genetic final review questions

Which of the following would inhibit amplification of DNA during the polymerase chain reaction?

0.5% SDS

This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splicesome. In addition, a splicing repressor prevents the recognition of the 3' splice site in exon 7. What exons will be present in the mature mRNA?

1, 2, 3, 4, 5, 6, 7, 8

An acceptable E-value for a nucleotide sequence alignment is

10^-6 or even smaller

How many codons would exist in a mRNA molecule coding for a protein 1,251 amino acids long?

1252

How many common amino acids are found in Eukaryotes?

20

Which of the plots below correctly depicts the amplification profile for a typical polymerase chain reaction?

2753

Below is a DNA sequencing chromatogram (in black and white) representing a short stretch of sequence using the Sanger method. What is the reverse complement of this sequence?

5'GCAAAGTCCAGCTGGCTC3'

What is the approximate length in base pairs for the PCR product in lane 3 of the agarose gel below?

625

The steps on the right take place to sequence DNA using dideoxy chain termination. What is the correct order?

7516432- DNA purification, denaturation, primer annealing, elongation, termination, electrophoretic separation, later detection

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

8

A gene codes for an 859 amino acid protein. One (1) in-frame insertion of three bases and three (3) in-frame deletions of nine (9) bases has occurred. How many codons would exist in the mRNA molecule of the mutated gene?

858

Which of the following best describes the addition of nucleotides to a growing DNA chain?

A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

Which of the following is a start codon found in a FASTA file?

ATG

BLAST stands for_________

Basic Local Alignment Search Tool

In an analysis of the nucleotide composition for any double stranded DNA molecules, which of the following relationships of the nitrogenous bases will not be found?

D (A + T) - (C + G) = 0 %

CpG islands are associated with which of the following?

DNA methylation

Genomic imprinting is a result of ___________.

DNA methylation

Which of the following statements about the 5' and 3' ends of a polynucleotide strand of DNA is correct?

Deteleted

Which region of DNA contains the coding information for a protein in a eukaryote?

Exons

If the gene was successfully transcribed, it's a guarantee that it will be translated

False

Several sequences from different species that align to one another may be

Homologous

The program BLAST would be best used for what purpose?

Identify related sequences to a given DNA sequence in a database

Which of the following is the most direct benefit of high-throughput Sanger sequencing?

Many DNA samples can be sequenced simultaneously.

What is the term for two genes from two different species that are similar in sequence and serve the same function in each species?

Orthologs

A protocol requires the addition of 12.6 µl of a solution. Which micropipette should be used for this?

P20

Which of the following attributes of a DNA molecule is crucial to its accurate duplication?

Specific base pairing

Below is the alignment between a mutant gene sequence against the wild type genome of an unspecified organism. What can be concluded?

The mutant gene has a 3 base deletion and a point mutation.

Genomic DNA was isolated from wild type flies and from flies with a mutation in single gene. PCR with identical conditions and forward and reverse primers that flanked the same region in the genome were used. Below is a gel analyzing the results: lane 1 is a 1Kb standard DNA ladder; lane 2 is wild type; and lane 3 is the mutant. Which of the following best explains the nature of the mutation?

The mutant has a deletion of about 330 bp

DNAse is an enzyme that catalyzes the hydrolysis of the covalent bonds that join nucleotides together. What would first happen to DNA molecules treated with DNAase?

The phosphodiester bonds between deoxyribose sugars would be broken.

Two equal peaks, larger than the others, in a FinchTV chromatogram indicates

Two of the bases can be ruled out as being located at that position

What are the three stop codons?

UAA, UAG, UGA

Of the following, which is the most fundamental description of a gene?

a DNA sequence that is expressed to form a functional product: either RNA or polypeptide

Sequencing an entire genome, such as that of C. elegans, a nematode, is most important because___________________

a sequence that is found to have a particular function in the nematode is likely to have a closely related function in vertebrates.

A SNP would best be described as __________.

a single nucleotide difference between two DNA sequences

Mutations in the 5' UTR can:

all of the above

A limitation to the polymerase chain reaction is that it

c

Amino acids froma hypothetical protease from Homo sapiensare compared to the same protease in other species using the BLAST program.The following results are obtained. The sequence from which species has the highest E value?

catodon SSTNQLLKHRSAALSTMVIITNQKRSAA

When a scientist is attempting to use haplotype analysis to link a disease-causing allele to a molecular marker, it is important for the marker to be close to the disease-causing allele, otherwise __________ may occur.

crossing over

Which of the following is unique to DNA sequencing reactions and not present in PCRs?

dideoxynucleoside triphosphates

DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration.

false

Heterozygosity and heterogeneity are synonyms and describe the state of an individual that has both the dominant and the recessive alleles.

false

Map units correspond to fixed physical distances.

false

Single Nucleotide Polymorphisms (SNPs) alterations in the non-coding DNA sequences can lead to some types of cancer.

false

The phenomenon in which a particular type of disease or trait may be caused by mutations in two or more different genes is called multiple gene action.

false

If mutations in two different genes give rise to a single disease then the disease exhibits

locus heterogeneity

Which RNA encodes the sequence of amino acids for a functional protein?

mRNA

The experimental process of determining the relative location of genes or other segments of DNA along individual chromosomes is called __________.

mapping

Haplotype mapping would be least useful in the study of __________.

monozygotic twins

Which of the following DNA molecules would require the most heat to separate? Note only one strand is shown, the other strand would be the complement.

requires highly purified DNA as a template.

PCR primers are short segments of deoxyribonucleotides. What functions as natural primers during DNA replication in eukaryotic cells?

short segments of ribonucleotides

An acceptable E-value for an amino acid sequence alignment is

smallest number

You have purified a novel protein from Drosophila virilis and obtained the partial amino sequence: PLEASEHELPMEASAP. To find the gene DNA sequence through NCBI BLAST, which of the following search programs should you use?

tblastn

Thomas Hunt Morgan didn't know about the specific structure of DNA. However, which of Morgan's contributions were necessary when Watson and Crick proposed a model for DNA structure?

the particulate nature of the hereditary material

The genetic information of DNA is contained in

the sequence of nucleotides along the length of the two strands of the DNA molecule.

One of the characteristics of retrotransposons is that

they code for an enzyme that synthesizes DNA using an RNA template.

Genome wide association studies are used __________.

to identify single nucleotide polymorphisms that are near disease causing genes

Before the discovery of PCR, it was very difficult to isolate single genes.

true

If a portion of a transcription factor's domain is structurally similar in a variety of organisms, it is called a motif.

true

In sequencing by synthesis (SBS) methods, the sequence of a sample is directly determined as nucleotides are incorporated into a DNA strand by DNA polymerase.

true

Mutations that happen in the Untranslated regions (UTRs) could affect the phenotype

true

Pseudo exons are sequences that used to be exons but have changed by mutation.

true

This pre-mRNA contains 8 exons and 7 introns. A mutation that happens in intron 2 can have an effect on the sequence of the resulting protein

true

Suppose you have just discovered a Drosophila gene that has a sequence similar to a gene of interest in humans. You need to have mutants of the Drosophila gene because___________

you need to see whether the Drosophila mutant disrupts the same metabolic pathway.