Chapter 3: Cell the Living Unit

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 59% water and the Extracellular fluid contains 45%?

Neither

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 12% water and the Extracellular fluid contains 12% water?

Neither, equilibrium

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 12% water and the Extracellular fluid contains 12% water?

Neither, equilibrium

Looking at the plasma membrane model, it can be observed that there are two separate liquids in the container (oil & water). Based on what you know about the plasma membrane where would you expect to find the oil layer and where would you expect to find the water layer?

Oil layer would be found in between the non-polar tails; water layer would be found on the surface are of the polar heads

Carrier mediated

Only allows a specific "friend" to enter the cell

During which stage of the cell life cycle is DNA replicated?

S

DNA is a double-stranded molecule, meaning it has two strands that are complimentary to each other. Write the complement DNA strand to the following DNA sequence: ATTACTGGCGTAG

TAATGACCGCATC

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 2% protein and the Extracellular fluid contains 1% protein?

Stays

Inclusions

Stored glycogen granules, crystals, pigments, and so on

Body fluids

Type of extracellular material; mainly interstitial fluid, blood plasma, cerebral spinal fluid. Key in transport and dissolving media

Cellular secretions

Type of extracellular material; substances that aid in lubrication and digestion

Osmosis

is the movement of solvent (water) across semipermeable membrane either through aquaporins or lipid bilayer; usually water concentration is different on two sides of the membrane

The DNA sequence, TACGGGTCAATAAAAGCTTGACGCATT needs to be transcribed then translated into a protein. Write the codon, ant-codon, and protein sequence created by the DNA template.

mRNA: AUGCCCAGUUAUUUUCGAACUGCGUAA protein: Methionine, Proline, Serine, Tyrosine, Phenylalanine, Arginine, Threonine, Alanine

Lysosomes "suicide sacs"

"Safe" sites for intracellular digestion.

Golgi apparatus

A system of membranes that modifies, concentrates and repackages proteins and then expels them in vesicles. These vesicles are either destined for Exocytosis, integrating into the plasma membrane, or they become Lysosomes.

Gap junctions

Channels (slides) between cells; found in areas with a lot of conduction (communication) such as the brain and heart

Cytoplasm

A jellylike fluid inside the cell in which the organelles are suspended

Phospholipid

A lipid that contains phosphorus and that is a structural component in cell membranes

Cholesterol

A lipid that forms an essential component of animal cell membranes and acts as a precursor molecule for the synthesis of other biologically important steroids.

Centrioles

A minute cylindrical organelle near the nucleus in animal cells, occurring in pairs and involved in the development of spindle fibers in cell division.

What part of the phospholipid is hydrophilic?

Polar head

Looking at the plasma membrane model, what do the Styrofoam balls represent?

Polar, hydrophilic heads

Microtubules

A hollow rod composed of tubulin proteins that makes up part of the cytoskeleton.

Cytoskeleton

A network of fibers that holds the cell together, helps the cell to keep its shape, and aids in movement

Smooth ER

A network of tubules that are continuous with the rough ER. It's enzymes (integral proteins) function in the absorption, synthesis and transport of fats. They also store calcium and detoxify chemicals, and metabolize lipids.

Plasma membrane

A selectively-permeable phospholipid bilayer forming the boundary of the cell

Tonicity

Ability of a solution to change the shape or tone of cells by altering the cells' internal water volume

Selective permiability

Allows some substances to cross more easily than others

Rough Endoplasmic Reticulum (Rough ER)

An endomembrane system covered with ribosomes, it makes all excretory proteins and integral proteins and packages them to leave via vesicles.

Peroxisomes

Bud off of the Smooth ER and detoxify substances. They are highly abundant in the liver.

Prophase

Chromosomes become visible, nuclear envelop dissolves, spindle forms

Metaphase

Chromosomes line up in the middle of the cell

Telophase

Chromosomes move to opposite ends of the cell and two nuclei are formed.

Anaphase

Chromosomes separate and move to opposite ends of the cell

Mitochondria

Contain their own DNA, RNA and ribosomes, this DNA comes only from your mother, and they replicate themselves. They are called the "power plant" of cells because they produce the most of the cell's energy molecules (ATP) via aerobic cellular respiration.

Blood plasma would be considered an intracellular fluid. True or false?

False

Nucleolus

Found inside the nucleus. Aids in rRNA synthesis, and assembles ribosomes

Nucleus

Genetic footprint (material) for nearly all cellular proteins.

Chromatin

Granular material visible within the nucleus; consists of DNA tightly coiled around proteins. Condenses into chromosomes.

Ribosomes

Granules containing protein and rRNA, and they are the site of protein synthesis. Free ribosomes make protein meant to stay inside that cell, and membrane-bound ribosomes make proteins to be sent outside of the cell.

Rough ER

Has an external surface studded with ribosomes and manufactures all secreted proteins, integral proteins and phospholipids. Packages proteins and sends them to the golgi apparatus.

Osmolarity

If particles can't move to achieve equilibrium, water will move in order to

Tight junctions

Impermeable zipper-like plasma protein system, good at keeping water out, water proof (i.e. skin and lungs); weak. Found in epithelial cells

Explain why the phospholipid bilayer orients itself the way it does when mixed with a substance like water.

In order to have the polar heads exposed to the water, and the non-polar tails hidden to protect themselves from the water.

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 5% salt and the Extracellular fluid contains 10% salt?

Inside

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 15% potassium and the Extracellular fluid contains 5% potassium?

Inside

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 2% protein and the Extracellular fluid contains 1% protein?

Inside

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 3% glucose and the Extracellular fluid contains 1% glucose?

Inside

Endoplasmic Reticulum (ER)

Interconnected tubes and parallel membranes enclosing cisterns that are continuous with the outer nuclear membrane, and is made up of the smooth ER and rough ER.

If a cell did not contain a nucleus, why would it eventually die?

It is unable to repair itself and reproduce when it is aneucleate, an example is the red blood cells.

Microfilaments

Long, thin fibers that function in the movement and support of the cell

__________ are membranous bags that contain enzymes which digest ingested bacteria, viruses and nonfuntional organelles.

Lysosomes

Glycolipids

Membrane carbohydrates that are covalently bonded to lipids.

What organelle would be incapable of carrying out its function if it was deprived of oxygen?

Mitochondria, which produce ATP. The production of ATP requires Oxygen.

Golgi Apparatus

Modifies, concentrates and packages proteins and lipids from the Rough ER. Takes all "like" packages and repackages them into proper destinations.

Which of the following is a function of a plasma membrane protein?

Molecular transport through the membrane

What part of the phospholipid is hydrophobic?

Non-polar tail

Looking at the plasma membrane model, what do the red tubes attached to the balls represent balls represent?

Non-polar, hydrophobic tails

Mitochondria "powerhouses"

Organelles, which are inherited from your mother, that produce ATP (energy source).

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 15% potassium and the Extracellular fluid contains 5% potassium?

Outside

Does the solute move to the inside or to the outside of the cell if the Intracellular fluid contains 3% glucose and the Extracellular fluid contains 1% glucose?

Outside

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 5% salt and the Extracellular fluid contains 10% salt?

Outside

Does the water move to the inside or to the outside of the cell if the Intracellular fluid contains 59% water and the Extracellular fluid contains 45% water?

Outside

The centromeres move away from each other and the nuclear envelope breaks up during which phase of mitosis?

Prophase

___________ is the phase of mitosis in which the chromosomes begin to condense and the nuclear envelope breaks down (disappears).

Prophase

State the 4 phases of the cell cycle.

Prophase, Anaphase, Telophase, Cytokenesis

Integral Proteins

Proteins of a membrane that are embedded in the lipid bilayer, and aid in facilitating transport through the plasma membrane into/out of the cell.

The plasma membrane is comprised of all the following except ___________. lipids phospholipids glycolipids RNA

RNA

Channel mediated

Slide that allows any lipophobic molecule to pass into the cell as long as they are small

If the nuclear envelope lacked pores, which of the following statements would be false? Lack of pores in the nuclear envelope would result in a decrease in protein synthesis. Lack of pores in the nuclear envelope would effect the ability to make ribosomes. The transport vesicles from the rough endoplasmic reticulum would likely only contain lipids made in the smooth endoplasmic reticulum. The cell would be unable to carry out translation.

The cell would be unable to carry out translation.

If a cell was placed in a hypotonic solution, what would be the effect on the cell?

The cells will swell and ultimately burst.

Peripheral Proteins

The proteins of a membrane that are not embedded in the lipid bilayer; they are appendages loosely bound to the surface of the membrane.

Nucleus

The genetic library with blueprints for nearly all cellular proteins. It responds to signals, and dictates the kinds and amounts of proteins synthesized

Smooth Endoplasmic Reticulum (Smooth ER)

The portion of the endoplasmic reticulum that does not have ribosomes attached to it. It synthesizes and transports fats, metabolizes fats, detoxifies drugs, and is the storage/releasing site for Calcium.

Ribosomes

The site of protein synthesis. Can either be "free," staying in the cell; or "bound," and will be exported out of the cell or integrated into the plasma membrane.

The plasma membrane contains many proteins, state at least 4 major functions of these proteins.

They allow for communication between the cell and it's environment, an option for transport for larger molecules, enzymes for cell to cell connections, and signal transduction.

Extracellular matrix (ECM)

Type of extracellular material (most abundant); the substance in which animal cells are embedded, consisting of protein and polysaccharides synthesized and secreted by cells.

intermediate filaments

Threadlike proteins in the cell's cytoskeleton that are roughly twice as thick as microfilaments

Chromosomes

Threadlike structures made of DNA molecules that contain the genes

Exocytosis

Transport out of the cell

Plasma membrane protein functions

Transport, signal transduction, attachment, intracellular joining, enzymatic activity, cell-cell recognition

Desmosomes

Velcro-like connection, very strong; allows for water to pass through (i.e. skin); found in areas where abrasion is common, keep cells from tearing apart. Most abundant type of junction and can be found in the skin.

In areas of the body subject to higher degrees of mechanical stress, which of the following types of membrane junctions would you expect to be most prevalent? a. Desmosomes b. Microvilli c. Tight junctions d. Gap junctions

a. Desmosomes

Which of the following describes the plasma membrane? a. a single-layered membrane that surrounds the nucleus of the cell b. a double layer of protein enclosing the plasma c. a phospholipid bilayer surrounding the cell d. a membrane composed of tiny shelves or cristae

c. a phospholipid bilayer surrounding the cell

Translation

converts the base sequence of nucleic acids into the amino acid sequence of proteins

Plasma membrane functions

defines cell boundaries, governs interactions with other cells, controls passage of materials in and out of cell

If you walk into your house and smell dinner, the odorant molecules are dispersing via _______________.

diffusion

The movement of solutes from an area of high concentration to an area of lower concentration is known as _____________.

diffusion

Secondary active transport

indirectly uses energy from ATP to move molecules from low to high concentration.

Cholesterol

is a lipid

Transcription

is the first step of gene expression, in which a particular segment of DNA is copied to RNA

Hypo

not enough

Facilitated diffusion

occurs when certain lipophobic molecules (glucose, amino acids, ions) transport passively by binding to protein carriers or by moving through water-filled channels into the cell.

Simple diffusion

occurs when hydrophobic (lipid soluble) substances diffuse directly through the plasma membrane

Primary active transport

requires energy directly from ATP hydrolysis, causing a change in the shape of the transport protein. Moves molecules from low to high concentration (sodium-potassium pump).

In a cell, proteins are synthesized at the ______________.

ribosome

Iso

same

If you created a cellular junction that to could resist a great deal of pull and water could not pass through, it would likely contain __________ and _________.

tight junctions; intermediate filaments

Hyper

too much