genetics ch. 14

The transcriptional start site is denoted +1. -1. 0.

+1.

In humans, the long 45S rRNA transcript is cleaved to produce which of the following? 11.2S 5.8S 30S 15S 28S 18S

18S 28S 5.8S

The template strand is read in the ______ direction, and the synthesis of the RNA transcript occurs in a ______ direction. 3'-to-5'; 3'-to-5' 5'-to-3'; 5'-to-3' 5'-to-3'; 3'-to-5' (RNA polymerase catalyzes synthesis of the transcript in a 5'-->3' direction.) 3'-to-5'; 5'-to-3'

3'-to-5'; 5'-to-3'

During transcription, RNA is synthesized in what direction? 5' to 3' for all genes 3' to 5' for some genes, and 5' to 3' for other genes 3' to 5' for all genes (New RNA molecules are transcribed in the 5' to 3' direction.) 5' to 3' in prokaryotes, and 3' to 5' in eukaryotes 3' to 5' in prokaryotes, and 5' to 3' in eukaryotes

5' to 3' for all genes

What is the consensus sequence of the following five DNA molecules? 5'-GGGAGCG-3' 5'-GAGAGCG-3' 5'-GAGTGCG-3' 5'-GAGAACG-3' 5'-GAGAGCA-3' 5'-GAGAACG-3' 5'-GAGTGCG-3' 5'-GAGAGCG-3' 5'-GGGAGCG-3'

5'-GAGAGCG-3'

The template strand of a gene has the sequence: 5'-ATTGCC-3'. What is the sequence of the transcribed mRNA? 5'-UAACGG-3' (Recall that the sequence is read from 3'-->5' to produce the RNA product oriented 5'-->3'.) 5'-UAAGCC-3' 5'-GCCAAU-3' 5'-AUUGCC-3' (Remember that the mRNA that is synthesized will be complementary to the template strand of DNA.) 5'-CCGUUA-3' 5'-GGCAAU-3'

5'-GGCAAU-3'

*Figure 14.18 Mechanisms of RNA splicing* Match the letter to the correct intron. A B C Group I intron Group II intron Pre-mRNA intron

A -> Group I intron B -> Group II intron C -> Pre-mRNA intron

During transcription, a T on the template DNA strand is paired with a(n) ___in the mRNA, and an A on the template DNA strand is paired with a(n) _____in the mRNA.

A and U

What is a promoter? A regulatory protein that accelerates mRNA turnover. A specific target sequence to which RNA polymerase binds. An environmental chemical that induces gene expression. An element that facilitates termination of transcription.

A specific target sequence to which RNA polymerase binds.

*Figure 14.7 The Initiation stage of transcription in bacteria* The initiation stage of bacterial transcription is shown in this figure. Match the letter to its appropriate description. A B C D Closed Complex Open Complex RNA polymerase core enzyme Sigma factor

A-> Closed Complex B-> Open Complex C-> Sigma Factor D-> RNA polymerase core enzyme

The terminator is a DNA sequence that specifies the end of translation. molecule that binds to RNA polymerase to end RNA synthesis. molecule that binds to a ribosome to end protein synthesis. DNA sequence that specifies the end of transcription.

DNA sequence that specifies the end of transcription.

Transcription factors are proteins that bind to DNA sequences and control the rate of transcription. RNA molecules during transcription in order to stabilize them. RNA polymerase and control transcription. (Control of transcription relies on proteins that recognize specific DNA sequences.) RNA molecules after transcription in order to enhance their conversion into proteins.

DNA sequences and control the rate of transcription.

The central dogma of genetics can be summed up by which of the following? mRNA → polypeptide → DNA DNA → mRNA → polypeptide DNA → polypeptide → mRNA mRNA → DNA → polypeptide polypeptide → mRNA → DNA

DNA → mRNA → polypeptide

True or false: A gene is a DNA segment that is used to make a polypeptide only. True (Some genes are used to make functional RNAs, such as rRNA and tRNA.) False

False

True or false: Transcription occurs in two stages: initiation and termination. True (Transcription occurs in three stages: initiation, elongation and termination.) False

False

Who proposed the existence of messenger RNA in 1961? Jacob and Monod Hershey and Chase Meselson and Stahl Watson and Crick

Jacob and Monod

Which sequences of bacterial promoters are particularly important for transcription initiation? The -35 site: 5' TATAAT 3' The -25 site: 5' TATAAT 3' The -35 site: 5' TTGACA 3' The -25 site: 5' TTGACA 3' The -10 site: 5' TATAAT 3' The -10 site: 5' TTGACA 3'

The -35 site: 5' TTGACA 3' The -10 site: 5' TATAAT 3'

The rho-dependent mechanism of transcription termination requires what? Helicase activity to separate the DNA-RNA complex A uracil-rich sequence located at the 3' end of the mRNA The presence of a stop codon in the mRNA The formation of a stem-loop structure

The formation of a stem-loop structure Helicase activity to separate the DNA-RNA complex

The term closed complex refers to what? The binding of the ribosome to the mRNA to initiate translation The final binding of the DNA to the newly-synthesized mRNA The initial binding of the RNA pol holoenzyme to the promoter The binding of the RNA pol core enzyme to the DNA

The initial binding of the RNA pol holoenzyme to the promoter

In a chromosome, which of the following statements is TRUE? The mRNAs of different genes can be transcribed off either DNA strand of the double helix, but always synthesized in the 5′ --> 3′ direction. The mRNAs of all genes are synthesized 3′ --> 5′ off the same DNA strand of the double helix. The mRNAs of different genes can be transcribed off either DNA strand of the double helix, but always synthesized in the 3′ --> 5′ direction. Different genes can be transcribed off either strand of the double helix, some in the 5′ --> 3′ direction and some in the 3′ --> 5′ direction. The mRNAs of all genes are synthesized 5′ --> 3′ off the same DNA strand of the double helix.

The mRNAs of different genes can be transcribed off either DNA strand of the double helix, but always synthesized in the 5′ --> 3′ direction.

What marks the transition to the elongation stage of transcription in bacteria?. The release of the sigma factor from the RNA pol holoenzyme The release of the rho factor from the RNA pol holoenzyme The formation of an open complex between RNA pol and DNA (The open complex forms before the sigma factor is released.) The formation of a closed complex between RNA pol and DNA

The release of the sigma factor from the RNA pol holoenzyme

Intrinsic termination is a term used for the type of transcription termination in eukaryotes that does not require mediator protein. bacteria that does not require mediator protein. eukaryotes that does not require rho protein. (Rho protein is only used in termination of transcription in bacteria.) bacteria that does not require rho protein.

bacteria that does not require rho protein.

The flow of genetic information in a cell, from DNA to RNA to protein, is described as the ___ _____of genetics.

central dogma

Transcription in E. coli is initiated when the sigma factor of the RNA pol holoenzyme binds to the promoter region to form a(n) ___ ____

closed complex

For protein-encoding genes, the nontemplate strand is also called ____ the strand.

coding

A triplet of nucleotides that corresponds to an amino acid is known as a(n) codon. exon. intron. operon.

codon

The mRNA contains groups of three nucleotides that specify the amino acid sequence of a polypeptide. These three-nucleotide groups are called ____-

codons

The most commonly occurring bases within a specific type of sequence is called the ____ sequence.

consensus

In E. coli, the RNA polymerase holoenzyme is composed of the apoenzyme plus rho factor. core enzyme plus rho factor. apoenzyme plus sigma factor. sigma factor plus rho factor. (Rho factor is involved in the termination of transcription of some prokaryotic genes.) core enzyme plus sigma factor.

core enzyme plus sigma factor.

E. coli employs two different mechanisms for transcription termination: rho- ____and rho- ____termination.

dependent and independent

Sequences in DNA that are present in mature mRNA and which code for polypeptides are called ___

exons

Coding sequences that are present in the mature mRNA are termed exons. prions. operons. introns.

exons.

An enzyme that cleaves a covalent bond between two nucleotides at one end of a strand is called a(n) _____

exonuclease

In E. coli, the core enzyme of RNA polymerase is composed of four subunits: αβγσ. five subunits: αδββ'ω. five subunits: α2ββ'ω. four subunits: αβ2θ.

five subunits: α2ββ'ω.

A DNA segment that encodes a functional product, either an RNA molecule or a polypeptide, is termed a(n) ____

gene

At the molecular level, ______ is the process by which a gene's information is used to produce a polypeptide or functional RNA molecule. gene expression genomic imprinting gene manifestation genomic editing

gene expression

The overall process by which the information within a gene is used to produce a functional product is called ___ _____

gene expression

The nontemplate strand is also called the coding strand because it has the same sequence as the mRNA but with A's instead of T's. has the same sequence as the mRNA but with A's instead of U's. is complementary and parallel to the mRNA. has the same sequence as the mRNA but with T's instead of U's. is complementary and antiparallel to the mRNA.

has the same sequence as the mRNA but with T's instead of U's.

The association of a sigma factor with the core enzyme forms a complex referred to as the RNA polymerase ___

holoenzyme

*Figure 14.10 The process of p-dependent termination* This figure highlights rho- or termination of transcription in bacteria.

independent and intrinsic

*Figure 14.7 The Initiation stage of transcription in bacteria* This diagram shows the ______. elongation stage of transcription in eukaryotes elongation stage of transcription in bacteria initiation stage of transcription in eukaryotes initiation stage of transcription in bacteria

initiation stage of transcription in bacteria

The three stages of transcription are called __,____ , and ______.

initiation, elongation and termination

Rho-independent termination of transcription is also known as ____ termination.

intrinsic

Sequences that are found between exons are called ____

introns

Noncoding sequences that are initially transcribed into mRNA are termed introns. operons. exons. anticodons.

introns.

The transcriptional product of a protein-encoding gene is a(n) __ molecule. rRNA polypeptide (A polypeptide is produced through translation of the first product of the gene.) tRNA mRNA

mRNA

The ribosome-binding site is a sequence in bacterial ______ that is involved in ______. DNA ; transcription initiation (Ribosomes bind to RNA and carry out translation.) mRNA ; translation initiation DNA ; transcription termination (Ribosomes bind to RNA and carry out translation.) mRNA ; translation termination

mRNA ; translation initiation

In prokaryotes, a protein-encoding gene is transcribed into an RNA molecule called ___ RNA.

messenger

The nucleotides preceding the transcriptional start site are numbered in a _______ direction, while those that come after it are numbered in a _______ direction. 5' to 3' ; 3' to 5' (Polarity of one strand of the DNA helix does not change on either side of the transcriptional start site.) 3' to 5' ; 5' to 3' (Polarity of one strand of the DNA helix does not change on either side of the transcriptional start site.) positive ; negative (The DNA region coding for the RNA transcript starts with +1.) negative ; positive

negative ; positive

In eukaryotes, the assembly of ribosomal subunits occurs in a site within the nucleus called the ___

nucleolus

Following the binding of RNA polymerase to the promoter, the DNA is denatured into a bubble known as the _____ ___

open complex

The formation of a stem-loop structure and the requirement for a helicase are characteristic of bacterial genes that undergo____ -____ termination of transcription.

p-dependent

A structural gene encodes a(n) polypeptide. rRNA molecule. tRNA molecule.

polypeptide.

In E. coli, the transcription termination of certain genes requires an RNA-binding protein called ___

rho protein

A stem-loop structure followed by a stretch of U nucleotides in the 3'-end of a bacterial mRNA are characteristic of genes that undergo rho-independent termination of transcription. capping and polyadenylation. alternative splicing and RNA editing. rho-dependent termination of transcription. (rho-dependent termination requires the rut sequence for rho protein binding and a GC rich terminator sequence.)

rho-independent termination of transcription.

The nucleolus in eukaryotes is the site of processing of ribosomal RNA. messenger RNA. (mRNA is processed in the nucleus, rather than within the nucleolus.) small RNA. transfer RNA.

ribosomal RNA.

In bacteria, a short sequence in the mRNA provides a location that recruits the machinery to start translation. This sequence is called the ____-____ site.

ribosome-binding

An RNA molecule that has catalytic activity is called a(n) ___ _

ribozyme

The enzyme that synthesizes RNA from a DNA template is called ___ ___

rna polymerase

During rho-dependent termination of transcription, the sequence that serves as a recognition site for the binding of the rho protein is called the ____ site.

rut

The removal of introns where RNA functions as its own ribozyme is a process called self-splicing. auto-splicing. complementary-splicing. alternative-splicing.

self-splicing.

The transition from the initiation to the elongation phase of bacterial transcription is marked by the release of the _____ ____

sigma factor

The process by which introns are removed and exons are connected together is called RNA ____

splicing

The synthesis of a polypeptide molecule from an mRNA template is called ___

translation

The process of RNA splicing joins together two exons. two introns. two DNA molecules. a DNA and an RNA molecule. an exon and an intron. (Introns are removed during RNA splicing.)

two exons.

Match the subunit of the bacterial RNA polymerase to its appropriate function. α2 β and β' ω σ Proper assembly of the holoenzyme Recognition of the promoter Proper assembly of the core enzyme Catalytic synthesis of the RNA

α2-> Proper assembly of the holoenzyme β and β' -> Catalytic synthesis of the RNA ω -> Proper assembly of the core enzyme σ -> Recognition of the promoter

Which regions of a bacterial promoter play a key role in promoting transcription? -35 and -10 -25 and +1 -35 and -75 -75 and -35 -100 and -10

-35 and -10

The following numbers represent the order of nucleotides in a bacterial promoter, going from left to right. Which of these is a correct representation of the conventional numbering system? -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 (No base is numbered zero.) +5 +4 +3 +2 +1 -1 -2 -3 -4 -5 (The numbering of nucleotides to the left of the transcriptional start site is in a negative direction.) -5 -4 -3 -2 -1 +1 +2 +3 +4 +5 +5 +4 +3 +2 +1 0 -1 -2 -3 -4 -5 (No base is numbered zero and the +/- signs should be reversed.)

-5 -4 -3 -2 -1 +1 +2 +3 +4 +5

Part of the coding region of a gene is shown here: 5' TTCCCATTTCGATGGGATACGATGG 3' 3' AAGGGTAAAGCTACCCTATGCTACC 5' What is the sequence of the transcribed mRNA, assuming transcription proceeds left to right? 3' UUCCCAUUUCGAUGGGAUACGAUGG 5' (The template strand is oriented 3'-->5' so the transcribed RNA is oriented 5'--> 3'.) 5' AAGGGUAAAGCUACCCUAUGCUACC 3' 5' UUCCCAUUUCGAUGGGAUACGAUGG 3' 3' AAGGGUAAAGCUACCCUAUGCUACC 5' (Recall that the mRNA would be produced from 5'--> 3' using the DNA template strand that is oriented 3'-->5'.) 5' TTCCCATTTCGATGGGATACGATGG 3'

5' UUCCCAUUUCGAUGGGAUACGAUGG 3'

RNA polymerase catalyzes the formation of a bond between the ______ group of one nucleotide and the ______ group on the previous nucleotide. 3' hydroxyl; 5' phosphate (New RNA molecules are transcribed in the 5' to 3' direction. Thus, the 5' phosphate of the incoming nucleotide binds to the 3' hydroxyl of the previous nucleotide.) 5' phosphate; 3' hydroxyl 5' hydroxyl; 3' phosphate 3' phosphate; 5' hydroxyl

5' phosphate; 3' hydroxyl

The rho-independent mechanism of transcription termination requires what? Helicase activity to separate the DNA-RNA complex A uracil-rich sequence located at the 3' end of the mRNA The presence of a stop codon in the mRNA The formation of a stem-loop structure

A uracil-rich sequence located at the 3' end of the mRNA The formation of a stem-loop structure

The complementarity rule used in transcription is similar to the ______ rule, except that ______ substitutes for thymine in the RNA. AT/GC; uracil AT/GC; inosine AG/CT; inosine AG/CT; uracil

AT/GC; uracil

In mammals, the ribosomal RNA gene is transcribed by RNA polymerase ____ to make a long primary transcript known as _____rRNA. This transcript is then cleaved into _____ smaller fragments.

I and 45S and three

Francois Jacob and Jacques Monod hypothesized the existence of what molecule? Ribosomal RNA (They proposed a type of molecule that would provide information for making a specific protein.) Transfer RNA Messenger RNA Single-stranded DNA

Messenger RNA

Transcription is the process of synthesizing DNA from an RNA template. protein from a DNA template. RNA from a DNA template. protein from an RNA template.

RNA from a DNA template.

Which enzyme synthesizes RNA during transcription? RNA replicase DNA replicase RNA polymerase DNA polymerase

RNA polymerase

Sidney Altman and his colleagues discovered that the RNA subunit of which enzyme(s) had catalytic activity? RNaseP and RNaseD RNA polymerase II RNaseD RNaseX RNaseP

RNaseP

In E. coli, tRNAs are synthesized as large precursor tRNAs that must be cleaved to produce mature, functional tRNAs that carry amino acids. The processing of precursor tRNA molecules typically involves an endonuclease called ______, and an exonuclease called ______. RNaseD ; RNaseP (RNaseP is an endonuclease.) RNaseP ; RNaseD RNaseD ; RNaseX RNaseP ; RNaseX (RNaseD is involved in this process.) RNaseX ; RNaseD

RNaseP ; RNaseD

Which of the following are the two mechanisms of transcription termination in E. coli? Energy-independent termination Sigma-independent termination Energy-dependent termination Rho-dependent termination Sigma-dependent termination Rho-independent termination

Rho-dependent termination Rho-independent termination

The DNA sequence that directs the exact location where transcription begins is called the ____

promoter

The RNA polymerase holoenzyme is composed of several subunits including sigma factor whose primary role is to recognize the ___

promoter

The sequence in DNA that signals RNA polymerase where to begin transcription is called the ___-

promoter

Transcription is initiated by the binding of one or more transcription factors to the ____ region of a gene. Listen to the complete question

promoter

The sequence of a gene's DNA that is transcribed starts from the ___ and extends to the ____.

promoter and terminator

In a gene, the DNA is transcribed into RNA from the end of the start codon to the stop codon. (Translation proceeds from the start codon to the stop codon.) start codon to the terminator. (The transcription start site is near the end of the promoter.) promoter to the stop codon. (The transcription terminator is located beyond the code for the stop codon.) promoter to the terminator.

promoter to the terminator.

Structural genes are also known as ____-encoding genes.

protein

Translation is the process of synthesizing protein from an RNA template. RNA from a DNA template. DNA from an RNA template. protein from a DNA template.

protein from an RNA template.

The group of three nucleotides that signals the beginning of translation is called the ___ ____

start codon

The end of protein synthesis is specified by a ____ ___, which is a triplet of nucleotides in the mRNA molecule.

stop codon

The base sequence of the RNA transcript is complementary to the ___ strand of DNA.

template

The synthesis of an RNA molecule from a DNA template is called ____

transcription

*Figure 14.10 The process of p-dependent termination* What is shown in this figure? Rho-dependent transcription termination in bacteria (The image is depicting Rho-independent termination. Note that the ρ protein is not required.) Rho-independent transcription termination in bacteria The torpedo model of transcription termination in eukaryotes The allosteric model of transcription termination in eukaryotes

Rho-independent transcription termination in bacteria

The strand of DNA that is transcribed into RNA is called the ______ strand, while the opposite strand of DNA is called the ______ strand or non-template. coding; noncoding (The non-template strand is designated as coding because its sequence is similar to mRNA, except T is in the places where U would be in the mRNA.) noncoding; template template; coding coding; template

template; coding

The rho factor is most important for synthesizing primers for transcription. binding of the RNA polymerase to the promoter. (Sigma factor is involved in transcription initiation while rho factor is involved in transcription termination.) proofreading of the mRNA by RNA polymerase. termination of transcription. rapid movement of the RNA polymerase along the DNA.

termination of transcription.

The rut site serves as a binding site for the rho protein during transcription termination in bacteria. ribozymes involved in RNA splicing in eukaryotes. ribosomes involved in protein synthesis in eukaryotes. RNA polymerase during transcription initiation in bacteria.

the rho protein during transcription termination in bacteria.

Proteins that bind to DNA and control the rate of RNA synthesis are collectively called _____ ______

transcription factors

The first DNA base used as a template for RNA synthesis is called the ____ ___ site.

transcriptional start

The _______ is the first DNA base used as a template for RNA synthesis. translational start site initiator transcriptional start site promoter (The promoter region is longer than a single DNA base.)

transcriptional start site

The +1 site in DNA typically designates the first base used as a template for RNA transcription. used as a template for DNA replication. of the promoter region of a gene. of the coding region of a gene.

used as a template for RNA transcription.

Which of these subunits are found in the RNA pol core enzyme of E. coli? Multiple select question. α β β' δ ω σ

α β β' ω