cell bio final

Which of the following is not a method of epigenetic inheritance?

DNA recombination

Which of the following is not an example of epigenetic inheritance?

DNA recombination

Which of the following statements is true?

Disulfide bonds stabilize but do not change a protein's final conformation

Which of the following choices reflects the appropriate order of locations through which a protein destined for the plasma membrane travels?

ER ---> Golgi ---> plasma membrane

Which of the following is true about a newly synthesized human chromosome?

It was synthesized by continuous and discontinuous DNA synthesis from multiple origins of replication

The DNA that codes for the ribosome-binding sequences in the bacterial TrpA gene is deleted. The removal of these sequences will lead to ____.

No translation of the TrpA mRNA

Which type of double strand break repair usually results in a loss of nucleotides at the repair site?

Non-homologous end joining

A protein contains a KDEL endoplasmic reticulum retention signal sequence. Which protein processing mechanism would permit the protein to transport out of the ER?

Proteolytic cleavage of the KDEL? NOT ubiquitination

Which of the following statements about a protein in the lumen of the ER is false?

Some of the proteins in the lumen of the ER can end up in the plasma membrane

Which statement is true?

a nonpolar molecule is hydrophobic

Which of the following channels would not be expected to generate a change in voltage by movement of its substrate across the membrane where it is found?

an aquaporin

Apoptosis differs from necrosis in that necrosis

causes cells to swell and burst, whereas apoptotic cells shrink and condense.

Which of the following would not occur following the unfolded protein response (UPR).

cell divison

Which of the following statements about skeletal muscle contraction is false?

changes in voltage across the plasma membrane that occur when a muscle cell receives a signal from the nervous system cause an influx of Ca2+ into the sarcoplasmic reticulum,, triggering a muscle contraction

Razzle, a new drug, is structurally similar to the hormone endorphin and binds to opioid receptors. What kind of regulation is this?

competitive inhibtion

Amino acids are joined together to form a polypeptide by ____ reactions.

dehydration

what is the RNA component of a ribosome?

mRNA ?

What type of macromolecule helps package DNA in eukaryotic chromosomes?

proteins

Which of the following structures shorten during muscle contraction?

sarcomeres

Which RNA is involved in regulating gene expression?

tRNA ?

Which enzyme involved in DNA replication is not present in prokaryotes?

telomerase

Which of the following does not occur before a eukaryotic mRNA is exported from the nucleus?

the ribosome binds to the mRNA

Which of the following is NOT a process that delivers to the lysosome?

transcytosis

Which of the following is required for the secretion of neurotransmitters in response to an action potential?

voltage gated Ca2+ channels

All of the following promote apoptosis except ___

Bcl2

Which of the following double stranded DNA sequences would have the highest melting temperature?

'5 GCCTATCCCCGGCCCC3' ** one with the most C**

which of the following functional groups is a amino group?

-NH2

An exported mRNA containing 300 nucleotides can initially be transcribed into a protein that is approximately how many amino acid residues in length?

100 amino acids

Which of the answers below shows the following DNA sequence correctly replicated? 3' GCTACGGGGTA 5'

5' CGATGCCCCAT 3'

The nucleotide consensus sequence found at the 3' splice site of intron-exon boundaries is ___.

5' PyPyPyPyPyNCAG- 3'

Comparing DNA polymerase and RNA polymerase, which of the following statements is incorrect?

Both polymerases require a short RNA primer to be synthesized by primase before they can synthesize DNA or RNA

Both excitatory and inhibitory neurons form junctions with muscles. By what mechanism do inhibitory neurotransmitters prevent the postsynaptic cell from firing an action potential?

By opening Cl- channels

For a cyclin-Cdk complex to be maximally active, inhibitory phosphates must be removed by phosphates such as ___

Cdc25

Which of the following statements is true?

Chaperone proteins in the mitochondria facilitate the movement of proteins across the outer and inner mitochondrial membranes.

Which of the following statements about chromatin is TRUE?

Chromatin remodeling affects transcription by altering chromatin structure to allow accessibility to the DNA

Which of the following statements about eukaryotic chromatin is true?

Chromatin remodeling complexes change the accessibility of chromatin to other proteins

You observe cells under a microscope undergoing mitosis. The sister chromatids have condensed, but they are not paired up. The cell is in Prometaphase. This is likely due to a defect in which protein?

Cohesin

To initiate DNA replication, ___ separates a segment of the DNA double helix to expose single-stranded DNA.

DNA helicase

At replication forks, ____ catalyze addition of nucleotides to the 3' end of a growing DNA strand by using a parental DNA strand as a template.

DNA polymerases

Which of the following statements is true?

Extracellular signal molecules that are hydrophilic must bind to a cell- surface receptor so as to signal a target cell to change its behavior.

All functional DNA sequences inside a cell code for protein products.

FALSE

All proteins have quaternary structure?

FALSE

DNA has an overall positive charge.

FALSE

H20 is a molecule that diffuses freely by passive transport across cell membranes.

FALSE

In DNA and RNA, new molecules are always added to the 5' end of the nucleic acid strand.

FALSE

In eukaryotes, DNA polymerase II add the poly (A) tail.

FALSE

In eukaryotes, translation can begin before transcription is complete.

FALSE

In transmembrane proteins, start-transfer sequences are hydrophobic and stop-transfer sequences are hydrophilic.

FALSE

Lamellipodia are long, thin, actin-containing extensions.

FALSE

Primase is only needed for leading strand DNA synthesis.

FALSE

The DNA-binding motifs of transcription factors have an overall negative charge.

FALSE

Akt promotes the survival of many cells by affecting the activity of Bad and Bcl2, as diagrammed below. Which of the following statements is FALSE?

In the absence of a survival signal, Bad is phosphorylated

A protein has a mutation that prevents it from being ubiquitinated. What would be the most likely outcome?

Levels of the protein would be higher

A eukaryotic ribosome translates the following mRNA. What polypeptide sequence would the ribosome synthesize? 5' ACAUGAUAGGAGGUUGAACAUG3'

Met-Pro-Thr-His

Which of the following statements about the function of the centrosome is false?

Microtubules emanating from the centrosome have alternating polarity such that some have their plus end attached to the centrosome while others have their minus end attached to the centrosome.

Cells use membranes to help maintain set ranges of ion concentrations inside and outside the cell. Which of the following ions is the most abundant inside a typical mammalian cell?

Na+

What type of mutation is this? DNA CAG CAG CAG CAG Amino acid GIn GIn. GIn. GIn DNA. CAG CAG TAG CAG Amino acid. GIn. GIn STOP (Truncated protein)

Nonsense

The bacterial gene PheC has extensive mutations in its terminator sequence. What would be the most likely outcome?

PheC mRNA transcripts are longer than normal. ? NOT PheC mRNA will be transcribed into a polypeptide chain which is longer than usual

Which of the following protects mRNA in a eukaryotic cell from degradation by RNases?

Poly (a) tail

The eukaryotic gene BAB is only expressed during fetal development. In an adult organism, which of the following statements would be false?

Promoter of gene is methylated? NOT BAB is located in heterichromatin

Which of the following statements is true?

Proteins destined for the ER are translated by cytosolic ribosomes and are targeted to the ER when a signal sequence emerges during translation

Unlike DNA, which typically forms a helical structure, different molecules of RNA can fold into a variety of three-dimensional shapes. This is largely because ___________________.

RNA is single stranded

Which of the following statements about RNAi is true?

RNAi is induced when double-stranded RNA is present in the cell

Your friend has just joined a lab that studies vesicular transport and has been given a cell line. He wants to start designing some experiments but was not listening carefully when he was told about the molecular defect of this cell line. He is too embarrassed to ask and comes to you for help. He does recall that this cell line forms coated vesicles that completely bud off the parent membrane but cannot dock with the target membrane. Which of the following proteins might be lacking in this cell line?

Rab

In a eukaryotic chromosome, where would you expect find regions of euchromatin?

Regions containing housekeeping genes, which are constitutively (constantly) expressed-0

Which of the following statements about the genetic code is correct?

Some amino acids are specified by more than one codon

By wobble pairing, a single tRNA is sometimes able to decode more than one codon sequence.

TRUE

Endosomes mature into lysosomes, which contain hydrolytic enzymes that are only active in acidic conditions.

TRUE

In the aqueous environment of a cell, amino acids with polar side chains are usually located on the exterior surfaces of a protein.

TRUE

Microtubules are important for transporting cargo in nerve cell axons. Notice that the two types of cargo are traveling in opposite directions. The gray cargo is attached to dynein.

TRUE

Replication origins are usually AT rich

TRUE

Steroid hormones can pass through the plasma membrane to interact with intracellular receptors.

TRUE

Which of the following DNA replication enzymes is NOT needed for leading strand synthesis?

Telomerase

Which of the following statements is false?

Telomerase extends the newly replicated lagging strand to fill in the missing section of DNA on the end of the linear chromosome

K+ leak channels are found in the plasma membrane. These channels open and close in an unregulated, random fashion. What do they accomplish in a resting cell?

They keep the resting membrane potential at slightly below zero

Which of the following statements is true about chaperone proteins that act as "isolation chambers"?

They protect the proteins from interacting with other proteins while they fold

The DNA duplex consists of two long covalent polymers wrapped around each other many times over their entire length. The separation of the DNA strands for replication causes the strands to be "overwound" in front of the replication fork. How does the cell relieve the torsional stress created along the DNA duplex during replication?

Topoisomerases nick the phosphate backbone, allowing local unwinding of DNA ahead of the replication fork

How could you decrease the transcription of just one specific gene in a bacterial cell?

a mutation that introduced extensive sequence changes into the DNA that precedes the gene's transcription start site

Primary structure of a protein is____.

a particular amino acid sequence

Which of the following statements about prokaryotic mRNA molecules is false?

a single prokaryotic mRNA molecule can be transcribed into several proteins

Binding of adrenaline to a GPCR stimulates cAMP synthesis, which can ultimately activate glycogen phosphorylase to break down glycogen to glucose. Which of the following proteins can diminish signal transduction of this pathway?

activated cyclic AMP phosphodiesterase NOT activated PKA

Pumps are transporters that are able to harness energy provided by other components in the cells to drive the movement of solutes across membranes, against their concentration gradient. This type of transport is called _____________.

active transport

Which of the following protein families are NOT involved in directing transport vesicles to the target membrane?

adaptins

Which of the following conditions is likely to increase the likelihood of skeletal muscle contraction?

addition of a drug that increases CA2+ binding to troponin

Which of the following is true about operons?

all genes in the operon are transcribed into one mRNA molecule

Which of the following methods is NOT used by cells to regulate the amount of protein in the cell?

circRNA can bind mRNA and prevent translation

In prokaryotes, which of the below underlined codons will be selected as the translation initiator codon?

codon 1 5' end

In eukaryotes, which of the below underlined codons will be selected as the translation initiator codon? AUAUGCGCACAUG(1)GCGCCGCCCACCAUG(2)AGGGCAGCGCCAUG(3)GACG

codon 4 kozak seq. GCCGCCACC

Which picture shows the correct directionality of DNA strands in a replication fork? a 5' 3'. b. 5' 3' c. 5' 3'. d. 5' 3' 5' 3'. 5' 3'. 3' 5'. 3' 5' 3' 5'. 5' 3'. 3' 5'. 5' 3' 3' 5'. 3' 5' 5' 3'. 3' 5'

d

Cell cycle progression is controlled by Cdk-cyclin activity. All of the following are methods to regulate Cdk-cyclin activity except

degradation of the cyclin by seprase

If lactose is absent and glucose is absent, transcription of the lactose operon ___.

does not occur because promoter is blocked by repressor, even though CAP/cAMP is available

If lactose is present and glucose is present, transcription of the lactose operon ____.

does not occur because the repressor can no longer bind to the operator, but CAP/cAMP is not available

Which factor makes direct contact with the 5' cap on mRNA at the start of translation?

eIF-4B

Signal sequences that direct proteins to the correct compartment are ___.

encoded in the amino acid sequence and sufficient for targeting a protein to its correct destination

In eukaryotic cells, genes that are frequently expressed by a cell are usually located in ____.

euchromatin

Which part of a phospholipid is hydrophobic?

fatty acid tails

You examine some cells under the microscope, they initiate DNA replication and start synthesizing new DNA, but eventually the replication forks stall before replication is complete. Which enzyme likely has a defect?

helicase

When a signal needs to be sent to most cells throughout a multicellular organism, the signal most suited for this is ___________.

hormonal

WHy does it take about the same amount of time for a human cell and a bacterial cell E. Coli to replicate their DNA?

human cells have multiple origins of replication, E. Coli only has one

In the DNA double helix, what type of bond holds the two complementary strands together?

hydrogen

Which of the following choices best describes GAP (GTPase activating protein) regulation of GTP-binding protein?

hydrolyzes GTP to GDP to deactivate the protein

Ligand and ligand binding site interactions depend of many weak non-covalent interactions. Where is the binding site usually located on a protein?

inside a deep cavity on the protein surface

All of the following cytoskeleton components are involved in mitosis and cytokinesis except

intermediate filaments

In eukaryotic cells, intronic sequences coded for within the DNA are not transcribed into proteins. Why?

intronic sequences are removed from RNA molecules by the spliceosome, which works in the nucleus

During RNA splicing ____ are excited and ___ are ligated.

introns, exons

Combinatorial control of gene expression ___.

involves groups of transcriptional regulators working together to determine the expression of a gene

Which type of chemical bond donates or receives electrons?

ionic

Which noncovalent interactions between nonpolar amino acid side chains contribute to the tertiary structure of a protein?

ionic bonding? electrostatic?

which of the following is NOT a eukaryotic transcription factor binding motif?

iron finger

What is the role of the nuclear localization sequence in a nuclear protein?

it is bound by cytoplasmic proteins that direct the nuclear protein to the nuclear pore

How does S-Cdk help guarantee that replication occurs only once during each cell cycle?

it phosphorylates the Cdc6 protein, marking it for destruction

In a eukaryotic cell, what would happen if Poly (A) polymerase was not functional?

mRNA transcripts would not have poly (a) tails? NOT no change

During which stage of mitosis do the chromosomes line up at the cell equator?

metaphase

Some chemotherapy drugs function by preventing mitotic spindle formation and function and as a result preventing cell division. Which cytoskeleton component are they targeting?

microtubules

What type of mutation is this? DNA CAT CAT CAT CAT Amino acid His His His His DNA. CAT CAT CCT CAT Amino acid. His His Pro His (incorrect amino acid)

missense

A eukaryotic cell line has a defect in the enzymes that add the 5' cap to mRNA transcripts. Where would you expect to find the mRNA which does not have the 5' cap?

nucleus only? NOT cytoplasm only

If allolactose is present and glucose is absent, transcription of the lactose operon ____.

occurs because the repressor can no longer bind to the operator, and CAP/cAMP is available.

Irradiated mammalian cells usually stop dividing and arrest at a G1 checkpoint. Which would occur first?

p53 phosphorylated

You examine some cells under the microscope, they form replication bubbles and forks, but DNA synthesis does not begin. Which enzyme likely has a defect?

primase

Enzymatic_____ catalyze the transfer of a phosphate group to a specific amino acid side chain on a target protein.

protein kinases

WHich subatomic particle determines the electronegativity of an atom?

proton

In a water molecule, what is the charge of the hydrogen atoms compared to the oxygen atom?

slightly positive

Which RNA is involved in RNA splicing?

snRNA

The storage form of carbohydrates is ________ in plants and ________ in animals.

starch, glycogen

The microtubules in a cell form a structural framework that can have all the following functions except which one?

strengthening the plasma membrane

Involved in translation termination, eRF-1 has a structure similar to which of the following choices?

tRNA

Which RNA functions as a carrier of amino acids?

tRNA

After an amino acid sequence has been linked to a peptide chain, the large ribosomal subunit shifts forward, moving the spent tRNA to which ribosome tRNA binding site before ejecting it?

the E site

What accounts for the polarity of the water molecule?

the oxygen atom is more electronegative than the hydrogen atoms

What would most likely happen if the start codon in a transcript was was mutated?

the transcript would not be translated

In a DNA double helix,

the two DNA strands run antiparallel

What would be the effect of changing the codon UAA to UGA in a mRNA transcript?

transcription would precede normally

Proteins that are fully translated in the cytosol do not end up in _____.

transport vesicles

Posttranslational modification with ___ marks proteins to be located to the proteasome.

ubiquitin

After translation, what would NOT occur to turn a polypeptide chain into a functional protein?

ubiquitination ? NOT proteolytic cleavage

Which of these pathways is not a function of an endosomal compartment?

unfolded protein response

During DNA replication, the following replication error occurs. Which of the following shows the correct way to repair the DNA damage? C new strand T template a. A. b. C. c. C. d. G T. A. G. T

A. A T

The figure below shows you how normal signaling works with a Ras protein acting downstream of an RTK. You examine a cell line with a constitutively active (always on) Ras protein that is always signaling. Which of the following conditions will turn off signaling in this cell line?

Addition of a drug that blocks protein Y from interacting with its target

Which of the following statements is true about RNA splicing in a eukaryotic cell?

All introns will be removed. Some or all of the exons will be in the final processed mRNA.

K9-Methylation, K23-methylation Would this hypothetical histone modification pattern be most likely associated with gene splicing or gene expressing?

Gene Splicing

Active transport requires the input of energy into a system so as to move solutes against their electrochemical and concentration gradients. Which of the following is not one of the common ways to perform active transport?

Glucose transporter uniport

A nucleosome consists of DNA wrapped around a core of histone proteins. Which histone protein is not part of the octomeric core?

H1

The formation of heterochromatin maintains genes in a transcriptionally silent state. Which histone modification is associated with the formation of the most common type of heterochromatin?

H3 lysine 9 methylation

Which of the following statements is true?

In a prokaryotic cell, the cell wall provides structural support from the environment.

You have a segment of DNA that contains the following sequence: 5′-GGACTAGACAATAGGGACCTAGAGATTCCGAAA-3′ 3′-CCTGATCTGTTATCCCTGGATCTCTAAGGCTTT-5′ You know that the RNA transcribed from this segment contains the following sequence: 5′-GGACUAGACAAUAGGGACCUAGAGAUUCCGAAA-3′ Which of the following choices best describes how transcription occurs?

The bottom strand is the template strand; RNA polymerase moves along this strand from 3' to 5'

The cat can run. Which of the following would be analogous to a frameshift mutation of this sentence.

The cax tca nru n ?

DNA damage is present during the G1 stage of interphase. All of the following are possible outcomes except

The cell immediately enters S phase

Which of the following descriptions is consistent with the behavior if a cell infected with a virus that inhibits checkpoint mechanisms that normally operates during G2?

The cell would enter M phase under conditions when normal cells would not