final genetics practice questions
c) A failure of the RNA polymerase to maintain an open complex
A mutation in TFIIIE could result in _________
constituative heterochromatin
Areas of the chromosome that remain highly condensed are called ______.
both directions
DNA polymerases add new nucleotides in what direction?
DNA methylation
Genomic imprinting is a result of ___________.
False
Negative transcriptional regulation is conducted by activator proteins.
mRNA
Translational regulatory proteins recognize specific areas of what molecule?
uracil
Which of the following is not found in DNA?
d) AUU
.......... select the codon that is not synonymous with CUU
only posterior structures
A Drosophila larva that develops from an oocyte that has no bicoid mRNA will have what developmental defect?
The transcript will not be produced
A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon?
Repressor + inducer
A gene is inducible and under negative control. Which of the following pairs will allow expression of this gene?
The function of condensin is to coat the chromosomes and condense them into heterochromatin through the compaction of the radial loops. The DNA does not need to be this compacted for most of the cell's life. Rather, it should remain as euchromatin. But during mitosis, the chromosomes need to be very condensed in order to properly segregate, as well as to prevent replication and transcription. For this reason, condensin is needed only during mitosis to create metaphase chromosomes. Because it functions by binding to chromosomes and "coating" them, condensin cannot remain in the nucleus except for when it is needed—during mitosis.
A molecule of DNA is one inch long when stretched out. How many nucleosomes are in this molecule of DNA?
Glucocorticoid receptor
A mutation in which of the following would result in little or no effect on the expression of a gene regulated by a CRE?
The person would be a male because the Y chromosome determines maleness in humans. He would have two Barr bodies in each cell because the counting of Xics allows just one X chromosome to remain active.
A person is born with three X chromosomes and one Y chromosome (XXXY). Would you expect this person to be a male or female? How many Barr bodies would you expect in their somatic cells?
d) bb and BB
A phenotypically non-bald woman and a bald man produce four bald sons and .... bald dauther. What are the most likely genotypes of the mother and father?
d) 1128 nucleotides
A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than
d) reverse transcriptase PCR
A scientist does not have an antibody to detect the protein of interest, but wants to know if the gene is expressed at low levels. What technique could the researcher use to detect, but not quantify the expression of the gene of interest?
d) a charged tRNA
A tRNA that has an amino acids attached is called ______
a) Reciprocal translocation
A translocation cross may occur in an individual that has a (n) _____________
b) Dolphins and false killer whales likely have the same number of
A wholphin is a rare hybrid animal born from mating a female bottlenose male false killer whale. Wholphins are diploid. Interestingly, wholphins ... can you conclude from the fact that wholphins are fertile?
30 %
According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain?
False
Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences.
a small molecule that fits into a site on the enzyme that is not the active site.
Allosteric regulation is accomplished by
carry more genes
Alternative splicing allows an organism to ___________.
transposable element
An Alu sequence is an example of what?
positive control
An activator is present and results in the increase in transcription of the target gene. This is an example of _______________. termination
a) epigenetic b) epigenetic c) usually both genetic and epigenetic e) epigenetic
Are the following examples best explained by genetic and/or epigenetic phenomena? a. imprinting of the Igf2 gene b. variation in coat color in mice carrying the Avy allele c. formation of cancer cells e. X-chromosome inactivation
c) usually both genetic and epigenetic d) genetic; it is due to variation in DNA sequences
Are the following examples best explained by genetic and/or epigenetic phenomena? c. formation of cancer cells d. variation in flower color between different strains of pea plants, such as purple versus white
inactive heterochromatin
Areas of the chromosome that remain highly condensed are called __________________
1
Bacterial DNA has how many origins of replication?
a) It inhibits DNA gyrase
Chemicals such as quinolones are anti-bacterial. How does it kill bacteria?
True
Constitutive genes are those that have constant levels of expression.
dispersive
DNA is packaged into nucleosomes in eukaryotes. The incorporation of histones into newly synthesized double helices is analogous to which of the three theories on replication?
10 million
DNA polymerase III has an error in replication once every _____ nucleotides.
a) DNA poly a
DNA polymerase III is the main replication enzyme in prokaryotes. What is it in eukaryotes?
False
DNA that contains instructions for two or more structural genes produces monocistronic mRNA. True
more than one of the above
DNA topoisomerase I does which of the following?
DNA POL III
Enzyme responsible for the majority of DNA replication in bacteria is ______________
the coding strand of DNA
Following transcription, the RNA has a complementary sequence of which of the following?
right, left
GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?
c) Left, right
GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5` end for the template and primer, respectively?
b) Interstitial deletion
Given the following sequence of genes on a chromosome, determine what change chromosome structure occurred. (the * indicates the centromere) before ABCD*EFGH after ACD*EFGH
1
How many Barr bodies would an individual with a XXY genotype possess?
b) 8
How many amino acids would be included in the polypeptide encoded by the following mRNA: 5`GCCACCAUGGGOCAAUUACGAAGGUUUUGCUGACCAGGUGAA3`
10
How many bases are necessary to complete one complete twist (360 degrees) of a DNA helix?
1
How many origins of replication are there in bacteria?
1
How many promoters are in an operon?
Transcription would be difficult to activate in the presence of glucose
If CAP could not bind to its CAP site, then what would be the result? Assume lactose is present in each scenario.
Glucose
If a bacteria is placed in an environment that contains both glucose and lactose, the regulation of the lac operon will allow which nutrient to be processed first?
A gene that is originally silenced in one cell but expressed in the other is silenced in the hybrid
If a cell is fused with another cell, which of the following would be the best example of a trans-mechanism of epigenetic control?
X - linked
If an allete is inherited on the X chromosome, but not the Y, it is said to be an example of __________
d) Telomeres
In eukaryotes, which of the following is similar to the oriC region of prokaryotes?
b) In the nucleolus
In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S ..... occurs where?
b) chromosome walking
In positional cloning, which method is used to identify clones that are progressively closer to a gene of interest?
α
In prokaryotes, a holozyme is formed when which of the following is added to the core enzyme?
e) enzymes
In the digestive system of animals, protein called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intenstine. What category of protein function do these proteins fall into?
mother's genotype
In the gene that affects snail coiling, the ______ is responsible for the phenotype of the offspring.
promoter, low
In the lac operon, the CAP site is located next to the ____________. When both lactose and glucose are present, this leads to a rate of transcription that is ___________.
False
In the lac operon, the operator site is recognized by an activator protein
e) Both paracentric inversions and pericentric inversions
Inversion loops can occur in ___________
IRE (see figure 16.4)
It is frequently desirable to experimentally regulate gene regulation and then study the consequences of expressing or suppressing the specific gene. To accomplish this, different gene sequences are fused to promoters or sequences that will be expressed as mRNA. Which of the following would most likely result in regulatable expression
c) Assist in synthesis of DNA from the lagging strand.
Okazaki fragments do which of the following?
meosis , cells
Oogeneis is a gametogenic process following ________ that produces___________
Prior to X-chromosome inactivation, pluripotency factors promote the expression of the Tsix gene. The expression of the Tsix gene inhibits the expression of the Xist gene.
Prior to X-chromosome inactivation, what prevents the expression of the Xist gene?
True
Repressor proteins are responsible for negative transcriptional regulation.
nucleosomes
The 30 nm fiber is formed from ____________.
Recessive ; dominant
The B allete (allete for baldness) behaves like a _________ allete in females and a ________ allete in males
maternal inheritance
The bicoid gene has what pattern of inheritance?
non - disjunction
The failure of chromosomes to seperate during anaphase is called ____________
False
The first morphogen gradient to provide positional information is established initially in the celluarized embryo.
True
The form of regulation that involves a physical change in the shape of an enzyme is called allosteric regulation
Pauling
The individual(s) who used ball and stick models to identify the three-dimensional structure of proteins was _______.
Avery, Macleod and McCarty
The individuals who determined that Griffith's transforming principle was DNA were __________.
True
The regulation of the CAP complex using cAMP is an example of inducible genetic regulation. True
positional information
Threshold concentration, morphogens, induction, and cell adhesion provide ________________ to a developing organism.
b) TFIIH
What basal transcription factor is a helicase?
b) Ribozymes
What enables the splicing of group I and II introns?
c) Tracking along DNA, separating double stranded DNA, synthesizing RNA primers
What functions are accomplished by the primosome ? (select best answer)
d) The nucleotide added is an adenine methylated at N7 and the bond is type phosphodiester bopnd with the terminal nucleotide
What is inusual about the 5` cap found on almost all eukaryotic mRNAs?
a) The allosteric model is that RNA pol II becomes destabilized after transcription the poly A signal sequence while the torpedo model is that the polymerase is physically removed from the DNA
What is the difference between the allosteric and torpedo models of eukaryotic transcriptional termination?
trpL
What is the gene responsible for attenuation in the trp operon?
tRNA nucleotidyl transferase
What is the name of the enzyme that adds CCA to the 3` end of tRNAs?
a) Convert from initiation to the elongation stage
What is the purpose of phosphorylating the carboxy terminal domain (CTD)?
c) The primers bind to complementary sequences of the template DNA
What occurs during the annealing stage of a PCR reaction?
U5
What snRNP holds the exons in place so that they can be connected after the intron is removed?
1-2 and 3-4
What stem-loop conformations favor attenuation?
5S rRNA
What transcripts are made by RNA polymerase I in eukaryotes?
Attenuation would not occur if tryptophan was high
What would be the result if the U-rich sequence after the fourth stem loop in the trp operon was replaced by a UG-rich sequence?
Epigenetic inheritance
Which inheritance pattern is common to oogenesis, spermatogenesis, and embryogenesis?
All are true statements with regards to mitochondria
Which of the following are false with regards to mitochondria?
c) Conservative
Which of the following best describes the mechanism of DNA replic parental strands remain together following replication?
Number of A's in polyA tail
Which of the following can control mRNA stability?
GRE
Which of the following is a region in DNA that binds to a steroid receptor?
Phosphorylation of an enzyme
Which of the following is an example of post translational regulation in prokaryotes?
c) The strands are initially separation , DNA helicase enzymes continue to unwrap the ..................
Which of the following is not correct concerning the initiation ....................?
Regulatory transcription factors
Which of the following recognizes response elements, control elements, and regulatory elements?
radial loop domain
Which of the following represents the lowest level of chromosome condensation?
c) Telocentric or acrocentric?
Which type of chromosome has the shortest parm of the chromosome?
2
You have available a dwarf male mouse with the genotype Igf-2m/Igf-2m and a dwarf female with the genotype Igf-2m/Igf-2. What is the minimum number of generations it would take to produce a normal male? Hint: mice inbreed happily.
semiconservative
You have isolated what appears to be alien DNA. While studying its replication, you performed the exact experiment Meselson and Stahl did. After three generations, the DNA is subjected to a CsCl gradient, and only one band appears. What type of replication does this DNA undergo?