Final Exam Study Guide Moroney
This model is a simple sugar
A
which of the following cells are haploid
human sperm cells
a tissue weighs 100 micrograms, what is that weight in grams
.0001g
three babies were recenty mixed up in a hospital. which of the following represents the correct baby/parent combinations?
I-2,II-1,III-3
one parent is heterozygous for Dwarfism and the other is homosygous normal, what is the chance that a child of theirs will have dwarfsism
a 50% chance
a molecule that binds to the actice site of an enxyme, inhibiting that enxyme is called
a competitive inhibitor
a human cell contains 22 autosomes and a Y chrommosome. what is this cell
a sperm cell
wolves are sometimes observed to have black coats and blue eyes. assume that these two traits are unlinked. assume further that normal coat color(G) is dominant to a black coat color and brown eyes are dominant to blue. if black make with blue eyes and a female that is heterozygous for bboth traits produce offspring. what fraction of the offspeing would be heterozygous for both traits
about 1/4
woves same as above: if black male with blue eyes and female that is heterozygous for both traits produced offspring. what franction of the offspeing woud have black coats
about 50%
cells hace Na+ -K+ ATPase that pumps Na+ out of the cell afainst the concentration gradient and K+ into the cell, also against the concentraiton gradient. What type of transport is this
active trasport
a white-eyed female fruit fly is crossed witha red-eyed male. what will be the color of their progeny
all of the females will have red eyes and all of the males will have white eyes
cloud leopards are an endangered species of cat, living in the very wet cloud forest of CA. assume that normal sponts are dominatnt, x chromosome linked traint and that dark spots are the recessive cunterpart. if female with dark spots is corssed with a male with normal sports what is the phenotype of the progeny
all of the males will have drak spts and all of the females will have normal spots
place the following in the correct order from smallest to biggest
amino acid, triglyceride, lysosome, human ficroblast cell
Use the table to determine the amino acid sequecne of the protein that would be produced if the following DNA sequence, CAGAGGGTC, was transcribed and translated. the DNA sequence shown is the template strand. begin your traslation with the first nucleotide
asp-pro-leu
which four elements make up approximately 96% of living matter
carbon hydrogen nitrogen oxygen
the making of an exact copy of DNA is called
dna replication
what is the order of information flow during gene expression?
dna-rna-protein
in chemiosmotic phosphorylation, what is the most direct source of eergy htat is used to convert ADP+Pi to ATP
energy released from movement of hydrogen ions through ATP synthase
which of the following statements regairding enzymes is true
enzymes increase the rate of a reaction
a molecule becomes more reduced when it
gains an electron
in the diagram of the chloroplast, which letter corresponds to the location of the calvin cycle
location b
in humans, the___determines the sex of the offspring becaseu___
male gamete: each male gamete can contribute either an X or a Y chromosome
a woman is a carrier of the color blind train and her husband has normal color vision. what percentage of the chidrin will be color blind
none of the girls will be color blind but one half of the boys will be color blind
a woman is a carrier of hemophilia trait and her husband is normal. what percentage of the children will have hemophilia
none of the girls will have hemopholia but one half of the boys will have hemophilia
the nucleus and minochondria contain___ but the lysosome and the cell waslll do not
nucleic acid
Compared to 40K, the isotope 39K has
one less neutron
consider the isotopes of carbon, 12C, 13C, and 14C. which isope is radioactive
only 14C is radioactive
if somebody knows only their abo blood type, do they also know their genotype
only if their genotype is AB or O
which of the follwing types of molecules are the mahor structural components of the cell membrane
phospholipids and proteins
yo are looking at a cell under the microscope, it has a nucleus, a large bvacuole and many chloroplasts. what type os cell is it
plant cell
which organelle prevents small charged molecules like Na+ form rapidly entering the cell
plasma membrane
which enzyme synthesizes small pieces of RNA to help DNA polymerase start making new DNA strand during replication
primase
in the scientific methos, whichis the next step after making a hypothesis?
testing the hypothesis
a couple has a son who is colorblind. netither parent is color blind. which parent or parents has the color blind trait.
th emother has the trait, the father does not
what type of fermentation can the brain perform
the brain cannot do any fermentation
which of the following is true for endergonic reactions
the products hace more free enrgy than the reactants
which of the following is an example of primary protein structure
the protein sequence is leu-val-gly
the structure that makes protein in a cell is called
the ribosome
according to the fluid mosaid model of cell membranes, which othe the following is a true statement about membrane phospholipids
they can move laterally along the plane of the membrane
how many CO2 molecules are produced when one glucose molecule is completely utilized in the process of aerobic respiration
6
Why does your instructor argue that a carrot in the market is alive
All of the above reasons are true
in a test cross, a pea plant with tellow round peas of uncertain heritage was crossed with a plaint that had green wrinkled peas. yellow is dominant to green and round is dominant to wrinkeled. one half of the resulting plants had yellow wrinkled peas and one half had yello round peas. what was the genotype of the parent that had yellow round peas
YYRr
different forms of a gene are called
alleles
five dialysis bags, constructed from semi permeable membrane, .6 sucrose. 10 min intervals, highest initial concentration?
bag a
Chlorophyll molecules mostly absorb___ wavelenghts of visible light
blue and red
this molecule contains a fatty acid
c
where is Rubisco located in the chloroplast
chloroplast stroma
a baby is born with only one X chromosome. What type of genetic problem is this
chromosomal aberration
which letter is pointing to a parental DNA strand
letter A
the R group or side chain of the amino acid serice is -CH2-OH. The R group or side chain of the amino acid leucine is -CH2-CH-(CH3)2. Where would you expect to find these amino acids in glocular protein in aqueous solution
leucine would be in the interior and serine would be on the exterior of the globular protein
for the reaction in the figure, whcih of the follwoing would be the enrgy released by the catalyzed reaction
line d
What is the main substance that makesu p the interior of a potato tuber
starch
what funcional group is -S-H
sulfhydryl group
the overall three-dimensional shape of a single polypeptide is called the
tericary structure
which carbon below, if any, is asymmetric
the carbon labeled B
Which is an example of a lipid
triglyceride
how many CO2 molecules are produced when one glucose molecure is completely utilized in the process of alcohol fermentation
2
how many bonds does nitrogen usually form in biological molecules
3
how many sites are there on the ribosome where trna's can bind
3
what is the result when a diploid cell undergoes meiosis
4 haploid cells
once strand of DNA has the sequence: A-C-C-T-C-C-G-G. The sequence of the complementary strand is
C-C-G-G-A-G-G-T
the mitotic spindle is composed of
microtubules
why is water cohesive
abc are correct: water molecules are nonpolar, one side of the molecule is slightly positive and the other slightly negatice, water molecules participate in hydrogen bonds
a diagram of the metabolic patheway is to the right. as metabolite d builds up in the cell it inhibitis enzyme 1. when this happens what will happen to the amoint of metabolikes a andn b
a will increase and b will decrease
a molecule that has all nonpolar covalent bonds would be
hydrophobic
in pure water about how many of the water molecules are dissociated into H+ and OH-
less than 1 in 1 million water molecules has dissociated
this ocmponent functions as biological catalysts
protein
what is the pH of a solution with a H+ concentration of 1x10^-11
11
The bases adenine and thymidine base pair in DNA double helixes. what type of bond and how many of this interation
2 hydrogen bonds
the mole of water weights 18 grams while a mole of sucrose weights 342 grams. Which statement is true
A mole of sucrose has the same number of molecules as a mole of water
which source of enrgy is most directly responsible for ATP synthsis in the chloroplast?
A pH gradient across the tylakoid membrane
Erythrose, a 4 carbon sugar, has the following chemical formula
C4H8O4
the stage of the cell cycle that occurs immediately after DNA synthesis is
G2 phase
Which mrna sequence below would encode part of a protein with the sequence Ala-Leu-Arg
GCCCUAAGA
the wild type sequence of a portion of mrna is GGCAAAUGUCUC and the GGC encodes a glycine in the normal sequence. which sequence above represents a frame shift of the origical sequence
GGCAAAAUGCCUC
which molecule contributes the oxygen atoms in the O2 produced by photosynthesis
H2O
Sulfur has 6 electrons in its outer electron shell. It combines covalently with hydrogen to form a stable and smelly compound. What is the structure of this compound?
H2S
which of the follwoing functional groups is importanin in protein folding
all of these functional groups are important
what type of dividison is the cell in the picture undergoing? for this organism 2n=4. all of the chromosomes are shown in the drawing
mitosis
How many bonds does sulfur normally have in biological molecules?
2
if glucose entering the cell from the blood goes through the GLUT2 carrier protein and goes form high to low concentration, what type of transport is occurting
facillitated diffusion
what oraganelle is shown in the picture
golgi apparatus
which of the following strictures is found in eukaryotic cells but not prokaryothic cells
mitochondria
which of the following molecules is an amion acid or protein
molecule B
what is translation
the making of proteins using mrna as the guide
the image below showing all chromosomes represents a cell in a stage of meiosis. what is the diploid number of chromosomes for this organism
8
what type of bond results form a complete trasfer of electron(s) between atoms
ionic bonds
this process occurs in our muscles during exercise
lactic acid fermentation
Acid rain sometimes has a pH of 5. What is the H+ concentration
1x10^-5
what is the OH- concentration of the solution with a H+ concentration of 1x10^-6 M
1x10^-8
a bacterial cell radioactice thymide so that the DNA in the cell was completely labeled. assume that no ther component of the cell is labeled. now take way the radioctive thymidene and allow the cells to divide and grow on non-radoactive thymadine. remember the old dna is still radioactive. after 2 rounds of cell division there are 4 cells. how many cells will be radioactive
2
how many bonds does oxygen usually form in biological molecules
2
which type of linkage connects nuclotides unites in rna
3'-5' phosphodiester linkages
How many amion acids would be encoded by the open reading frame in the following sequence: CGCAGCAUGGGCCCGUAUUGACCGGGA
4
how many chromosomes are in a human skincell that is in the G1 portion of the cell cycle
46
one stand of DNA has the sequence 5' T=C=T=A=T=G=G=T=3'. What is the sequence of the complementary stand
5' A-C-C-A-T-A-G-A-3'
this enzyme links two pieces of DNA together
DNA ligase
if one parent is heterozygous for Huntingtons disease and the other is homosygous normal, what is the chance that a child of theirs will have huntingtons disease
a 50% chance
an unequal sharing of electrons between atoms results in
a polar covalent bond
all of the follwoing ocur during the krebs cycle except
adding electrons and protons to O2 to form water
for the reaction in the figure, which of the following would be the energy released by the uncatalyzed reaction
line d
in his transformationan experiments, friffth observed that.
mixing a heat-killed pathogeninc strain of bacteira with a living nonpathogeninc strain can convert some of the living cells into pathogenic form
which of the following molecules is a carbohydrate?
molecule E
the macromolecuel that contains codon is
mrna
Which component is present in prokaryotic cells
ribosomes
a sexually reproducing animal has 2 unlinked henes, one for headshape and one for tail length. its genotype is HhTt. which of the folloing genotypes is possible in a gamete from this orgainsm
HT
a person has found out that both his father and his mother are both carriers of the cystic fibrosis trait. this person does not have cystic fibrosis. wht is the chance that he is a carrier of the train
a 2/3 chance
the primary role of oxygen in cellular respiration is to.
act as an acceptor for electrons and hydrogen ions, forming water
Metaphase in meiosis II is characterized by
aligment of chromosomes on the equator of the cell
insulin, a hormone, is makdein pancreatic cells and exported from the cell in samll vesicles. These vesicles fuse wiht plasma membrane realeasing hte insulin from the cell, what process is occuring
exocytosis
the carbon labelled in this molecule is asymmetric
false
which functional group is present on this molecule? CH3-CH2-O-H
hydroxyl group
where are ribosomes assembled in eukaryotic cells
in the nucleus
you have a yeast strain that has a defect in the Krebs cycle. Under what conditions, if any, could that yeast grow
it can grow by alcohol fermentation
which of the following statements is correct about diffusion
it is a passive process in which molecules move from a region of higher concentraion to a region of lower concentration
the pedigree in the figure shows the transmission of a train in a particcular camily. based on this pattern of transmission, the trait is most likely
mitochondrial
this process takes place entirely on the inner membrane of the mitochondria
mitochondrial electron tansport
during mirochondrial electron transport, H2O is formed. where does the oxygen for the synthesis of water directly come from
oxygen (O2)
when hershey and chase labeled the phage wtih 35S-sulfur, what cellular component were they specifically labeling
proteins were specifically labeled
a marathon is being run and 4 runners are near the lead. runner a has low glusocse levels in his muscles but his muscles are will oxygenated. runner b has low glucose leves in his muscles and anaerobic. runner C normal glusocse, well oxygenated, runner D normal glucose muscles anaerobic. assuming they are running at the same sped and have the same weight, is runner C or runner D using glusocse at the fastest rate
runner D is using glucose at the faster rate
the gene for black or grey body color in fruit flies has a recombination rate of 17% with the gene for vestigial wings. the gene for black or grey body color in fruit flies has a recombination rate of 9% with the gene for red or cinnabar eyes. which statement is true
the gene b is closer to the gene cn that the gene vg
what is transcription
the making of rna using dna as the guide
one characteristic shared by sucrose, lactose and maltose is
they are all disaccharides
genes that function in cell cycle checkpoint are ofter called
tumor suppressors
How do water molecules interact with a large molecules like a protein
water can form hydrogen bonds wiht the protein
Which of the carbon isotopes 12C, 13C, and 14C are found in nature and are naturally occuring
12 C, 13C, and 14C are all naturally occuring
flower color in snapdragons is an example of incomplete dominance. if a red flowered plant is crossed with a white flowered plant, the F1 generation has pink flowers. if a pink flowered pland crossed with a pink flowered plant, the progeny plants would be__-
25% red, 50% pink, and 25% white
What is the pH of a solution with a H+ concentration of 1x10^-8
8
what type of photosynthesis is done by sugar cane
C4-type photosynthesis
which of the following is a false statement with repect to celluose
Cellulose is a major food source for all animals becasue it is easily digested
