Exam 1: Genetics Homework 1-3
T or F: A new initiation event cannot occur on an mRNA molecule until the first ribosome falls away.
- False Many ribosomes may simultaneously be translating each mRNA, forming a structure called a polysome.
Why do eukaryotic chromosomes have multiple origins of replication, whereas prokaryotic chromosomes typically have only one origin?
- The large genome size of a typical eukaryotic chromosome, compared to that of a prokaryotic chromosome, necessitates multiple origins of replication so that the genetic material can be copied in a reasonable amount of time. - Also, replication is much slower in eukaryotes (the average is about 10-100 nucleotides/second) than in prokaryotes (the average is about 1000 nucleotides/second).
For each of the following sequences, select the process most immediately affected by deleting the consensus sequence. Choose only one process for each sequence. (Replication, Translation, Transcription, RNA Processing) - ori site: - 3' splice site consensus sequence - poly(A) tail - terminator - start codon - -10 consensus seq - Shine-Dalgarno sequence
- ori site: Replication - 3' splice site consensus sequence: RNA processing - poly(A) tail: translation - terminator: transcription - start codon: translation - -10 consensus seq: transcription - Shine-Dalgarno sequence: translation
How did the work of Hershey and Chase contribute to the model of DNA as the genetic material? What technique helped them to distinguish between viral DNA and protein?
It distinguished between protein and DNA as genetic material in phages. It is the DNA that is used to produce new phages within host cells. Radioactive isotopes were used to distinguish between DNA and protein. They used radioactive 32P to label the viral DNA, and they used radioactive 35S to label the viral proteins.
An anti-codon reads 5'-UAG-3'. Which amino acid does the tRNA with this anti-codon carry? (Give the one letter Amino Acid code)
L
The sequence of a template strand of DNA is 5'-CAT TAC GCT-3'. What amino acids are encoded by this sequence? (Type just the one letter amino acid sequence with no spaces)
SVM
An in vitro transcription system that contains a bacterial gene does not initiate transcription. Which of the following could explain this? (CHOOSE ALL THAT APPLY) a. Histones that were on the DNA when it was isolated from E. coli are blocking access to the template. b. There is a mutation in the inverted repeat sequence that prevents a hairpin secondary structure from forming. c. There is a mutation at -10, where a promoter consensus sequence is located. d. Rho factor has not been added.
c. There is a mutation at -10, where a promoter consensus sequence is located.
This is a two-part question. In Part 1 (this question) you will choose the one boldface word or term in this statement that makes the statement incorrect. In Part 2 (the next question) you will choose one word to replace the word you have removed, to make the statement correct. Consider the following incorrect statement. Which ONE word makes the statement incorrect? PART 2: DNA polymerase initiates translation when it encounters a start codon on the mRNA.
the ribosome
How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?
115 15 C-G pairs x 3 H-bonds per C-G pair = 45 35 A-T pairs x 2 H-bonds per A-T pair=70 45+70=115
If a 35 base pair double stranded piece of DNA contains 11 C bases, how many T bases does it contain?
24
During transcription, the synthesis of the mRNA strand proceeds in which direction?
5' to 3' only
If the following DNA strand were used as a template, what would the sequence of an RNA be? 5′ GTACCGTC 3′
5′ GACGGUAC 3′
A diploid human cell contains approximately 6.4 billion base pairs of DNA. How many histone proteins are complexed to this DNA?
6.4 billion (bps) / 200 (bp/nucleosome) * 9 (histones/nucleosome) = 288,000,000
Compare and contrast the processes of transcription and DNA replication. In your description you must include the following a) Describe the main objective for each process. b) In what ways are these processes similar (describe at least 3)? c) In what ways do these processes differ (describe at least 3)?
A. DNA Replication is a process that allows the cell to make many copies of DNA before cell division (mitosis or meiosis). Transcription transcribes a DNA sequence template into mRNA. The mRNA is then used as a message in translation to produce a protein that will carry out cell/bodily function. B. (1) RNA and DNA are both synthesized in the 5' to 3' direction. (2) DNA is used as a template strand in both DNA replication and transcription. (3) Both DNA replication and transcription occur in the nucleus of eukaryotes. C. (1) DNA replication uses helicase to unzip the DNA double helix, in transcription, RNA polymerase has an unzipping feature and no helicase is required. (2) DNA polymerase adds nucleotides in DNA replication while RNA polymerase adds nucleotides in transcription. (3) DNA replication produces two daughter strands of DNA while transcription produces mRNA, tRNA, or rRNA.
The sequence of a template strand of DNA is 5'-CAT TAC GCT-3'. What is the sequence of the corresponding DNA strand from 5' to 3'?
AGCGTAATG
The sequence of a template strand of DNA is 5'-CAT TAC GCT-3'. What is the sequence of the corresponding mRNA strand from 5' to 3'?
AGCGUAAUG
Which of the following is a chemical or structural characteristic of RNA that is different from those of DNA? (CHOOSE ALL THAT APPLY) a. RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. b. The RNA sugar is ribose instead of deoxyribose. c. The bases in RNA include uracil instead of thymine. d. RNA molecules are generally shorter in length than those of DNA macromolecules.
ALL ARE CORRECT a. RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. b. The RNA sugar is ribose instead of deoxyribose. c. The bases in RNA include uracil instead of thymine. d. RNA molecules are generally shorter in length than those of DNA macromolecules.
What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3′-TACCGTGCGTGACATTAAGCC-5′ Write the sequence from 5′ to 3′, left to right. (omit the 5' and 3' in your answer and just use the base letters with no spaces in your answer)
ATGGCACGCACTGTAATTCGG
An anti-codon reads 5'-UAG-3'. What is the corresponding codon (from 5' to 3') (Give just the bases with no spaces or other characters)
CUA
This is a two-part question. In Part 1 (this question) you will choose the one boldface word or term in this statement that makes the statement incorrect. In Part 2 (the next question) you will choose one word to replace the word you have removed, to make the statement correct. Consider the following incorrect statement. Which ONE word makes the statement incorrect? PART 1: DNA polymerase initiates translation when it encounters a start codon on the mRNA.
DNA polymerase
Gene expression can be regulated in a variety of ways. Describe 1 mechanism by which a eukaryotic cell relies on DNA sequence for gene expression, and describe 1 mechanism that is DNA sequence independent.
Euchromatin or heterochromatin can affect gene expression (epigenetics). The highly packed nature of heterochromatin makes the DNA sequence inaccessible to proteins that are involved in gene expression. In eukaryotes, methylation also affects gene expression. Sequences methylated show low levels of transcription.
Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?
Fragment B has a higher G + C content (i.e., fragment A has a higher A + T content). Three hydrogen bonds form between G-C pairs, so more energy is required to separate a G-C pair. Only two hydrogen bonds form per A-T pair.
Phosphorous is required to synthesize the deoxyribonucleoside triphosphates used in DNA replication. A geneticist grows some E. coli in a medium containing nonradioactive phosphorous for many generations. A sample of the bacteria is then transferred to a medium that contains a radioactive isotope of phosphorus (32P). Samples of the bacteria are removed immediately after the transfer and after one and two rounds of replication. Assume that newly synthesized DNA contains 32P and the original DNA contains nonradioactive phosphorous. What will be the distribution of radioactivity in the DNA of the bacteria in each sample? Will radioactivity be detected in neither, one, or both strands of the DNA?
Immediately after being transferred from the nonradioactive phosphorus to the phosphorus-32 medium, the bacteria sample will contain no radioactive 32P in their DNA. Note: DNA Replication is semi-conservative, each copy contains one original strand and one newly synthesized strand. After 1 round of DNA replication, the bacteria DNA will contain 1 strand radioactive phosphorus 32P and 1 strand no radioactive phosphorus. After 2 rounds of DNA replication, half of the DNA molecule will have both strands containing radioactive phosphorus-32. The other half of the DNA molecules would have 1 strand non-radioactive phosphorus and 1 strand radioactive phosphorus.
Which of the following enzymes do NOT aid in unwinding of DNA for replication? a. Topoisomerase b. Primase c. Helicase d. Gyrase
Primase
White eyes in Drosophila melanogaster result from an X-linked recessive mutation. Occasionally, white-eye mutants give rise to offspring that possess white eyes with small red spots. The number, distribution, and size of the red spots are variable. Explain how a transposable element could be responsible for this spotting phenomenon. Hint: White eyed mutants express a non-functional protein, Red-Eyed flies express a functional protein at this gene.
Such a fly may carry an allele of the white-eye locus that contains a transposon insertion. The eye cells in these flies cannot make red pigment. During eye development, the transposon may spontaneously transpose out of the white-eye locus, restoring function to this gene so the cell and its mitotic progeny can make red pigment. Depending on how early during eye development the transposition occurs, the number and size of red spots in the eyes will be variable.
What would the peptide sequence be for the following DNA sequence 5'-ACT CAT ATT AGT ATC TCT GAA GCT TCA TAC-3' (Use the one-letter amino-acid code, and don't include spaces)
THISISEASY
Which of the following processes are important in RNA processing? (Select ALL that apply) a. 3' poly-adenylation b. 5' poly-adenylation c. 3' capping d. 5' capping e. mRNA splicing f. transcription g. translation
a. 3' poly-adenylation d. 5' capping e. mRNA splicing
Which of the following statements is/are true? (CHOOSE ALL THAT APPLY) a. Both DNA and RNA are synthesized in a 5′ to 3′ direction. b. During RNA synthesis, the DNA template strand is read in a 3′ to 5′ direction. c. During RNA synthesis, new nucleotides are added to the 3′ end of the growing RNA molecule. d. RNA polymerase has 5′ to 3′ polymerase activity. e. RNA molecules have the same 5′ to 3′ orientation as the DNA template strands to which they are complementary.
a. Both DNA and RNA are synthesized in a 5′ to 3′ direction. b. During RNA synthesis, the DNA template strand is read in a 3′ to 5′ direction. c. During RNA synthesis, new nucleotides are added to the 3′ end of the growing RNA molecule. d. RNA polymerase has 5′ to 3′ polymerase activity.
Which of the following are components or forms of chromatin? (CHOOSE ALL THAT APPLY) a. Histones b. DNA c. Euchromatin d. Heterochromatin e. Uterochromatin f. Lipid Bilayer g. Nucleoli h. Ribosomes i. DNA Polymerase j. Helicase k. Transcription Factors l. Amino Acids
a. Histones b. DNA c. Euchromatin d. Heterochromatin
Why are most new mutations functionally neutral? (Choose ALL correct answers.) a. Only a small proportion of the genome codes for protein. b. Many amino acid changes don't affect protein function. c. Some sequence changes don't result in an amino acid change. d. Many amino acid changes don't affect DNA polymerase. e. DNA polymerase is more careful when replicating genes.
a. Only a small proportion of the genome codes for protein. b. Many amino acid changes don't affect protein function. c. Some sequence changes don't result in an amino acid change.
Which of the following are important attributes of genes, which distinguish gene sequences from non-gene sequences in the genome? (CHOOSE ALL THAT APPLY) a. Promoter b. Long ORF c. Terminator d. Short ORF e. C + G < T + A f. C + G > T + A g. Start Codon h. Stop Codon
a. Promoter b. Long ORF c. Terminator
For every codon, there is a corresponding amino acid. There are 64 codons, and only 20 amino acids. Which statement is correct? a. Some amino acids are specified by more than one codon. b. Some amino acids are not specified by codons. c. Some codons are not used for anything.
a. Some amino acids are specified by more than one codon.
Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes? a. double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0 b. double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C + T) = variable c. double-stranded, parallel, (A + T)/C + G) = variable, (A + G)/(C + T) = 1. d. single-stranded, antiparallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0 e. double-stranded, parallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0
a. double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0
Where does translation take place? a. In the cytoplasm b. In the nucleus c. In the nucleolus d. Anywhere in the cell e. In the centriole
a. in the cytoplasm
Okazaki fragments are found in all of the following EXCEPT (CHOOSE ALL THAT APPLY) a. leading strand b. bacterial cells c. eukaryotic cells d. lagging strand
a. leading strand
Which of the following are consequences of DNA replication errors? (CHOOSE ALL THAT APPLY) a. mutation b. evolution c. speciation
a. mutation b. evolution c. speciation
A transposon is (check ALL that are correct) a. a DNA segment that can insert itself at one or more sites in a genome. b. a "jumping gene." c. a DNA segment that may cause mutations in genes or chromosomal rearrangements. d. a mobile genetic element that may or may not leave a copy of itself in its original site when it moves to a new site.
all of the above
Make the following statement more precise by replacing the word 'gene' with either 'locus' or 'allele': Corn with high-sugar kernels has the 'waxy' gene.
allele
How can a carrot plant express a bacterial gene? a. Because the bacterial gene hijacks the carrot's cellular machinery b. Because the genetic code is the same in both organisms c. Because of the wobble phenomenon d. Because of the degeneracy of the genetic code e. A carrot cannot express a bacterial gene.
b. Because the genetic code is the same in both organisms
A mutation during DNA replication causes a G to be inserted early in a gene after the first base of the codon for tryptophan. In what ways could this affect the growing polypeptide chain? a. It will not be affected. b. Elongation may stop prematurely. c. There will be a single amino acid substitution. d. The reading frame will be shifted, and the wrong amino acids will be added from this point on. e. An extra amino acid will be added, but the reading frame will not be affected.
b. Elongation may stop prematurely. d. The reading frame will be shifted, and the wrong amino acids will be added from this point on.
Which of the following are possible outcomes shortly after DNA polymerase inserts an incorrect nucleotide (a G rather than a correct C) into a new DNA strand? (Choose ALL correct answers.) a. The wrong G stays in the DNA, so the new double-stranded DNA has a G:C pair where it should have a C:G pair. b. The wrong G stays in the DNA so the new double-stranded DNA has a mismatched G:G base pair. c. The wrong G stays in the DNA so the new double-stranded DNA has a mismatched C:C base pair. d. DNA repair enzymes cut out the incorrect nucleotide, so the new DNA strand is one base shorter. e. DNA polymerase immediately stops, backs up, takes out the G nucleotide, and inserts a C.
b. The wrong G stays in the DNA so the new double-stranded DNA has a mismatched G:G base pair. e. DNA polymerase immediately stops, backs up, takes out the G nucleotide, and inserts a C.
A mutation is... (Choose ALL correct answers.) a. usually beneficial to the individual in which it arose b. an inherited change in DNA sequence c. any change to the structure of DNA d. caused by a mistake during transcription e. a translation error that inserts a wrong amino acid f. a transcription error that inserts a wrong base
b. an inherited change in DNA sequence
The two DNA strands of a chromosome are held together by: (What keeps the 2 single strands together to form a double strand?) (choose all that apply) a. the centromere b. hydrogen bonds c. DNA polymerase d. DNA backbone e. base complementarity f. covalent bonds
b. hydrogen bonds e. base complementarity
Which of the following affect the likelihood of a mutation arising? (Choose ALL correct answers.) a. the effect of the mutation on phenotype b. whether or not the cell is replicating its DNA c. which DNA polymerase is copying the DNA d. whether or not it would result in a different amino acid e. whether or not the DNA is frequently transcribed f. None of the above is correct.
b. whether or not the cell is replicating its DNA c. which DNA polymerase is copying the DNA
Three out of the 64 codons are stop codons. How many stop codons would you expect to occur by chance in a random 1 kb sequence of double-stranded DNA? Hint: The DNA can be read in BOTH directions. a. 16 b. 47 c. 94 d. None.
c. 94
How do germ-line mutations differ from somatic mutations? a. Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions. b. Germ-line mutations occur during DNA replication, while somatic mutations do not. c. Germ-line mutations result in mutant gametes, while somatic mutations do not. d. Germ-line mutations are reversible, while somatic mutations are not. e. Germ-line mutations result in cancers, while somatic mutations do not.
c. Germ-line mutations result in mutant gametes, while somatic mutations do not.
The herc2 gene locus codes for a HERC2 enzyme, which plays a role in the pigment synthesis of melanin in human eyes. A functional HERC2 enzyme results in an individual with brown eyes whereas a non-functional HERC2 enzyme results in an individual with blue eyes. The herc2a allele codes for a functional HERC2 enzyme whereas the herc2b allele codes for a non-functional enzyme. Based on a modern definition of genotype and phenotype, which of the following would be considered phenotypes in the above described situation. (CHOOSE ALL THAT APPLY) a. herc2a allele b. herc2b allele c. HERC2 functional enzyme d. HERC2 non-functional enzyme e. herc2 mRNA molecule f. Brown-Eyed individual g. Blue-Eyed individual
c. HERC2 functional enzyme d. HERC2 non-functional enzyme e. herc2 mRNA molecule f. Brown-Eyed individual g. Blue-Eyed individual
If a 40 base single stranded piece of DNA contains 22 T bases, how many G bases does the corresponding single-stranded DNA contain? a. 22 b. 18 c. Not enough information d. 36 e. 9
c. Not enough information
Which of the following are necessary for DNA replication in vitro (PCR)? a. RNA, helicase, primers, DNA polymerase b. Okazaki fragments, helicase, DNA polymerase c. Template DNA, DNA polymerase, four dNTPs, primers, magnesium ions d. Telomerase, Template DNA, four dNTPs, primase e. DNA can't replicate in vitro
c. Template DNA, DNA polymerase, four dNTPs, primers, magnesium ions
Which of the following is an example of an epigenetic change in eukaryotes? (CHOOSE ALL THAT APPLY) a. A loss of an AT base pair from a gene b. The substitution of an AT base pair by a GC base pair in a gene as a result of a mistake during DNA replication c. The addition of methyl groups to cytosines in the promoter region of a gene d. A deletion that simultaneously removes two genes from the genome e. The addition of methyl groups to the lysine 9 residue of histone-H3
c. The addition of methyl groups to cytosines in the promoter region of a gene e. The addition of methyl groups to the lysine 9 residue of histone-H3
Analysis of the bases of a sample of nucleic acid yielded these percentages: A, 20%; G, 30%; C, 20%; T, 30%. The sample could be: a. single-stranded RNA. b. double-stranded RNA. c. single-stranded DNA. d. double-stranded DNA.
c. single-stranded DNA.
Which of the following is not true about a linear molecule of double-stranded DNA? a. It is a double helix composed of antiparallel strands. b. Pentose sugars are linked via covalent phosphodiester bonds. c. Bases are paired via hydrogen bonds. d. At one end, two 5′ phosphate groups can be found.
d. At one end, two 5′ phosphate groups can be found.
What does DNA polymerase do when it meets a promoter? a. It begins replicating the DNA. b. It begins transcribing the DNA. c. It continues transcribing the DNA. d. It continues replicating the DNA. e. It stops.
d. It continues replicating the DNA.
What does RNA polymerase do when it meets a stop codon? Choose all correct answers. a. It stops transcribing the DNA. b. It continues translating the RNA. c. It binds a special tRNA. d. It continues transcribing the DNA. e. It stops translating the RNA.
d. It continues transcribing the DNA.
In the Hershey-Chase experiment, T2 phage were radioactively labeled with either 35S or 32P, and allowed to infect E. coli. What results proved that DNA was the genetic material? a. The 32P was found in both progeny phage and in phage ghosts. b. The 35S was found in both progeny phage and in phage ghosts. c. The 35S was found in progeny phage, and the 32P was found in phage ghosts. d. The 35S was found in phage ghosts, and the 32P was found in progeny phage.
d. The 35S was found in phage ghosts, and the 32P was found in progeny phage.
DNA molecules of different sizes are often separated wit the use of a technique called electrophoresis. With this technique, DNA molecules are placed in a gel, and he DNA molecules migrate toward the + pole of the current. What aspect of its structure causes a DNA molecule to migrate toward the positive pole? a. The double helix b. The Nitrogenous Bases c. DNA is positively charged d. The phosphate backbone e. The Hydrogen Bonds
d. The phosphate backbone
Ultraviolet light causes mutations by... a. deleting segments of DNA b. inverting segments of DNA c. changing a T base to a G base d. creating a thymine dimer e. inducing an inter-strand crosslink
d. creating a thymine dimer
Proteins that regulate the initiation of transcription often bind to: Choose all correct answers. a. specific short sequences of RNA b. specific short sequences of single-stranded DNA c. DNA polymerase d. specific short sequences of double-stranded DNA e. the ribosome
d. specific short sequences of double-stranded DNA the ribosome
Which of the following DNA molecules has the lowest melting temperature? a. AGGGTGGCTTAACGG b. AAATTGCGCGCCCGA c. GGGAGCTCGGTTGCC d. GCATCGATCGATACG e. GAATTCCAATGTATA
e. GAATTCCAATGTATA
Make the following statement more precise by replacing the word 'gene' with either 'locus' or 'allele': All mammals have a keratin gene.
locus
Know that genes with the lowest methylation levels will have the highest levels of transcription
more methlyation = heterochromatin = tightly packed = less transcription
