chapter 2 protein synthesis
A person who is worried that he may have inherited the gene mutation for Huntington disease is told that he has the "wild-type" form of this gene. What is the best interpretation of this finding? A. His gene for Huntington disease (HD) has more "hot spots" for mutations than the general population. B. His Huntington disease has unusual mutations of unknown significance. C. His Huntington disease gene is considered normal. D. He has no Huntington disease gene.
C
A new experimental drug has been developed that reduces the activity of microRNA in the beta cells of the pancreas of people with type 2 diabetes mellitus. If this drug was specific only for pancreatic beta cells, what would be its effect? A. Increased production of insulin B. Decreased production of insulin C. Increased degradation of insulin D. Decreased degradation of insulin
A
How does replacement of thymine with uracil in messenger RNA help in the process of protein synthesis? A. Allowing messenger RNA to leave the nucleus B. Ensuring only the "antisense" strand of DNA is transcribed C. Determining the placement of the "start" signal for translation D. Promoting posttranslational modification for conversion to an active protein
A
What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of his noncoding regions and his monozygotic twin (twin B) does not? A. DNA identification of each twin will be more specific. B. Only their somatic cells will remain identical at all loci. C. Only their germline cells will remain identical at all loci. D. They will now be dizygotic twins instead of monozygotic twins.
A
Which events, structures, or processes are likely to trigger transcription of the beta-globin gene? A. Anemia and TATA boxes upstream from the beta-globin gene B. Anemia and polyadenylation downstream from the beta-globin gene C. Polycythemia and TATA boxes upstream from the beta-globin gene D. Polycythemia and polyadenylation downstream from the beta-globin gene
A
Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA A. AUGGUUAUUA B. ACGCTCGATTATTT C. CGCUCGAUUAUUU D. AACGCUUGGUCUGAAUUUUAAUUU
A
Which process would be directly inhibited by a lack of conversion of thymine to uracil? A. Translation B. Transcription C. MicroRNA silencing D. Posttranscriptional modification
A
Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis? A. These enzymes prevent overexpression of critical proteins. B. Without ribonucleases, messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type. C. When ribonucleases degrade RNA, the degradation products are recycled, making protein synthesis more energy efficient. D. The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production.
A
How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer type to his or her children? A. The predisposition can only be passed on if the person with the somatic cell mutation is female. B. There is no risk of passing on a cancer predisposition to one's children from a somatic cell mutation. C. The risk for predisposition is dependent on which tissue type experienced the somatic mutation. D. Multiple somatic mutations are required for passing on a predisposition to cancer development.
B
What is the best meaning for the term gene expression? A. The location of a specific gene allele on a specific autosomal chromosome B. The specific trait or protein coded for by a single gene is actually present C. The ability of a single gene to code for more than one trait or characteristic D. The loss of a trait or characteristic from one family generation to the next generation
B
What is the function of ribosomes (also known as ribosomal RNA) in protein synthesis? A. Allow interpretation of the two strands of DNA to determine which is the "sense" strand and which is the "antisense" strand B. Serve as the coordinator mechanism to allow proper reading of the mRNA and placement of the correct amino acid in the sequence by the tRNAs C. Allow further processing of synthesized proteins (posttranslational modification) in order to ensure that the final product is physiologically active D. Serve as transport molecules able to move a specific amino acid to the site of protein synthesis (peptide chain elongation) in the correct sequence
B
Which feature or characteristic is most critical for protein function or activity? A. The number of amino acids B. The sequence of amino acids C. Deletion of all active exons D. Transcription occurring after translation
B
Why are people who have poor DNA repair mechanisms at greater risk for cancer development? A. Their cancers are usually resistant to chemotherapy. B. Their somatic mutations are more likely to be permanent. C. They have greater exposure to environmental carcinogens. D. They have sustained a mutational event in all cells and tissues.
B
After a protein is synthesized during translation, what further process or processes is/are needed for it to be fully functional? A. No further processing beyond the linear arrangement of amino acids is required. B. Although minimal function can occur in the linear form, the protein is more active when it undergoes mitosis. C. The protein first twists into a secondary structure and then "folds" into a specific tertiary structure for activation and function. D. The initial protein produced is a "preprotein" that requires a series of depolarizations by electrical impulses for conversion to an active protein.
C
How does an "anticodon" participate in protein synthesis? A. Splicing out the introns to form a functional and mature messenger RNA B. Identifying which DNA strand is the "sense" strand to transcribe into RNA C. Ensuring the appropriate tRNA places the correct amino acid into the protein D. Interpreting the correct "stop" triplet or codon that signals for translation termination
C
Jack and Jill go up a hill that has high levels of gamma radiation emission. Jack suffers 10 point mutational events in a noncoding region, and Jill suffers only one frameshift mutation in the insulin gene-coding region of all her pancreatic beta cells. What are the possible and probable outcomes of these events for both people? A. Jack will have major deficiencies in the production of 10 proteins; Jill will have reduced insulin activity. B. Jack will have less functional proteins and an increased risk for cancer; Jill will have type 2 diabetes mellitus. C. Jack will have few, if any, effects on protein synthesis but will have more personal DNA markers; Jill will not produce any functional insulin and will have type 1 diabetes mellitus. D. Jack will not have any change in protein synthesis or function; Jill will have an increased risk for developing type 1 diabetes mellitus and can pass this risk on to her children.
C
The protein glucagon contains 29 amino acids in its active linear form. What is the minimum number of bases present in the mature messenger RNA for this protein? A. 29 B. 58 C. 87 D. 116
C
What is the expected result of a "nonsense" point mutation? A. Total disruption of the gene reading frame, no production of protein B. Replacement of one amino acid with another in the final gene product C. Replacing an amino acid codon with a "stop" codon, resulting in a truncated protein product D. No change in amino acid sequence and no change in the composition of the protein product
C
What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell? A. Increased rate of mRNA degradation B. Increased formation of mutation "hot spots" C. Decreased production of cellular proteins D. Decreased amounts of uracil in the cytoplasm
C
What would be the sequence of RNA complementary to single-stranded DNA with the base sequence of ACCTGAACGTCGCTA? A. TGGACTTGCAGCGAT B. ACCTGAACGTCGCTA C. UGGACUUGCAGCGAU D. ACCUGAACGUCGCUA
C
Which factor has the greatest influence on protein tertiary structure? A. The presence of a poly-A tail B. The specific amino acids that are in close proximity to each other C. Bond formation between amino acids that are distant from each other D. The number and position of additional proteins needed to form the complex structure
C
How does a "codon" participate in protein synthesis? A. Carrying amino acid for peptide bond attachment B. Ensuring that ribosomal RNA is securely wrapped around the mature mRNA C. Preventing microRNA from binding to mRNA and prematurely degrading it D. Indicating which amino acid is to be placed within the growing protein chain
D
How does the process of polyadenylation affect protein synthesis? A. Binding to the antisense DNA strand to prevent inappropriate transcription B. Promoting attachment of ribosomes to the correct end of messenger RNA C. Linking the exons into the mature messenger RNA D. Signaling the termination of mRNA translation
D
What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis? A. Transcription for DNA synthesis is rapidly followed by the process of translation. B. Transcription for protein synthesis has "greater fidelity" than does transcription for DNA synthesis. C. Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. D. Transcription for DNA synthesis occurs with both the "sense" and the "antisense" strands, while transcription for protein synthesis occurs with only the "antisense" strand.
D
What makes a frameshift mutational event more serious than a point mutational event? A. Frameshift mutations occur primarily in germline cells, and point mutations occur only in somatic cells. B. Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy), and point mutations are undetectable at the chromosome level. C. The rate of frameshift mutations increases with aging because DNA repair mechanisms decline, whereas the rate of point mutations is unchanged with age. D. When the mutations occur in expressed genes, frameshift mutations always result in disruption of the gene function, whereas a point mutation can be silent.
D
Which statement about single-nucleotide polymorphisms (SNPs) is true? A. SNPs can change an exon sequence into an intron sequence. B. SNPs can change an intron sequence into an exon sequence. C. SNPs are generally responsible for frameshift mutations. D. SNPs are generally responsible for point mutations.
D
Which statement about the introns within one gene is correct? A. These small pieces of DNA form microRNAs that regulate gene expression. B. They are part of the desert DNA composing the noncoding regions. C. When expressed, they induce posttranslational modifications. D. The introns of one gene may be the exons of another gene.
D
A strand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA? A. 1, 2, 3, 4, 5, 6, 7, 8 B. 2, 3, 4, 5, 6, 7 C. 1, 2, 4, 8 D. 3, 5, 6, 7
D
Which process occurs outside of the nucleus? A. DNA transcription B. RNA transcription C. Splicing out of introns D. Translation of mRNA
D
Which DNA segment deletion would cause a frameshift mutation? A. TCT B. GAGTC C. TACTAC D. GCATGACCC
B
1. What is the relationship among genes, DNA, and proteins? A. DNA is composed of a series of amino acids that provide the directions for synthesizing proteins. B. Protein is composed of DNA that is organized into specific gene sequences called amino acids. C. A gene is a section of DNA that provides the directions for synthesizing a specific protein. D. Proteins are the nitrogenous bases that form double strands of DNA in its helical shape.
C
