Cell Bio Exam 3
Which of the following DNA strands can form a DNA duplex by pairing with itself at each position?
5'-AAGCGCTT-3' (opp. pairing bases code for same sequence backwards)
What DNA sequence is repeated in human telomeres?
5'-TTAAGGG-3'
You have a piece of DNA that includes the following sequence: 5′-ATAGGCATTCGATCCGGATAGCAT-3′ 3′-TATCCGTAAGCTAGGCCTATCGTA-5′ Which of the following RNA molecules could be transcribed from this piece of DNA?
5′-AUAGGCAUUCGAUCCGGAUAGCAU-3′
Which eukaryotic RNA polymerase is responsible for the synthesis of most rRNAs?
RNA polymerase I
What family of G-proteins determines the specificity of interaction of vesicles with the correct target membrane?
Rabs
Which of the following eukaryotic pre-initiation complex factors is NOT correctly paired with its function?
TFIIB: Helps recruit RNA polII to the complex, similar to sigma factor in prokaryotic transcription
Inner membrane mitochondrial proteins use this complex during transport from the cytosol.
TOM complex and TIM22 complex (Ans: A and B)
What do you predict would happen if you replace the Lac operator DNA from the Lac operon with the DNA from the operator region from the tryptophan operon?
The Lac operon will not be transcribed when tryptophan levels are high
To mark proteins that will be degraded through the proteasome, what modification occurs to the protein?
Ubiquitination of the lysine residues
In the fusion event between vesicle and target membranes, _____________ found in the target membrane interact with ___________ found on vesicles to pull the two lipid bilayers together.
tSNAREs; vSNAREs
In terms of eukaryotic DNA fractions, satellite DNAs are found in the ________ fraction and histone genes are found in the ________ fraction.
highly repeated; moderately repeated
Which eukaryotic RNA polymerase is responsible for the synthesis of most mRNAs?
RNA polymerase II
The DNA from two different species can often be distinguished by a difference in the:
Ratio of A+T to G+C
Which of the following is NOT true concerning transcription factor motifs?
The HLH motif has two B-pleated sheets separated by a loop
All of the following concerning protein translation are true except:
The Kozak sequence is used in bacteria to locate the correct initiation codon. The Shine-Dalgarno sequence is used in eukaryotic cells to located the correct initiation codon
In Drosophila, the cytoplasmic localization of bicoid and oskar transcripts to determine the correct development of the anterior-posterior axis is an example of:
Translational-level control
Regulation of ferritin to help detoxify the presence of intracellular iron is an example of:
Translational-level control
Which of the following eukaryotic pre-initiation complex factors recognizes the promoter TATA box?
TFIID
RNA-RNA hybridization is involved an all of the following processes except:
(Ans: all of the above are reliant on RNA-RNA hybridization) Secondary structure formation in rRNAs and tRNAs Recognition of Shine-Delgarno sequence in bacterial mRNAs Recognition of 5' and 3' hnRNA splicing sites by the spliceosome Correct tRNA association with mRNA codons during translation
Mitochondrial matrix proteins use this complex during transport from the cytosol
(Ans: A and C) TOM complex; TIM23 complex
All of the following concerning the human genome are true except:
(Ans: All of the above are true) Gene duplication may arise from unequal crossing over, and leads to evolution of multigene families Trinucleotide repeat expansion diseases can occur in introns, coding exons, and untranslated regions (UTRs) The human genome consists of around 20,000 genes The most common type of genetic variability in humans is from single nucleotide differences
RNA-RNA hybridization is involved in all of the following processes except:
(Ans: all of the above are reliant upon RNA-RNA hybridization) Secondary structure formation in rRNAs and tRNAs Recognition of Shine-Dalgarno sequence in bacterial mRNAs Recognition of 5' and 3' hnRNA splicing sites by the spliceosome Correct tRNS association with mRNA codons during translation
With respect to genome structure and stability, all of the following statements are true except:
(Ans: all of the above are true) Genome complexity in terms of size can be determined from DNA renaturation Gene families are represented in the non-repeated fraction of eukaryotic DNA Retrotransposons have an RNA intermediate and require reverse transcriptase Movement of transposons require the enzyme transposase
Which of the following is NOT true concerning transcription factor motifs? (All ans are true)
(Ans: all of the above are true) The leucine zipper motif has a leucine at every 7th amino acid of an a-helix The HLH motif has two a-helical segments separated by a loop The zinc finger motif has zinc ions held in place by 2 cysteines and 2 histidines The leucine zipper and HLH motifs can have basic amino acid regions that interact with DNA
Which of the following statements concerning human diseases is not correct?
(Ans: all of the above statements are correct) Progeria is linked to mutations in the lamin A/C gene Tay-Sachs disease is a type of lysosomal storage disease Huntington's disease is based on a trinucleotide repeat expansion miRNA's are linked to the development of cancer
If you want to engineer a cytoplasmic protein to become a nuclear protein, which of the following amino acid sequences would you need to add?
A Lys-Lys-Lys-Lys-Lys sequence to its N-terminus
If you want to engineer a cytoplasmic protein to become a resident RER protein, which of the following amino acid sequences would you need to add?
A signal sequence to its N-terminus and a KDEL sequence to its C-terminus
Adaptor molecules are essential for the assembly of clathrin-coated vesicles. The adaptor protein ________ is the essential adaptor used in the endocytic pathway, while ______ is important for those vesicles to be formed at the trans Golgi network.
AP2; GGA
What GTP-binding protein plays a regulatory role in the formation and disassembly of the COPI coat?
ARF1
Amino Acids are charged onto their respective t-RNAs through the activity of:
Aminoacyl-tRNA synthetases
During translation initiation, which initiation factor is a GTP-binding protein required for attachment of the first aminoacyl-tRNA?
Ans: B and D IF2 and eIF2
What biological process involves surrounding internal organelles like mitochondria with a double membrane for subsequent degradation through the lysosome?
Autophagy
In terms of DNA structure and composition, which of the following is true?
Bases are found on the inside of the DNA helix Nucleotides of a DNA strand are linked by 3',5'-phosphodiester bonds DNA strands of the double helix run anti-parallel to each other C and G pair w/ 3 hydrogen bonds
How are most eukaryotic transcription regulators able to affect transcription when their binding sites in enhancers are far from the promoter?
By looping out the intervening DNA between their binding site and the promoter
Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble?
CAC and CAU
______ vesicles move materials from the ER "forward" to the ERGIC and Golgi complex, while _______ move materials from the ERGIC and Golgi "backward" towards the ER.
COPII-coated; COPI-coated
An example of constitutive heterochromatin would be ______________
Centromeres Telomeres (Ans: A and B)
Which of the following statements is true?
Chaperone proteins in the mitochondria matrix facilitate the movement of proteins across the outer and inner mitochondrial membranes.
Which of the following is NOT associated with mRNA stability and degradation?
Chaperones
What technique is used to determine DNA binding sites for transcription factors genome-wide?
Chromatin immunoprecipitation
______ vesicles internalize materials from the plasma membrane via receptor-mediated endocytosis, while _______ move materials from the Golgi towards the RER.
Clathrin-coated; COPI-coated
In terms of DNA structure and composition, which of the following is not true?
Contain the purines A and C, and pyrimidines G and T
DNA methylation to maintain DNA silencing generally occurs at which base?
Cytosine
Which enzymes or complexes are NOT associated with mRNA stability and degradation?
Deadenylase Decapping enzyme 5'-3- exonuclease Exosome (Ans: all of the above)
Which of the following is true about the glycosylation of proteins in the ER?
Dolichol phosphate serves as a lipid carrier Carbohydrates are added to the lipid carrier by glycosyltransferases. Asn-X-Ser/Thr serves as the glycosylation site on the protein. Oligosaccaryltransferase links the NAG 'base' of the oligosaccharide to the protein.
You are a virologist interested in studying the evolution of viral genomes. You are studying two newly isolated viral strains and have sequenced their genomes. You find that the genome of strain 1 contains 25% A, 45% G, 20% C, and 10% T. You report that you have isolated a virus with a single-stranded DNA genome. Based on what evidence can you make this conclusion?
Double-stranded genomes have equal amounts of A and T
Which G protein mediates the release of clathrin-coated vesicles from the plasma membrane during recpetor-mediated endocytosis?
Dynamin
During eukaryotic pre-mRNA processing, which enzymes are involved in modification of the 3' end?
Endonuclease and polyA polymerase
Which of the following statements concerning endocytosis and phagocytosis is INCORRECT?
Engulfment of particles by phagocytosis is driven by microtubule formation in the cell
Which region of the nucleolus is associated with the location of DNA?
Fibrillar center
Consider two genes that are next to each other on a chromosome, as arranged in the figure below (exact same structure for both genes, next to each other). Which of the following statements is true?
Gene A and Gene B can be transcribed at different rates, producing different amounts of RNA within the same cell.
6. With respect to genome structure and stability, all of the following statements are true except:
Gene families are represented in the moderately repeated fraction of eukaryotic DNA
Which region of the nucleolus is associated with ribosome assembly?
Granular component
The N-terminus of which histone is generally the most extensively modified by chemical modification?
H3
Most eukaryotic cells only express 20-30% of the genes they possess. The formation of hetero-chromatin maintains the other genes in a transcriptionally silent state. Which histone modification directs the formation of the most common type of heterochromatin via recruitment of HP1 proteins?
H3 lysine 9 methylation
During the formation of heterochromatin from euchromatin, what is the order of events that generally occurs at the level of the histone?
Histone deacetylation; histone methylation; HP1 protein binds to histones
What is the order of events that occur for the routing of a protein with a nuclear localization signal into the nucleus? I. Association of protein complex with Ran-GTP II. Movement of protein complex through the nuclear pore III. Importin a/B association with protein IV. Transport of importin B to the cytosol via Ran-GTP V. Interaction of protein complex with cytoplasmic filament of the nuclear pore
III; V; II; I; IV
Which of the following statements concerning the lac operon is NOT true?
It is a type of repressible operon
Which of the following statements concerning endocytosis and phagocytosis is incorrect?
LDL particles are routed to the lysosome via pinocytosis
What specific tag added to proteins in the cis-Golgi will route lysosomal enzymes to the lysosome?
Mannose 6-phosphate
You have discovered a new hn-RNA from a human cell line and want determine the protein product that is made from the message. The sequence of this hn-RNA is as follows: (5' cgcaugaccaccaccaccauggggggucaugccaacuaauucccucacagggcauucuaaacuuuaa 3') Which is the predicted protein sequence from this mRNA? Remember to splice out the intron and locate the correct start codon within the Kozak sequence
Met-Gly-Gly-His-Ser-Lys-Leu
What statement concerning histone modification is generally true?
Methylation of aa is linked to a heterochromatin state Acetylation of aa is linked to a euchromatin state (Ans: A and B)
Transcription regulators bind gene regulatory sequences through:
Non-covalent bonds between amino acid R groups on the surface of the protein and specific nitrogenous bases in the major groove of DNA.
Your friend works in a biotechnology company and has discovered a drug that blocks the ability of Ran to exchange GDP for GTP. What is the most likely effect of this drug on nuclear transport?
Nuclear transport receptors would be unable to release their cargo in the nucleus.
DNA packaging from the lowest level of organization to the highest level is:
Nucleosome, 30-nm fiber, supercoiled loop, mitotic chromosome
Which enzyme transfers an oligosaccharide to proteins via N-linked glycosylation at the ER?
Oligosaccaryltransferase
During the unfolded protein response, the protein ______ is activated to cause an inhibition of protein translation, while the protein _____ is cleaved to act like a transcription factor to turn on 'helper' genes.
PERK; ATF6
Formation of clathrin-coated vesicles during receptor-mediated endocytosis is initiated by which of the following molecules?
PI(4,5)P2
After isolating the rough endoplasmic reticulum from the rest of the cytoplasm, you purify the RNAs attached to it. Which of the following proteins do you not expect the RNA from the rough endoplasmic reticulum to encode?
Peripheral proteins on the cytoplasmic face of the lipid bilayer
Where would the protein from the previous question (Met-Gly-Gly-His-Ser-Lys-Leu) be found in the cell?
Peroxisome
These amino acids line the channel of the nuclear pore to provide a hydrophobic environment:
Phenylalanine; glycine
A defect in the lamin A/C gene leads to what disease?
Progeria
Which of the following statements about the protein quality control system in the ER is FALSE?
Proteins that are misfolded are degraded in the ER lumen
In terms of DNA structure and composition, which of the following is NOT true?
Pyrimidines are G and T
During eukaryotic pre-mRNA processing, which enzyme is involved in the last step in the formation of the 5' Cap?
RNA methyltansferase
You are interpreting data on a DNA chip or microarray. You expose the chip to a mixture of two cDNA populations: one from cells that were not treated with a glucocorticoid hormone (untreated controls; labeled with a red fluorescent dye) and a population from cells that were treated with glucocorticoid hormones (glucocorticoid-treated; labeled with green fluorescent dye). You look at a spot on the chip representing the gene for phosphoenolase, a gene that is expressed in these cells and is repressed when glucocorticoid is added. What color should the spot representing the phosphoenolase gene be?
Red
During ribosome docking at the rough endoplasmic reticulum, which of the following act as G proteins to hydrolyze GTP before translation resumes?
SRP and SRP receptor (Ans: A and B)
What GTP-binding protein plays a regulatory role in the formation and disassembly of the COPII coat?
Sar1
Which of the following is not true concerning protein processing?
Secreted proteins (e.g. neurotransmitters) are synthesized on 'free' ribosomes. The SER is continuous with the nuclear membrane and the starting point of the biosynthetic pathway
Concerning pre-RNA processing, which of the following is true?
SnoRNPs process rRNAs by methylating nucleotides and converting uridine to pseudouridine tRNAs contain unusual bases since they undergo base modification Spliceosomes (e.g. U1, U2) are made up of protein and RNA components Complexes that process hnRNAs assemble on the C-terminal domain of RNA polymerase II
What of the following is a function of the smooth ER?
Steroid hormone synthesis Detoxification of organic compounds Sequestering calcium (Ans: A, B, and C)
A change in nucleotide sequence that does not affect amino acid sequence is said to be _________, whereas a change that causes an amino acid substitution is said to be _________.
Synonymous; nonsynonymous
You have a segment of DNA that contains the following sequence: (two DNA strands). You know that the RNA transcribed from this segment contains the following sequence: (another strand related to one of the first two). Which of the following choices best describes how transcription occurs?
The bottom strand is the template strand; RNA polymerase moves along this strand from 3′ to 5′ (the bottom strand has opposite bases from the RNA strand, Ts to Us)
Which model suggests that the Golgi cisternae are transient structures that form at the cis face of the stack by fusion of membranous carriers from the ER and ERGIC and that each cisterna travels through the Golgi complex from the cis to the trans end of the stack, changing in composition as it progresses?
The cisternal maturation model
Fred Griffith studied two strains of Streptococcus pneumonia, one that causes a lethal infection when injected into mice, and a second that is harmless. He observed that pathogenic bacteria that have been killed by heating can no longer cause an infection. But when these heat-killed bacteria are mixed with live, harmless bacteria, this mixture is capable of infecting and killing a mouse. What did Griffith conclude from this experiment?
The heat-killed pathogenic bacteria "transformed" the harmless strain into a lethal one
Which of the following statements concerning DNA is true?
The melting temperature of DNA increases as its GC content increases most proteins interact with DNA along its major groover
Which of the following is NOT true about the glycosylation of proteins in the ER?
The oligosaccharide 'tree' is made up entirely of glucose.
All of the following concerning bacterial transcription are true:
The promoter contains a -35 element and Pribnow box (-10 element) needed for transcription. RNA polymerase needs an associated factor to effectively bind to the promoter. Transcription occurs 5' to 3' antiparallel to the template strand.
Which of the following is NOT true concerning transcription factors?
Transcription factors generally act as monomers
Which of the following is not true concerning transcription factors?
Transcription factors generally act as monomers
All of the following concerning bacterial transcription are true except:
Transcriptional termination is always a rho-dependent process Transcription occurs 5' to 3' parallel to the template strand
During translation initiation in eukaryotes, which initiation factor is a GTP-binding protein required for attachment of the first aminoacyl-tRNA?
eIF2
Concerning pre-RNA processing, which of the following is NOT true?
mRNAs have 3' methyladenine caps and 5' polyG tails Complexes that process hnRNAs assemble on the N-terminal domain of RNA polymerase II
All of the following concerning protein translation are true:
mRNAs that contain nonsense mutations are destroyed by nonsense-mediated decay. Polysomes allow simultaneous translation of mRNAs to increase the rate of protein synthesis. Eukaryotic cells have two release factors for termination: eRF1 and eRF3. Peptidyl transferase catalyzes the peptide bond formation between amino acids.
