - Isoform‑A mRNA is degraded faster than isoform‑B mRNA is. - The protein translated from isoform‑A mRNA possesses an additional functional domain.

The table shows the genetic code common to nearly all organisms. Using the codon table, what conclusions can be drawn about the genetic code? - There are three codons that specify the end of translation. - The 64 codons are roughly evenly distributed between the 20 amino acids. - Some codons specify more than one amino acid. - Many amino acids are encoded by multiple codons.

- There are three codons that specify the end of translation. - Many amino acids are encoded by multiple codons.

RNA interference (RNAi) is a mechanism of gene silencing that is mediated by the presence of double‑stranded RNA. Arrange the steps involved in gene silencing by RNAi. - [GIVEN] Double-stranded RNA (dsRNA) is introduced into a cell. - [GIVEN} A gene's expression is silenced. Answer bank: - Long dsRNA is cleaved into short dsRNA. - The sense strand is separated from the antisense strand and degraded. - Antisense RNA pairs with the target RNA. - RNA-induced silencing complex (RISC) binds to short dsRNA. - Target RNA is not translated.

- [GIVEN] Double-stranded RNA (dsRNA) is introduced into a cell. - Long dsRNA is cleaved into short dsRNA. - RNA-induced silencing complex (RISC) binds to dsRNA. - The sense strand is separated from the antisense strand and degraded. - Antisense RNA pairs with the target RNA. - Target RNA is not translated. [GIVEN} A gene's expression is silenced.

The codon table identifies the amino acid sequence that can be translated from a human mRNA sequence. This chart can also be used to identify amino acid sequences for other organisms. Select the organisms that use the codon assignments shown in the codon table. - cat - Staphylococcus aureus - whale shark - oak tree - lizard

- cat - Staphylococcus aureus - whale shark - oak tree - lizard

Suppose that a geneticist was attempting to determine the nature of the genetic code. The geneticist conducts an experiment to determine if the genetic code contains triplets or doublets and if the genetic code is overlapping or nonoverlapping. In the images, each circle represents an amino acid in a polypeptide sequence, with the different colors representing different amino acids. Match the types of polypeptide that the scientist predicts would be produced by different reading frames from the sequence 5′−GAGAGAGAGAGA−3′5′−GAGAGAGAGAGA−3′ to the associated genetic code hypothesis. More than one polypeptide may be possible for each reading frame type. - doublet genetic code without overlap? - doublet genetic code with overlap? - triplet genetic code without overlap? - triplet genetic code with overlap?

- doublet genetic code without overlap? all red, all blue - doublet genetic code with overlap? even blue/red mix - triplet genetic code without overlap? even blue/red mix - triplet genetic code with overlap? even blue/red mix

Consider an image of an mRNA being translated. 1. What is the sequence of the anticodon, from the 3' to 5' end, of the tRNA in the A site? A. UAC B. AUG C. ACG D. UGC 2. What is next amino acid added to the growing polypeptide chain? Use the codon and codon table. A. Cys B. Met C. Tyr D. Thr

1. D. UGC 2. D. Thr

When researchers obtain genomic sequence data from organisms with little known genetic information, they often search for open reading frames (ORFs) to classify potential genes. Suppose scientists have collected the sequence 5′−TAATGCCTAGTACCGGACTGAGTCAGTGTCTA−3′5′−TAATGCCTAGTACCGGACTGAGTCAGTGTCTA−3′ 3′−ATTACGGATCATGGCCTGACTCAGTCACAGAT−5′3′−ATTACGGATCATGGCCTGACTCAGTCACAGAT−5′ Select the reading frame that corresponds to each translational product. You may want to use the Codons table and the Amino Acid Abbreviations table. Stop codons are noted as a dash (-). 1. MPSTGLSQCL? 2. -TLTQSGTRH? 3. RH-LSPVLGI? 4. NA-YRTESVS? 5. -CLVPD-VSV? 6. DTDSVRY-AL? Which reading frame is most likely a part of a larger ORF? A. reading frame one B. reading frame two C. reading frame five D. reading frame three E. reading frame four F. reading frame six

1. MPSTGLSQCL? - reading frame 3 2. -TLTQSGTRH? - reading frame 4 3. RH-LSPVLGI? - reading frame 5 4. NA-YRTESVS? - reading frame 2 5. -CLVPD-VSV? - reading frame 1 6. DTDSVRY-AL? - reading frame 6 D. reading frame three

1. Compare and contrast spliceosomes and ribosomes. Match each description to the correct structure. Spliceosomes? Ribosomes? Both? Answer bank: - composed of RNA and protein components - has catalytic RNA - produces mature mRNA - catalyzes peptide bond formation 2. Why might spliceosomes and ribosomes be so similar? A. Spliceosomes and ribosomes perform the same catalytic reaction. B. Both spliceosomes and ribosomes bind to RNA molecules at the same sequences. C. These structures were both obtained by eukaryotes through the process of horizontal gene transfer. D. The catalytic RNAs of both are thought to have originated when RNA molecules served to store information and catalyze reactions.

1. Spliceosomes: - produces mature mRNA Ribosomes: - catalyzes peptide bond formation Both: - has catalytic RNA - composed of RNA and protein components 2. D. The catalytic RNAs of both are thought to have originated when RNA molecules served to store information and catalyze reactions.

Basepair the codons to the anticodons 3′ GCU 5′, 3' ACC 5′, and 3′ GUU 5′, taking the wobble hypothesis into account. There may be more than one answer choice per anticodon. Not all answer choices will be used. 3' GCU 5'? 3' ACC 5'? 3' GUU 5'?

3' GCU 5'? - 5' CGA 3' - 5' CGG 3' 3' ACC 5'? - 5' UGG 3' 3' GUU 5'? - 5' CAG 3' - 5' CAA 3'

Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Recognition and binding the 3' AAUAAA sequence by specific protein factors 2. Cleavage at the poly(A) site 3. Addition of the 5' cap 4. Export to the cytoplasm 5. Addition of the poly(A) tail

3, 1, 2, 5, 4

Suppose that some cells are grown in culture in the presence of radioactive nucleotides for many generations so that both strands of every DNA molecule include radioactive nucleotides. The cells are then harvested and placed in new medium with nucleotides that are not radioactive so that newly synthesized DNA will not be radioactive. What proportion of DNA molecules will contain radioactivity after two rounds of replication? A. 1/2 B. 0 C. 1/8 D. 1/3 E. 1/4

A. *1/2*

If the sequence of an RNA molecule is 5'-GGCAUCGACG-3', what is the sequence of the non-template strand of DNA? A. 5'-GGCATCGACG-3' B. 3'-GGCATCGACG-5' C. 5'-CCGTAGCTGC-3' D. 3'-CCGTAGCTGC-5' E. 3'-CGTCGATGCC-5'

A. *5'-GGCATCGACG-3'*

What would be the consequence of a mutation in the gene that encodes sigma factor for bacterial transcription? A. The initiation of transcription may begin at random points of the DNA template. B. The RNA polymerase may not be released from the DNA template. C. Transcription may be delayed indefinitely, which may kill the cell. D. The RNA transcript may not be able to dissociate from the DNA template. E. The transcription may end prematurely, resulting in shorter mRNA transcript.

A. *The initiation of transcription may begin at random points of the DNA template.*

What is the function of DNA ligase? A. connects Okazaki fragments by sealing nicks in the sugar-phosphate backbone B. unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork C. reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding D. binds to onC and causes a short section of DNA to unwind E. prevents the formation of secondary structures within single-stranded DNA

A. *connects Okazaki fragments by sealing nicks in the sugar-phosphate backbone*

CRISPR-Cas9 gene editing takes advantage of which feature of prokaryotic crRNA (CRISPR RNA)? A. crRNA's ability to destroy foreign DNA. B. crRNA's ability to be translated into protein. C. crRNA's ability to incorporate amino acids into a polypeptide chain. D. crRNA's ability to inhibit transcription. E. crRNA's ability to inhibit translation.

A. *crRNA's ability to destroy foreign DNA.*

Like DNA Replication, Polymerase Chain Reaction (PCR) requires which of the following components to be conducted? A. dNTPs B. DNA template C. Primers D. DNA Polymerase E. Okazaki Fragments

A. *dNTPs* B. *DNA template* C. *Primers* D. *DNA Polymerase*

What is measured in Svedberg (S) units? A. sizes of the ribosomes and their RNA components B. ages of ribosomes and their RNA components C. densities of ribosomes and their RNA components D. distances of their components

A. *sizes of the ribosomes and their RNA components*

Which process is illustrated in the diagram below? A. transcription B. translation C. RNA processing D. replication E. nucleosome assembly

A. *transcription*

Where are transcription promoters usually located? A. upstream of the start site B. downstream of the start site C. near nucleotide +25 D. near the hairpin loop E. downstream of the terminator

A. *upstream of the start site*

Consider the diagram of the results from a DNA-RNA hybridization expirement for an unknown gene. For this experiment, a mixture of DNA and mRNA has been heated to a point of denaturation & cooled such that the RNA can hybridize, or form a double helix, with DNA that has a complementary nucleotide sequence. A. Using the image, determine the total number of exons contained in the unknown gene. - 6 - 4 - 8 - 7 B. Using the image, determine the total number of introns contained in the unknown gene. - 8 - 7 - 4 - 6

A. - 7 B. -6

An image of ovalbumin gene is portrayed. A. For the full‑length ovalbumin gene shown, where is the most likely location of the 5′5′ untranslated region on the DNA and RNA molecule? - exon 6 - exon 1 - exon 8 - intron 1 - intron 7 B. Where would the 3′3′ untranslated region be located on the DNA and RNA molecule? - exon 1 - intron 7 - exon 6 - intron 1 - exon 8

A. - exon 1 B. - exon 8

The _____ affects the stability of mRNA and helps regulate the translation of the mRNA protein-coding sequence. A. 3' UTR B. 5' UTR C. protein-coding region D. 5' cap

A. 3' UTR

Polyadenylation occurs: A. 3' of the 3' consensus sequence B. 5' of the 5' consensus sequence C. after the mRNA is mature D. 5' of the 3' consensus sequence E. before RNA processing

A. 3' of the 3' consensus sequence

This amino acid sequence is found in a tripeptide: Met-Trp-His. Give a possible nucleotide sequences on the template strand of DNA that can encode this tripeptide. A. 5'-TACACCGTA-3' B. 5'-AUGUGGCAU-3' C. 5'-TACACAGTA-3' D. 3'-AUGUGGCAU-5

A. 5'-TACACCGTA-3'

Which event occurs during eukaryotic translation termination? A. A protein recognizes the stop codon, and the ribosome dissociates from the mRNA. B. The ribosome reaches the end of the mRNA and dissociates, releasing the polypeptide chain. C. Codons in the mRNA are recognized by rRNAs, and tRNAs add the amino acid to the polypeptide chain. D. The small ribosomal subunit binds with a specific tRNA to the mRNA and scans for a start codon. E. A tRNA binds a codon and the ribosome adds amino acids from each tRNA to the polypeptide chain.

A. A protein recognizes the stop codon, and the ribosome dissociates from the mRNA.

According to Ainsworth (2005), approximately 2-5% of cystic fibrosis cases are caused by a mutation that introduces a premature stop codon to the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene, ultimately translating a truncated and non-functional CFTR enzyme. Treatment of this type of cystic fibrosis might involve inducing the ribosome to read through premature stop codons. A drug called PTC124 interferes with the ribosome's ability to correctly read stop codons, inducing the ribosome to insert an amino acid instead of termination translation. A CFTR enzyme with an altered amino acid is not ideal, but may have greater functionality than the truncated form. Therefore, human clinical trails of PTC124 were conducted. Predict if nonsense-mediated mRNA decay (NMD) would be a problem for this treatment. A. No, exon-junction proteins that target mRNA for degradation are removed when the ribosome reads through the premature stop codon. B. Yes, NMD prevents transcription of mRNA that contains a nonsense mutation, the ribosome never has a chance to read through the premature stop codon. C. Yes, PTC124 will also interfere with actual stop codons, resulting in stalled ribosomes that cannot detach from the mRNA molecule. D. No, NMD activates a series of enzymes that terminate translation, recycle stalled ribosomes, and degrade abnormal mRNA. E. No, NMD is a bacterial form of mRNA surveillance, whereas eukaryotes use nonstop mRNA decay and no-go decay to prevent synthesis of truncated proteins.

A. No, exon-junction proteins that target mRNA for degradation are removed when the ribosome reads through the premature stop codon.

Which of the following processes supports the observation that the amino acid sequence of a protein may not be the same as that encoded by its gene? (Select all that apply.) A. RNA editing B. alternative splicing C. multiple 3' cleavage sites D. 5' capping E. errors that occurred during transcription

A. RNA editing B. alternative splicing C. multiple 3' cleavage sites

If pre-mRNA processing fails, which of these can result? A. Translation may not occur. B. Replication may not occur. C. Transcription and translation may not occur. D. Translation and replication may not occur. E. Transcription may not occur.

A. Translation may not occur.

The process of intron splicing involves which of these? A. branch point sequence in the pre-mRNA B. consensus sequence at the 5' end of the pre-mRNA C. poly(A) tail at the 3' end of the mRNA D. promoter at the 5' end of the mRNA E. consensus sequence at the 3' end of the pre-mRNA

A. branch point sequence in the pre-mRNA

Given the figure below, within which of the following would the 5' untranslated region be located? The sequences in red and light gray are included in the mature mRNA. The sequences in light gray make up the protein-coding sequence of the gene. A. exon 1 B. promoter C. exon 4 D. intron 1 E. A 5' untranslated region would not be present in this figure.

A. exon 1

The information needed to edit an RNA molecule correctly is provided by _____ RNA in some cases. A. guide B. ribosomal C. Piwi D. micro

A. guide

Why can alternative splicing of messenger RNAs (mRNAs) be advantageous for eukaryotic organisms? A. increases the variety of proteins that can be produced B. decreases the average gene length in eukaryotes C. splices together introns instead of exons from newly transcribed mRNA D. allows exons from two different genes to be spliced into a new mRNA E. allows for smaller genomes than prokaryotes

A. increases the variety of proteins that can be produced

Which of these is not part of the eukaryotic RNA processing? A. initiation B. ALL are part of RNA processing. C. polyadenylation D. splicing E. 5' capping

A. initiation

Certain amino acids are encoded by more than one codon. The table shows the number of different codons in the second column that encode a particular amino acid. The third column of the table shows the frequency of each amino acid in all protein‑coding regions of DNA for a hypothetical bacterial species. What is the correlation between the number of different codons of an amino acid and the frequency of the amino acid in proteins for this bacteria? A. negative correlation B. perfect correlation C. positive correlation D. no correlation What information would best further the understanding of the relationship between the number of amino acid codons and their frequency in proteins? - the number of bacterial chromosomes - the complete bacterial proteome - the frequencies of each individual codon - the bacterial mRNA transcript sequences

A. negative correlation - the frequencies of each individual codon - the bacterial mRNA transcript sequences

What is the key function of CRISPR-associated proteins or CAS? A. nuclease B. RNA polymerase C. primase D. DNA polymerase E. reverse transcriptase

A. nuclease

All these components are necessary for the initiation of translation in a bacterial cell, EXCEPT: A. release factor 1. B. GTP. C. mRNA. D. small and large ribosomal subunits.

A. release factor 1.

Which one of these amino acids displays a different chemical property of the side chain from the rest? A. serine (S) B. leucine (L) C. alanine (A) D, glycine (G)

A. serine (S)

Which RNA molecules help to cleave and modify eukaryotic rRNAs? A. small nucleolar RNAs (snoRNAs) B. small nuclear RNAs (snRNAs) C. transfer RNAs (tRNAs) D. guide RNAs

A. small nucleolar RNAs (snoRNAs)

RNA editing, alternative splicing, and trans‑splicing complicate the concept of colinearity. Match each process to the statement describing how it complicates colinearity. A. This process joins exons from different mRNA molecules, which creates an amino acid sequence that does not correspond to a single gene. B. This process produces different mRNA molecules from a single gene, which causes a single gene to produce different proteins. C. This process adds nucleotides to the pre-mRNA molecule after transcription, which results in an amino acid sequence that does not directly correspond to the original gene sequence. Answer bank: - RNA editing - trans-splicing - alternative splicing

A. trans-splicing B. alternative splicing C. RNA editing

Suppose that a scientist deletes the AAUAAA consensus sequence, the poly(A) tail, or the 5' cap from pre‑mRNAs in an mRNA. She then observes the effects on RNA regulation. Assign each RNA regulation consequence to the type of deletion most likely to result in the consequence. Answer bank: - The mRNA is not transported to the cytoplasm. - The pre-mRNA is not cleaved at the cleavage site. - Introns are not removed from the pre-mRNA.

AAUAAA deletion: - The pre-mRNA is not cleaved at the cleavage site. Poly (A)-tail deletion: - The mRNA is not transported to the cytoplasm. 5' cap deletion: - Introns are not removed from the pre-mRNA.

Identify the most likely effect of mutation to each part of tRNA(Val), a tRNA for the amino acid valine. Acceptor stem? Anticodon? Any nucleotide that binds valyl-tRNA synthetase? Answer bank: - The tRNA will charge a non-valine amino acid. - The valine codon will change. - Translation will not terminate. - The tRNA will pair with a different codon. - Valine will not bind the tRNA.

Acceptor stem? - Valine will not bind the tRNA. Anticodon? - The tRNA will pair with a different codon. Any nucleotide that binds valyl-tRNA synthetase? - The tRNA will charge a non-valine amino acid.

Each type of pre‑mRNA processing has one or more important functions. Match each function with the appropriate type of processing. Answer bank: - alters nucleotide sequence in exons - stabilizes mRNA at the end adjacent to the start codon - assists in RNA splicing - removes non-coding regions from pre-mRNA - facilitates transport of mRNA into the cytoplasm - constructs multiple products from a single gene - assists mRNA in binding to the large ribosomal subunit

Addition of 5' cap: - stabilizes mRNA at the end adjacent to the start codon - assists in RNA splicing Addition of poly (A) tail: - assists mRNA in binding to the large ribosomal subunit RNA Splicing: - removes non-coding regions from pre-mRNA - facilitates transport of mRNA into the cytoplasm - constructs multiple products from a single gene RNA editing: - alters nucleotide sequence in exons

If the bottom strand of the DNA serves as the template, the amino acid sequence of the protein produced from the RNA would be:

Arg-Val-His

Which of the following is NOT required for transcription? A. ribonucleotides B. RNA primers C. DNA template D. RNA polymerase E. promoter

B. *RNA primers*

Where are Group I introns found? A. tRNA genes of bacteria, archaea, and eukaryotes B. genes of bacteria, bacteriophages, and eukaryotes C. protein-encoding genes in the nucleus of eukaryotes D. genes of bacteria, archaea, and eukaryotic organelles

B. *genes of bacteria, bacteriophages, and eukaryotes*

Which of the following typically only have one origin of replication? A. humans B. prokaryotes C. eukaryotes D. linear model of replication E. plants

B. *prokaryotes*

What is the important reason for understanding and applying CRISPR as a molecular technique? A. CRISPR would allow researchers to replicate the prokaryotic genome more efficiently. B. A potential application of CRISPR is targeted genome editing for gene therapy. C. CRISPR would allow us to understand the complexity of the prokaryotic genome. D. There is no particularly important reason. E. CRISPR would help to minimize foreign invasions in bacteria and archaea.

B. A potential application of CRISPR is targeted genome editing for gene therapy.

Why is a cap added to mRNA, but not to tRNA or rRNA? A. Neither tRNA nor rRNA contain introns. The capping process requires RNA to interact with the proteins that remove introns. Therefore, the capping and splicing processes occur at the same time. B. Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap. C. Transcription and processing of mRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and rRNA are transcribed and processed. D. The double stranded regions on tRNA and mRNA result in complex folding and a three-dimensional shape of each molecule. The structure of tRNA and rRNA makes the 5' end of the molecule inaccessible to the enzymes that add the cap.

B. Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap.

If the 3' consensus sequence were mutated in a particular gene, what effect would you expect on the RNA transcript? A. If the 3' consensus sequence were mutated, the RNA transcript would not be capped. B. If the 3' consensus sequence were mutated, the transcript would not be polyadenylated and would be unstable. C. If the 3' consensus sequence were mutated, splicing would not occur. D. If the 3' consensus sequence were mutated, transcription would not initiate. E. All of the events described would result if the 3' consensus sequence were mutated.

B. If the 3' consensus sequence were mutated, the transcript would not be polyadenylated and would be unstable.

Which statement about bacterial translation is true? A. Amino acids are added to the growing polypeptide chain by a phosphodiester linkage. B. None of the statements are true of bacterial translation. C. Amino acids are added to a growing mRNA molecule. D. Amino acids are added to the 3'‑hydroxyl of the growing polypeptide chain. E. Amino acids are added to the amino group at the end of a growing polypeptide chain.

B. None of the statements are true of bacterial translation.

Which of these is NOT involved in gene silencing using RNA interference? A. RISC B. Splicer C. hairpin D. target mRNA E. Dicer

B. Splicer

Ribosomes and their RNA components are measured in _____ units, which are a measure of how rapidly an object sediments in a centrifugal field. A. Bergstrom B. Svedberg C. Gustafsson D. Holmgren

B. Svedberg

Which of these best describes the first step of intron removal during mRNA processing? A. The 5' and 3' ends of the intron are simultaneously cleaved as the exons flanking the intron are joined. B. The 5' end of the intron is cleaved form the preceding exon and simultaneously joined to the branch point within the intron. C. The 5' end of the intron is cleaved. D. The 3' end of the intron is cleaved from the following exon and simultaneously attached to the branch point within the intron. E. The intron is cleaved at the 3' end with simultaneously joining of the exons flanking the intron.

B. The 5' end of the intron is cleaved form the preceding exon and simultaneously joined to the branch point within the intron.

Which step in mRNA processing occurs first? A. The introns are removed from the primary transcript. B. The 5' end of the primary transcript is capped. C. The primary transcript is cleaved at the 3' end. D. The mRNA transcripts is exported in the cytoplasm. E. Fifty to 250 adenine nucleotides are added to the 3' end of the RNA transcript.

B. The 5' end of the primary transcript is capped.

The experiment by Brenner, Jacob, and Meselson in 1961 demonstrated that rRNA is not the intermediary molecule that transfers genetic information to proteins as previously thought. Which of these statements correctly describes the critical observation that led to disproving rRNA as the intermediary molecule? A. New ribosomes produced after phage infection and new media with light radioisotopes only contained light radioisotopes. B. The ribosomes isolated after switching the phage-infected bacterial cells to grow in a medium containing lighter radioisotope only contained the original heavy radioisotopes (15N and 13C). C. E. coli was able to grow in a medium that contains heavy radioactive isotopes of nitrogen and carbon (15N and 13C). D. After phage infection, phage proteins produced only contain light radioisotopes.

B. The ribosomes isolated after switching the phage-infected bacterial cells to grow in a medium containing lighter radioisotope only contained the original heavy radioisotopes (15N and 13C).

Suppose a geneticist mutates the gene for the poly(A) tail‑binding protein (PABP) in an eukaryotic cell line. The resulting mutant protein cannot bind to poly(A) tails. What is the effect of the PABP mutation in the cultured cells? A. Transcription will not occur in the cultured cells, because PABP is an essential transcription factor. B. Translation will not occur in the cultured cells, because mRNAs will be degraded at a greater rate than normal. C. Translation will occur in the cultured cells, but the resulting polypeptide will be longer than normal. D. Replication will not occur in the cultured cells, because PABP determines the location of the origin of replication. E. Transcription will occur in the cultured cells, but the resulting transcript will be longer than normal.

B. Translation will not occur in the cultured cells, because mRNAs will be degraded at a greater rate than normal.

Which list gives the correct order of events during the elongation stage of translation? A. a tRNA with an amino acid enters the A‑site of the ribosome, the ribosome translocates by three bases on the mRNA, a peptide bond forms between the amino acids B. a tRNA with an amino acid enters the A‑site of the ribosome, a peptide bond forms between the amino acids, the ribosome translocates by three bases on the mRNA C. the ribosome translocates by three bases on the mRNA, a peptide bond forms between the amino acids, a tRNA with an amino acid enters the P‑site of the ribosome D. a peptide bond forms between amino acids, a tRNA with an amino acid enters the P‑site of the ribosome, the ribosome translocates by three bases on the mRNA E. the ribosome translocates by three bases on the mRNA, a peptide bond forms between amino acids, a tRNA with an amino acids enters the A‑site of the ribosome

B. a tRNA with an amino acid enters the A‑site of the ribosome, a peptide bond forms between the amino acids, the ribosome translocates by three bases on the mRNA

Why is the DNA encoding long noncoding RNAs known as "the dark matter of the genome"? A. because the DNA encoding these RNAs is so condensed, it actually appears black B. because no one really knows what the functions of these RNAs are C. because the DNA encoding these RNAs is overly methylated when compared to other DNA segments D. because not all the DNA encoding these RNAs is translated

B. because no one really knows what the functions of these RNAs are

How does RNA interference by microRNA reduce the amount of gene product produced from an mRNA? A. by binding to the promoter of the target mRNA to block its translation B. by the binding of a single-stranded microRNA to an imperfectly complementary sequence in a target mRNA C. none of the choices D. by binding to the DNA template strand to interfere with transcription of the target mRNA E. by the binding of a double-stranded small interfering RNA to its complementary sequence in target mRNA

B. by the binding of a single-stranded microRNA to an imperfectly complementary sequence in a target mRNA

A group of three adjacent nucleotides on an mRNA molecule that specifies a single amino acid of a polypeptide is a(n): A. tripeptide. B. codon. C. anticodon. D. nucleic acid.

B. codon

DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene. The hybridized structure was then observed with an electron microscope. The image is shown. Based on these results, the gene must contain _____ exons and _____ introns. A. four; four B. five; four C. five; five D. four; five

B. five; four

If a gene were arranged like the figure, how many different mRNAs with at least two exons are possible through alternative splicing? A. three B. four C. one D. two

B. four

Consider the diagram. Use the diagram to select the correct statement regarding RNA splicing. A. noncoding exons are edited out and removed B. noncoding introns are edited out and removed C. a string of adenines is put on the 3′ end D. a protective cap is put on the 5′ end

B. noncoding introns are edited out and removed

Which type of RNA molecule is derived from a long single-stranded RNA transcript and is known to suppress the expression and movement of transposons in the animal germ cells? A. snoRNA B. piRNA C. miRNA D. siRNA

B. piRNA

A _____ is a complex structure consisting of several rRNA molecules and many proteins. A. ribonucleoprotein particle B. ribosome C. histone D. protein

B. ribosome

Which type of RNA molecule can accomplish RNA interference by inhibiting transcription and generally is derived from sequences within the genes that it regulates? A. miRNA B. siRNA C. piRNA D. snoRNA

B. siRNA

How is siRNA different than miRNA? A. siRNA molecules target genes from which they were not transcribed. B. siRNA molecules inhibit transcription. C. siRNA molecules degrade mRNA. D. siRNA molecules are longer.

B. siRNA molecules inhibit transcription.

Which one of the following statements regarding eukaryotic transcription is NOT true? A. Eukaryotic transcription involves a core promoter and a regulatory promoter. B. There is no one generic promoter. C. A group of genes is transcribed into a polycistronic RNA. D. Chromatin remodeling is necessary before certain genes are transcribed. E. There are several different types of RNA polymerase.

C. *A group of genes is transcribed into a polycistronic RNA.*

Which of the following statements is TRUE regarding transcription in most organisms? A. All genes are transcribed from the same strand of DNA. B. Both DNA strands are used to transcribe a single gene. C. Different genes may be transcribed from different strands of DNA. D. The DNA template strand is used to encode double-stranded RNA. E. The DNA non-template strand is used to encode single-stranded RNA.

C. *Different genes may be transcribed from different strands of DNA.*

Telomerase activity is MOST likely to be found in which cells in humans? A. red blood cells B. muscle cells C. germ line cells D. neurons E. somatic cells

C. *germ line cells*

What is the function of topoisomerases such as DNA gyrase? A. connects Okazaki fragments by sealing nicks in the sugar-phosphate backbone B. unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork C. reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding D. binds to onC and causes a short section of DNA to unwind E. prevents the formation of secondary structures within single-stranded DNA

C. *reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding*

Which of these structures is NOT found on a tRNA molecule? A. The TΨC arm B. rare modified bases C. 5' UTR D. (CCA) at the 3' end

C. 5' UTR

What is the specific nucleotide sequence required for amino acid attachment at the 3' end of tRNA? A. 5'-GCA-3' B. 5'-AGA-3' C. 5'-CCA-3' D. 5'-ACC-3'

C. 5'-CCA-3'

What effect on the transcript would you expect if a eukaryotic gene underwent a two base pair deletion at the 5' end of an intron? A. A two base par deletion at the 5' end of an intron would prematurely end transcription of the gene. B. A two base pair deletion at the 5' end of an intron would not be expected to have any effect on the resulting transcript. C. A two base pair deletion at the 5' end of an intron would most likely prevent the normal splicing of this intron. D. A two base pair deletion at the 5' end of an intron would destabilize the mRNA. E. A two base pair deletion at the 5' end of an intron would prevent cleavage and polyadenylation at the 3' end.

C. A two base pair deletion at the 5' end of an intron would most likely prevent the normal splicing of this intron.

_____, which are numerous in some cells, may serve as decoys for miRNAs. A. CRISPR RNAs B. Enhancer RNAs (eRNAs) C. Circular noncoding RNAs D. Long noncoding RNAs

C. Circular noncoding RNAs

What occurs during the acquisition stage of the CRISPR-Cas system? A. Foreign DNA from the same bacteriophage or plasmid enters the cell again. B. The CRISPR array is transcribed into a long CRISPR precursor RNA. C. Fragments of phage DNA are inserted into the bacterial CRISPR array. D. Double-stranded RNA from viruses or long hairpins is cleaved by Dicer.

C. Fragments of phage DNA are inserted into the bacterial CRISPR array.

Which statement about termination of bacterial translation is false? A. It occurs when a stop codon enters the A-site of a ribosome. B. It requires a release factor. C. It requires a termination sequence. D. All of the statements are true. E. It results in the ribosome dissociating from the mRNA.

C. It requires a termination sequence.

The sequence is a hypothetical segment of a DNA with an indicated mutation represented by an arrow. What is the outcome of this mutation with regard to the ultimate protein that will form from this sequence? A. The corresponding amino acid is not altered. The protein will be unchanged. B. An alternative splice site is formed. Two proteins of different lengths will be produced. C. Nothing. This is a silent mutation. The protein will be unchanged. D. This is a nonsense mutation. The protein will be truncated early and likely be nonfunctional.

C. Nothing. This is a silent mutation. The protein will be unchanged.

siRNAs and miRNAs function in which of the following processes? A. transcription B. translation C. RNA interference D. RNA editing E. RNA splicing

C. RNA interference

Cleavage and polyadenylation of the 3' end of pre‑mRNA is a posttranscriptional modification common to most protein‑coding mRNA. It facilitates binding to ribosomes for translation, stabilizes the mRNA molecule, and prevents its degradation by exonucleases. Using recombinant DNA techniques, any gene that has a promoter for RNA polymerase II can instead be connected to a promoter for RNA polymerase I. This hybrid gene is transcribed by RNA polymerase I, but the transcript does not undergo 3' cleavage and polyadenylation. Explain why the hybrid gene mRNA transcript does not undergo 3' cleavage and polyadenylation. A. Recombinant DNA techniques cause premature stop codons that prevent 3'‑end transcription and processing. B. Regulatory factors for RNA polymerase I prevent 3' cleavage and polyadenylation. C. Regulatory factors must first associate with RNA polymerase II before 3' cleavage and polyadenylation. D. Protein‑coding genes have a consensus sequence that interferes with RNA polymerase I and proteins involved in polyadenylation. E. RNA polymerase II binds to the 3' end and prevents processing by RNA polymerase I.

C. Regulatory factors must first associate with RNA polymerase II before 3' cleavage and polyadenylation.

Bacterial genes are said to be collinear. What does this mean? A. The number of nucleotides in a gene is not proportional to the number of amino acids in the protein encoded by that gene. B. The number of nucleotides in a gene is far greater, proportionally, than the number of amino acids in the protein encoded by that gene. C. The number of nucleotides in a gene should be proportional to the number of amino acids in the protein encoded by that gene. D. The number of nucleotides in a gene is far fewer, proportionally, than the number of amino acids in the protein encoded by that gene.

C. The number of nucleotides in a gene should be proportional to the number of amino acids in the protein encoded by that gene.

How would the deletion of the Shine-Dalgarno sequence affect a bacterial mRNA? A. DNA replication would not occur. B. Transcription would not occur. C. Translation would not occur. D. Translation would occur at a slower rate. E. Transcription would occur at a slower rate.

C. Translation would not occur.

The part of the tRNA molecule that hydrogen bonds to the codon on an mRNA in a ribosome is called the: A. reverse codon. B. attachment site. C. anticodon. D. codon binding site. E. decoder.

C. anticodon.

Which of these best describes the consensus sites required for splicing introns during pre-mRNA processing? A. consensus sequences at the 5' splice site and 3' splice site of the intron B. consensus sequences at the 5' and 3' splice sites as well as a branch point consensus sequence within the preceding exon C. consensus sequences at the 5' and 3' splice sites as well as a branch point consensus sequence within the intron D. consensus sequences at the 5' and 3' splice sites as well as a branch point consensus sequence within the following exon E. consensus sequences at the 5' and 3' ends of the pre-mRNA

C. consensus sequences at the 5' and 3' splice sites as well as a branch point consensus sequence within the intron

What is the source of the unique sequences found in CRISPR? A. miRNAs B. transcription C. foreign invading DNA D. DNA replication E. reverse transcription

C. foreign invading DNA

CRISPR RNAs in bacteria function like what system in the human body? A. circulatory system B. nervous system C. immune system D. skeletal system

C. immune system

You discover a new RNA in the cell you are studying. It is 1200 base pairs in length, does not contain a start or stop codon, and has several protein binding motifs. What type of RNA have you likely identified? A. tRNA B. miRNA C. lncRNA D. snoRNA

C. lncRNA

Most eukaryotic mRNA molecules contain a _____, consisting of 50 to 250 adenine nucleotides at the 3' end. A. polyphosphate structure B. histone C. polyadenine tail D. 7-methylguanine

C. polyadenine tail

In this mRNA sequence, which is the correct reading frame? 5'-GAUGGGUAGUUGA-3' A. fourth reading frame B. first reading frame C. second reading frame D. third reading frame

C. second reading frame

Which of the following statements is TRUE regarding nucleosome formation during DNA replication? A. Nucleosomes are only reassembled on the lagging strand. B. Nucleosome assembly consists entirely of newly synthesized histones. C. Nucleosome assembly occurs at a faster rate in prokaryotes than in eukaryotes. D. The addition of newly synthesized histones is a part of nucleosome assembly. E. Nucleosome assembly does not occur during semiconservative replication.

D. *The addition of newly synthesized histones is a part of nucleosome assembly.*

What type of synthesis occurs on a lagging strand? A. conservative B. dispersive C. continuous D. discontinuous E. recombinant

D. *discontinuous*

In a transcription reaction, two phosphate groups are cleaved from the incoming: A. deoxyribonucleoside diphosphate (dNDP) B. deoxyribonucleoside triphosphate (dNTP) C. ribonucleoside diphosphate (rNDP) D. ribonucleoside triphosphate (rNTP) E. ribozyme

D. *ribonucleoside triphosphate (rNTP)*

Whereas the nucleotide strand used for transcription is termed the ___________, the non-transcribed strand is called the ____________. A. promoter; terminator B. terminator; promoter C. transcription apparatus; TATA box D. template strand; non-template strand E. non-template strand; template strand

D. *template strand; non-template strand*

During tRNA charging, an amino acid binds to the _____ end of tRNA. A. promoter B. UTR C. 5' D. 3'

D. 3'

Mutations in a sequence of DNA can result in what type of change to a polypeptide chain? A. a polypeptide chain being longer than it is supposed to be B. one amino acid being replaced by a different amino acid C. a polypeptide chain being shorter than it is supposed to be D. All of the changes can result from mutation. E. many amino acids being replaced by different amino acids

D. All of the changes can result from mutation.

What effect might you expect in a eukaryotic organism in which an enzyme essential for adding the 5' cap to RNA polymerase II transcripts was nonfunctional? A. The organism would be unable to produce stable mRNA transcripts. B. The organism would be unable to efficiently splice RNA transcripts. C. The organism's ribosomes would not efficiently recognize mRNA transcripts produced. D. All of the statements will result from nonfunctional mRNA capping.

D. All of the statements will result from nonfunctional mRNA capping.

How do the nucleus and ribosomes work together to generate a protein? A. Ribosomes produce mRNA that migrates into the nucleus and uses a gene in the DNA as instructions to synthesize a specific protein. B. A specific gene breaks away from the DNA and exits the nucleus, allowing the ribosomes to use the gene as instructions to synthesize a protein. C. Ribosomes migrate into the nucleus, attach to a gene in the DNA, and use the gene as a transcript to synthesize a specific protein. D. In the nucleus, an mRNA copy of a gene is produced, which ribosomes use as instructions to synthesize a specific protein.

D. In the nucleus, an mRNA copy of a gene is produced, which ribosomes use as instructions to synthesize a specific protein.

In the initiation of translation in bacteria, what pair binding is CORRECT? A. The initiator tRNA codon binds to the mRNA anticodon. B. mRNA binds to the large ribosomal subunit. C. Initiation factor 2 binds to ATP. D. Initiation factor 3 binds to the small ribosomal subunit.

D. Initiation factor 3 binds to the small ribosomal subunit.

A key modification in the 3' end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail? A. The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail. B. The poly(A) tail facilitates the attachment of the ribosome to the mRNA. C. The poly(A) tail is important for proper nuclear export of the mRNA. D. The poly(A) tail at the 3' end translates to a long stretch of repeated amino acids. E. Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.

D. The poly(A) tail at the 3' end translates to a long stretch of repeated amino acids.

In your bacterial translation experiment, you notice that you keep producing proteins with incorrect amino acids, based on the sequence of the mRNA. What is one possible reason you are seeing this? A. There are not enough tRNA molecules in your reaction. B. The original DNA sequence has mutations in it. C. The mRNA is mutating before it is translated by the ribosome. D. The ribosome you are using is defective in its proofreading function.

D. The ribosome you are using is defective in its proofreading function.

Which one of the following codons codes for a different amino acid from the rest? A. CUU B. CUC C. UUA D. UUU E. CUA

D. UUU

What are the two subunits of a functional ribosome? A. two large subunits B. two small subunits C. a thin and a thick D. a large and a small subunit

D. a large and a small subunit

Inverted repeats in _________ cause(s) the formation of hairpin loops. A. target gene RNA sequences B. a macroRNA sequence C. an intergering gene sequence D. a microRNA sequence E. an mRNA sequence

D. a microRNA sequence

RNA interference is involved in which of these? A. immune response to viruses B. none of the choices C. limiting spread of transposons D. all of the choices E. silencing genes after they have been transcribed

D. all of the choices

When studying a plant's protein production, a scientist found two different proteins. The first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one only contained amino acids from exons from 1, 2, and 3. Which of the following is MOST likely responsible for this difference? A. a mutation in the gene that encodes an miRNA B. post-translational modification C. RNA editing D. alternative RNA processing E. a mutation in the gene that encodes a snoRNA

D. alternative RNA processing

All of these amino acids have a positively charged R group EXCEPT: A. arginine. B. histidine. C. lysine. D. aspartate.

D. aspartate.

_____ lack an open reading frame—a sequence with a start and a stop codon that is translated into a protein. A. tRNAs B. miRNAs C. snRNAs D. lncRNAs

D. lncRNAs

What essential role is played by the NORAD lncRNA? A. plays a central role in dosage compensation in mammalian cells B. prevents the miRNAs from attaching to and inhibits the translation of mRNAs C. regulates the expression of protein-encoding genes D. maintains chromosome stability in mammalian cells

D. maintains chromosome stability in mammalian cells

CRISPR consists of a series of _____ sequences that read the same forward and backward on two complementary strands, separated by unique sequences. A. complementary B. repetitive C. unique D. palindromic E. pseudogenic

D. palindromic

Which description applies to alternative mRNA splicing? A. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand B. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns C. heritable changes in gene expression that occur without altering the DNA sequence D. processing of exons in mRNA that results in a single gene coding for multiple proteins E. protein modifications such as addition of a functional group or structural changes such as folding

D. processing of exons in mRNA that results in a single gene coding for multiple proteins

Which step in termination requires energy? A. the translation of the 3' UTR of the mRNA B. the release of the polypeptide chain from the ribosome C. the binding of release factor 1 to a termination codon D. release factor 3 causing a conformational change in the ribosome that causes the tRNA in the P site to shift to the E site

D. release factor 3 causing a conformational change in the ribosome that causes the tRNA in the P site to shift to the E site

When a(n) ____ in RISC binds to a target mRNA, there is no gene product, but when a(n) in RISC binds to a target mRNA, there is less gene product than normal. A. microRNA; siRNA B. inRNA; microRNA C. inRNA; siRNA D. siRNA; microRNA E. microRNA; inRNA

D. siRNA; microRNA

All of these ribosomal RNA components are produced from cleavage of the 30S rRNA precursor, EXCEPT: A. 23S rRNA. B. 16S rRNA. C. tRNA. D. snoRNAs.

D. snoRNAs.

Transfer RNAs are processed by all EXCEPT: A. methylation B. cleavage C. trimming D. splicing

D. splicing

In which type of RNA do rare modified bases occur including ribothymidine, pseudouridine, and dozens of others? A. pre-mRNA B. snRNA C. mRNA D. tRNA

D. tRNA

The structure of tRNA described as L-shaped is the _____ structure. A. primary B. quaternary C. secondary D. tertiary

D. tertiary

In eukaryotic gene regulation, RNA interference occurs through: A. the accumulation of mRNA that blocks transcription of the target gene by feedback inhibition. B. the action of RNA-protein complexes that inhibit translation by altering the three dimensional configuration of rRNA molecules. C. the accumulation of mRNA that blocks transcription of nearby genes. D. the action of small interfering RNAs that mediate the degradation of complementary mRNA molecules.

D. the action of small interfering RNAs that mediate the degradation of complementary mRNA molecules.

RNA-induced silencing complex (RISC) facilitates: A. the actual degradation of target mRNA. B. the cleavage of double stranded RNA. C. removal of the miRNA hairpin. D. the binding of target mRNA to siRNA or miRNA.

D. the binding of target mRNA to siRNA or miRNA.

The adapter molecule that serves as a link between the genetic code in mRNA and the amino acids that make up a protein is _____ RNA. A. messenger B. small nuclear C. Piwi D. transfer

D. transfer

At least ___ genes encode components of the RNA interference machinery that silences other genes. A. 1 B. 3 C. 2 D. 6 E. 4

E. 4

If a eukaryotic gene undergoes a single base pair substitution in the middle of an exon, what effect would you expect on the transcript of that gene? A. A single base pair substitution in an exon will destabilize the mRNA transcript. B. A single base pair substitution in an exon will prevent mRNA capping. C. All of the events described will result from a single base pair substitution within an exon. D. A single base pair substitution in an exon will almost always disrupt pre-mRNA splicing. E. A single base pair substitution in an exon would be unlikely to affect the transcript unless it created a new splice consensus site.

E. A single base pair substitution in an exon would be unlikely to affect the transcript unless it created a new splice consensus site.

The mature, processed transcript (mRNA) consists of all of these except the: A. 3' consensus sequence and poly A tail B. 5' untranslated sequences C. exons D. 5' cap E. All are part of the mature transcript

E. All are part of the mature transcript

Napoli et al. (1990) produced genetically‑modified petunias by inserting numerous copies of the petunia CHS gene into individual genomes. CHS codes for a key enzyme in the synthesis of anthocyanin, a pigment that produces light purple petals in wild type petunias. The investigators hypothesized that additional copies of CHS would increase expression of anthocyanin, producing a phenotype of dark purple petals. Unexpectedly, 42% of modified plants yielded petals that were white or white with patches of purple. Contrary to initial predictions, results showed that overexpression of CHS had silenced expression of CHS. Select the best explanation for how overexpression of CHS silences expression of CHS. A. CHS overexpression induces mutation in the promoter, which decreases template affinity for RNA polymerase and prevents transcription of CHS. B. CHS overexpression induces addition of 5' caps and 3' poly(A) tails to mRNA molecules, modifications which prevent ribosomes from binding to the mRNA. C. CHS overexpression interferes with tRNA secondary structure formation, preventing amino acid incorporation into protein products by ribosomes. D. CHS overexpression causes formation of CHS introns, which interfere with translation by forming double-stranded molecules with tRNA molecules. E. CHS overexpression increases concentration of CHS mRNA in the cytosol, which activates an RNA-induced silencing complex that degrades mRNA or suppresses its translation.

E. CHS overexpression increases concentration of CHS mRNA in the cytosol, which activates an RNA-induced silencing complex that degrades mRNA or suppresses its translation.

During bacterial translation, initiation occurs in three steps. Which step is last? A. The small ribosomal subunit binds to the mRNA. B. The large and small ribosomal subunits bind to each other. C. The ribosome finds the start codon on a piece of mRNA. D. The initiator tRNA binds to the start codon. E. The large ribosomal subunit binds to the mRNA.

E. The large ribosomal subunit binds to the mRNA.

What is the function of the spliceosome? A. The spliceosome removes the Shine-Delgarno sequence from the 5' end of the mRNA. B. The spliceosome transcribes ribosomal RNA and transfer RNA genes. C. The spliceosome adds a stretch of about 180 adenine nucleotides to the 3' end of the mRNA. D. The spliceosome adds a 7-methylguanosine residue to the 5' end of the mRNA. E. The spliceosome removes the introns and joins the exons to form the mature transcript.

E. The spliceosome removes the introns and joins the exons to form the mature transcript.

Which of the following statements describes the "wobble" rules CORRECTLY? A. There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. B. The number of the genetic code exceeds the number of amino acids available in the cell. C. There are multiple tRNAs that may bind to the same amino acids. D. There are multiple codons that may code for the same amino acids. E. The third base pairing between the tRNA and mRNA is relaxed.

E. The third base pairing between the tRNA and mRNA is relaxed.

Translation is the process of: A. making mRNA from a DNA template. B. assembling amino acids into nucleotides. C. making protein from a DNA template. D. assembling nucleotides into DNA. E. assembling amino acids into proteins.

E. assembling amino acids into proteins.

What is the primary role of CRISPR? A. generating alternative genetic mechanism for genome replication B. generating mechanism equivalent to reverse transcription C. generating alternative versions of prokaryotic proteins D. protecting prokaryotes from eukaryotic predators E. generating adaptive immune system against foreign invaders

E. generating adaptive immune system against foreign invaders

George Beadle and Edward Tatum used mutant strains of Neurospora to formulate the one-gene-one-enzyme hypothesis. Researchers later updated this hypothesis to propose that one gene encodes one polypeptide because proteins can have multiple subunits. Consider a heterotrimeric protein with all unique subunits. How many genes are required to form this protein? A. four B. one C. six D. two E. three

E. three

Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? [Earliest encountered to Latest encountered] Answer bank: - start codon - 3' UTR - splice acceptor site - promoter - translation termination codon - 5' UTR

Earliest encountered to Latest encountered: - promoter - 5' UTR - start codon - splice acceptor site - translation termination codon - 3' UTR

Suppose an assassin uses abrin, a translation inhibitor, to poison her victim. Place the events in chronological order, starting from the poisoning and ending with the death of the victim. First: [GIVEN] Abrin enters the victim's body. Last: [GIVEN] The victim dies. Answer bank: - Abrin binds to ribosomes in the cytoplasm. - Ribosomes are unable to add new amino acids to polypeptides. - Multiple organ systems fail. - Abrin is absorbed into the blood and enters the body's cells. - Abrin inactivates the peptide transferase in the large subunit of the ribosome. - Protein synthesis halts in many tissues.

First: [GIVEN] - Abrin enters the victim's body. - Abrin is absorbed into the blood and enters the body's cells. - Abrin binds to ribosomes in the cytoplasm. - Abrin inactivates the peptide transferase in the large subunit of the ribosome. - Ribosomes are unable to add new amino acids to polypeptides. - Protein synthesis halts in many tissues. - Multiple organ systems fail. Last: [GIVEN] - The victim dies.

Classify each description as true of introns only, true of exons only, or true of both introns and exons. Answer bank: - code for a protein - generally absent from bacterial genomes - present in the DNA used as the template for transcription - present in eukaryotic genomes - part of the final mRNA strand - removed from initial mRNA strand

Introns only: - generally absent from bacterial genomes - removed from initial mRNA strand prior to translation Exons only: - code for a protein - part of the final mRNA strand Both introns & exons: - present in the DNA used as the template for transcription - present in eukaryotic genomes

Which part is responsible for the unique properties of each amino acid?

R group

The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase or term as relating to replication, transcription, or translation. Replication? Transcription? Translation? Answer bank: - DNA polymerase - requires tRNA - single DNA strand is used to produce mRNA - ribosome - amino acids added to peptide chain - described as semi-conservative - both DNA strands are duplicated

Replication: - both DNA strands are duplicated - described as semi-conservative - DNA polymerase Transcription: - single DNA strand is used to produce mRNA Translation: - amino acids added to peptide chain - requires tRNA - ribosome

Determine the process most immediately affected by the deletion of each sequence. Replication? Transcription? RNA processing? Translation? Answer bank: - -10 consensus - terminator - AAUAAA consensus - 3' splice site consensus - start codon - Shine-Dalgarno consensus - ori site

Replication: - ori site Transcription: - terminator - -10 consensus RNA processing: - 3' splice site consensus - AAUAAA consensus Translation: - start codon - Shine-Dalgarno consensus

Identify which statements apply to the ribosome, RNA polymerase II, or both in eukaryotic cells. Answer bank: - is used in translation - has protein components - is used in transcription - made of two RNA-protein subunits - found in the nucleus - found in the cytoplasm

Ribosome: - is used in translation - made of two RNA-protein subunits - found in the cytoplasm RNA polymerase II: - found in the nucleus - is used in transcription Both: - has protein components

The nucleotide sequence 5' ...GGAGCUCGUUGUAUU... 3' is changed to 5' GGAG*A*CUCGUUGUAUU 3' due to an insertion of an 'A.' Why does or why doesn't the amino acid sequence change?

The reading frame changes after the mutation (the addition of an A in the fifth position) and so the amino acid sequence is modified after that point.

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. Answer bank: - In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. - Splicing occurs while the mRNA is still in the nucleus. - Splicing occurs while the mRNA is attached to the nucleosome. - Splicing of mRNA does not involve any proteins. - One mRNA can sometimes code for more than one protein by splicing at alternative sites.

True statements: - In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. - Splicing occurs while the mRNA is still in the nucleus. - One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements: - Splicing occurs while the mRNA is attached to the nucleosome. - Splicing of mRNA does not involve any proteins.

Place the events that take place during translation and protein synthesis in the correct order. Answer bank: - The smaller subunit of the ribosome attaches to the mRNA strand and moves along it. - Once the amino acids have been removed from the tRNA molecules, the tRNAs leave the ribosome. - New amino acids are added to the polypeptide chain by the ribosome. - The anticodon of a tRNA molecule carrying an amino acid matches with the complementary codon on the mRNA strand.

[First event to Last event:] - The smaller subunit of the ribosome attaches to the mRNA strand and moves along it. - The anticodon of a tRNA molecule carrying an amino acid matches with the complementary codon on the mRNA strand. - New amino acids are added to the polypeptide chain by the ribosome. - Once the amino acids have been removed from the tRNA molecules, the tRNAs leave the ribosome.

Arrange the components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis, from first to last. Answer bank: - fMet-tRNA - elongation factor Tu - 70S initiation complex - 30S initiation complex - initiation factor 3 - release factor 1 - elongation factor G

[First to Last:] - fMet-tRNA - initiation factor 3 - 30S initiation complex - 70S initiation complex - elongation factor Tu - elongation factor G - release factor 1

Use the Transcription Translation interactive to answer the question. Arrange the amino acids coded for in the translation portion of the transcription translation interactive in the correct order, starting with the first amino acid at the top. Answer bank: - arginine - glycine - glutamine - methionine - histidine - threonine - leucine

[Start to Stop:] - methionine - threonine - glutamine - arginine - leucine - histidine - glycine

The genetic code is NOT universal for:

a few mitochondrial genes, which substitute one sense codon for another.

During elongation, an incoming charged tRNA enters at the ________ site of the ribosome.

aminoacyl (A)

The 5' and 3' untranslated regions (UTRs) of processed mRNA molecules are derived from:

exons

The spliceosome is a large, ribonucleoprotein complex located in the: (i.e., where does mRNA splicing occur?)

nucleus

Using the codon table, determine the number of unique RNA sequences that encode the polypeptide methionine-alanine-tyrosine. Include start and stop codons as appropriate. number of RNA sequences?

number of RNA sequences: 24

How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met‑Leu‑Arg? Include the stop codon in the mRNA sequence. Use the codon table to identify the codons. number of mRNA sequences?

number of mRNA sequences: 108

The amino acid sequence of a polypeptide is referred to as the ___________ sequence of the polypeptide.

primary

Which of the following elements would NOT be found in an mRNA molecule? A. protein-coding region B. 3' untranslated region C. 5' untranslated region D. promoter E. start and stop codons

promoter

The genetic code is said to be "degenerate" because:

some codons specify more than one amino acid.

Translating an mRNA requires two other types of RNA:

tRNA and rRNA

During translation, the cell recycles ________ when they are recharged and can reuse ________ multiple times when a polyribosome complex forms.

tRNAs; mRNAs

How many introns are present on a gene that consists of four exons and is known to have introns?

three

A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. 5' CCATGCACCAGATCGCTTATTAAAT 3' 3' GGTACGTGGTCTAGCGAATAATTTA 5' total number of ORFs?

total number of ORFs: 1