Genetics Exam 3 (ch. 16-21)
What is required for PCR?
-DNA polymerase -All four nucleotides -Target DNA AND -Primers
The Ames test determines the frequency with which a chemical causes mutations in DNA. Given below are the results of the Ames test for three substances X, Y, and Z. Label the carcinogenic potential of each of these substances based on the production of his+ revertants in the presence or absence of liver extract (-+ LE).
1st strain- carcinogenic 2nd strain- non-carcinogenic 3rd strain- undetermined
When tryptophan concentrations are high in an E. coli cell, what happens?
All of the above: -Tryptophan binds the repressor and it can repress trp operon transcription -Attenuation causes premature termination of transcription of the trp operon AND -The tryptophan synthesis genes are not transcribed
The presence (+) or absence (-) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A-E) is indicated in the following table. (Refer to image) Using these markers, place the BAC clones in their correct order and indicate the locations of the numbered sequences within them. BAC B has been placed as a reference point.
Answer in image
Honeybee queens and workers come from larvae that differ only in that queens are fed royal jelly, which:
Both A and B: -causes silencing of a gene (Dnmt3). -causes increased expression of a number of genes.
Low levels of glucose lead to all of the following, EXCEPT that:
CAP-cAMP loses its affinity to DNA
Interpret the chain-terminating dideoxynucleotide polyacrylamide sequencing gel below by assigning the individual bases in order next to the DNA bands.
GCCTGAGACTGGGCACTGCA
Epigenetics is the study of:
Inheritance of traits not coded by DNA sequence
The human genome and invertebrate genomes encode similar numbers of protein domains, yet the human genome encodes many more proteins. How can the human genome encode more proteins using the same number of protein domains?
The human genome uses more combinations of the same domains.
In the presence of allolactose, the lac repressor _________.
cannot bind to the operator
For the Escherichia coli lactose operon genotypes listed, + indicates a functional component, - indicates a nonfunctional component, superscript C indicates a constitutively active component, and superscript S indicates a component that is unresponsive to an inducer. Genotypes written on two lines and separated by a slash represent the bacterial chromosome and an additional circular DNA strand, called a plasmid. For each E. coli strain shown on the table, use a plus sign (+) to indicate the synthesis of β-galactosidase (β-gal) and permease and a minus sign (-) to indicate no synthesis of these proteins. No glucose is present.
Study the photo
Approaches to bioinformatics include:
All of the above: -analyzing sequences for characteristics of genes, such as open reading frames -comparison of sequences to known genes AND -annotation to indicate distribution and other characteristics of a gene
Order the steps required to analyze gene expression from a particular cell type using a DNA microarray.
*First step* -extract mRNA from cells -reverse transcribe mRNA to cDNA -label cDNA with a chemilumiscent molecule -add cDNA to microarray and incubate -wash away unbound cDNA -visualize microarray and analyze resulting data *Last step*
Shotgun sequencing does NOT:
depend on physical or genetic maps
A typical operon contains several regions. In which region does a regulator protein bind?
operator
Which of the following types of gene mutation in a protein-coding gene usually have the least-severe (i.e., deleterious) phenotype?
silent substitutions
A cross between the light pigmentation F1 individual in the figure and a dark pigmentation corn plant with genotype B-I B-I will produce progeny with what phenotype? (Refer to image)
all light pigmentation
siRNA and miRNA inhibit gene expression by all of the following EXCEPT:
stabilizing translation machinery
Place the steps of DNA methylation maintenance in order from first to last. -The replicated DNA strand is synthesized unmethylated. -Prior to replication, CpGs are fully methylated. -Any unmethylated DNA is methylated. -Fully methylated DNA is produced. -Methyltransferase binds to DNA methyl groups.
*First step* -Prior to replication, CpGs are fully methylated. -The replicated DNA strand is synthesized unmethylated. -Methyltransferase binds to DNA methyl groups. -Any unmethylated DNA is methylated. -Fully methylated DNA is produced. *Last step*
Plasmids are small circular DNA molecules found in bacteria that replicate separately from chromosomes. Why are plasmids essential for recombinant DNA technology?
DNA from a gene of interest can be inserted into a plasmid, then the modified plasmid can be inserted into a bacterial cell to replicate a gene of interest many times.
All of the cells in the human body contain the same genes. How do cells have different morphologies and functions when they contain the same genetic information?
Different cell types express particular genes at different levels.
What would be required to prove that a phenotype is caused by an epigenetic change?
The phenotype must be heritable with modified chromatin and an unaltered nucleotide sequence.
In the figure below, Bob and Joe are homozygous for different restriction fragment patterns. The restriction enzyme cuts the sequence GGCC. How many gel bands would you expect to see after restriction digestion of DNA from a person heterozygous for patterns A and B?
4 bands
Which of the following is not required for PCR?
DNA ligase
Which of the following is not true regarding DNA gel electrophoresis?
Larger DNA fragments will migrate farther than will smaller DNA fragments.
Select the best example of transgenerational epigenetic inheritance.
Offspring of rats with high-fat diets were fed a low-fat diet and had normal weights, but still developed symptoms of diabetes.
Consider the same partial diploid (lacI+ O+ lacZ+ lacY-/lacIS Oc lacZ- lacY+). Under what conditions will this strain make permease?
constitutively
When present in small amounts in sequencing reactions, dideoxyribonucleoside triphosphates (ddNTPs) terminate the sequencing reaction at different positions in the growing DNA strands. ddNTPs stop a sequencing reaction because they _____.
lack a hydroxyl (-OH) group at their 3′ end
Compared to the original Sanger method of DNA sequencing, next-generation sequencing methodologies _____.
Both a and b: -have made sequencing faster -allow hundreds of thousands to millions of DNA fragments to be simultaneously sequenced
Consider the following partial diploid strain of E. coli: lacI+ O+ lacZ+ lacY-/lacI+ Oc lacZ- lacY+. Under what conditions will this strain make b-galactocidase?
only when lactose is present
How can microRNAs (miRNAs) regulate gene expression?
prevent translation by binding to mRNA and degrading the mRNA strand
The human genome contains three genes for enolase (a, b, g), whereas yeast contains just one gene for enolase. The three human enolase genes are __________ of each other, whereas the human and yeast enolase genes are __________ of each other.
paralogs; orthologs
A mutation at the operator site of an operon prevents the repressor from binding. (A) What effect will this mutation have on transcription in a repressible operon? (B) What effect will this mutation have on transcription in an inducible operon?
(A) The operon will always be transcriptionally active. (B) The operon will always be transcriptionally active.
The lac operon consists of a promoter that initiates transcription of the gene i, which encodes a repressor protein. A seperate promoter, p, within the operon initiates transcription of z, which encodes B-galactosidase, and y, which encodes permease. The operator, o, where the repressor protein binds to inhibit transcription, is positioned between mutations, whereas superscript c denotes a constitutively active mutant. The table below describes the activity of B-galatosidase and permease for haploid and diploid mutant strains. (Refer to image) Match the dominant type of regulation controlling permease expression to each mutant strain. -cis -trans -cannot determine
-Strain 1 —> cis -Strain 2—> trans -Strain 3—> cis -Strain 4—> trans -Strain 5—> cis -Strain 6—> cis
What is true regarding DNA gel electrophoresis?
-The agarose gel acts as a molecular sieve separating DNA fragments based on size. - By passing an electrical current through the gel, DNA fragments move toward the positive end. - Fragments of known size are used to measure the size of the sample DNA. AND - DNA needs to be stained in order to be visualized.
A new mutagen is able to cause frameshift mutations. Which kind of mutagen would be capable of reversing this mutation?
intercalating agent
What technique would be most useful and efficient in comparing the different gene-expression patterns between different developmental stages of mouse embryogenesis?
Microarray analysis/ RNA sequencing
An insertion sequence contains a large deletion in its transposase gene. Under what circumstances would this insertion sequence be able to transpose?
There is another transposable element of the same type present in the cell and it expresses a functional transposase enzyme.
What generally causes thymine dimers to form in a strand of DNA, and why are thymine dimers a problem?
Ultraviolet light can cause thymine dimers, potentially creating a mutation that could lead to cancer
A mutation in gene X overrides the effect of a previous mutation in gene Y and restores wild-type phenotype. The mutation in gene X is called a(n):
intergenic suppressor mutation
Complete the sentence. Histone proteins
regulate gene expression by reducing the rate of transcription.
The trp operon contains five genes: trpE, trpD, trpC, trpB, and trpA. These five genes code for components that produce three enzymes that catalyze the biosynthesis of tryptophan. The trpL region is the leader region, which helps regulate transcription once RNA polymerase has initiated transcription. (Refer to picture) The trp operon also undergoes negative regulation by a repressor. Tryptophan is the signal molecule (effector molecule) that binds to the repressor. Determine which events lead to an increase in transcription. The trp operon is transcribed when...
-the trp repressor dissociates from DNA. AND -trp is present at low concentrations inside the cell.
Suppose a researcher decides to sequence a short fragment of DNA. She uses polymerase chain reaction (PCR) and a series of four dideoxy reactions. She then separates the products of the reactions using gel electrophoresis and obtains the banding pattern below. Enter the sequence of the original template strand in the 5' to 3' direction.
5'- AGCTGCATC -3'
Electrophoresis gels are used to separate DNA fragments. Match the DNA fragment size, in base pairs (bp), to each band on the electrophoresis gel. A DNA ladder with known fragment sizes is visible in Lane 1. The sizes of the most intense bands in the ladder are provided to the left. Electrode charge is indicated to the right of the gel.
5,000-> 2,250-> 500
The yeast Saccharomyces cerevisiae has several genes encoding enzymes that function in the importation and metabolism of galactose. The genes are located on several chromosomes, and are transcribed separately. The GAL genes have similar promoters, and gene transcription is under regulation by the proteins Gal3p, Gal4p, and Gal80p. Place the following statements about GAL gene regulation in the correct order, starting from conditions with an absence of galactose through conditions with abundant galactose. You will only place five statements. -Gal3p binds to promoter as an activator -Gal3p associates with Gal80p -galactose binds Gal3p -Gal4p, in complex with Gal80p, is bound to DNA -Gal3p interacts with Gal4p, relieving inhibition -Gal80p inhibition of Gal4p is abated -galactose binds Gal80p, inhibiting it -Gal4p is freed to function as an activator at GAL promoters -GAL80p is bound to DNA
Answer in photo
Determine which of the genomic traits below are associated with prokaryotes or eukaryotes. These traits include relative genome size, number of genes, gene density, and number of exons. -about one gene every 2000 to 100,000 bp -about one gene every 1000 bp -relatively large, variable size genome -relatively small genome -multiple introns -few, if any, introns -500 to 7000 genes -6000 to 30,000 genes
Prokaryote: -relatively small genome -500 to 7000 genes -about one gene every 1000 bp -few, if any, introns Eukaryote: -relatively large, variable size genome -6000 to 30,000 genes -about one gene every 2000 to 100,000 bp -multiple introns
To activate the transcription of permease (and the whole lac operon) lactose needs to be present in the cell. How can lactose get in the cell when the permease gene is not activated?
The repressed lac operon is never completely repressed.
A geneticist is interested in the immune function of mice and induces random mutations in a number of specific genes in mice and then determines which of the resulting mutant mice have impaired immune function. This is an example of ________.
reverse genetics
Match the description of transcriptional control to the corresponding transcriptional regulator. There is one description for each transcriptional regulator. (A) Active Repressor (B) Inactive Repressor (C) Active activator (D) Inactive activator (1) positive control in an inducible operon (2) negative control in an inducible operon (3) regulator of a positive repressible operon (4) negative control in a repressible operon
(A) Active Repressor & (2) negative control in an inducible operon (B) Inactive Repressor & (4) negative control in a repressible operon (C) Active activator & (3) regulator of a positive repressible operon (D) Inactive activator & (1) positive control in an inducible operon
Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. 2 kb (EcoRI site 1) 4 kb (EcoRI site 2) 5 kb In each of the scenarios described below, DNA is cut by EcoRI and the resulting fragments are separated by gel electrophoresis. The gel image is pictured on the right. Match each of the scenarios to the lane on the gel that would result after digestion and gel electrophoresis. (A) Digestion is performed on the linear DNA as shown above. (B) A mutation that alters EcoRI site 1 occurs in this piece of DNA. (C) Mutations that alter EcoRI site 1 and 2 occur in this piece of DNA. (D) 1000 bp of DNA are inserted between the two restriction sites. (E) 500 bp of DNA between the two restriction sites are deleted.
(A) C (B) A (C) B (D) E (E) D
PCR (polymerase chain reaction) is a commonly used method for the amplification of a short segments of DNA. The flow chart below is a simplified illustration of the basic steps of PCR. Complete the flow chart. Note: In reality, primers generally must be longer than the primers shown here, and the DNA being amplified is generally much longer. The process has been simplified here.
Answer is in the photo
The field of genomics encompasses several methodologies used to study an organism's entire set of DNA, or genome. Classify each statement as a characteristic of comparative, functional, or structural genomics. -focuses on transcription and translation -concerns the physical organization of DNA -analyzes multiple genomes to determine gene functions -focuses on determining the nucleotide sequence of a genome -investigates the cellular roles of genes and gene products -examines evolutionary relationships between organisms
Comparative: -analyzes multiple genomes to determine gene functions -examines evolutionary relationships between organisms Functional: -investigates the cellular roles of genes and gene products -focuses on transcription and translation Structural: -focuses on determining the nucleotide sequence of a genome -concerns the physical organization of DNA
At which level of gene regulation, shown in the figure, does attenuation occur?
transcription
Identify the specified genes as orthologs or paralogs. (Refer to picture)
Orthologs: -A1 in species 1 and A1 in species 2 -A1 in species 2 and A2 in species 3 -A1 and B1 -all copies of A2 -A1 and B2 Paralogs: -B1 and B2 -A1 and A2 in species 2
Mismatch repair in bacteria distinguishes between old and new strands of DNA on the basis of __________.
methyl groups on the old strand
Hemoglobin is a complex protein that contains four polypeptide chains. The normal hemoglobin found in adults, called adult hemoglobin, consists of two alpha and two beta polypeptide chains, which are encoded by different loci. Sickle-cell hemoglobin, which causes sickle-cell anemia, arises from a single mutation in the beta chain of adult hemoglobin. Adult hemoglobin and sickle-cell hemoglobin differ in a single amino acid. The sixth amino acid from one end in adult hemoglobin is glutamic acid, whereas sickle-cell hemoglobin has valine at this position. (A) After consulting a codon table, indicate the mutant codons that could give rise to sickle-cell anemia. (B) Indicate the type of mutation that gave rise to sickle-cell anemia.
(A) GUA & GUG (B) a transversion that leads to a missense mutation
What would be the most likely effect on the transcription of the trp structural genes for the following mutations? (A) mutation that prevents ribosome binding to the mRNA 5' UTR (B) mutation that changes region 1 tryptophan codons into alanine codons (C) mutation that creates a stop codon in region 1 of mRNA 5' UTR (D) deletions in region 2 of the mRNA 5' UTR (E) deletions in region 3 of the mRNA 5' UTR (F) deletions in region 4 of the mRNA 5' UTR (G) deletion of the string of adenine after region 4 of the mRNA 5' UTR
(A) No transcription occurs (B) Transcription when alanine is low (C) No transcription occurs (D) No transcription occurs (E) Transcription occurs (F) Transcription occurs (G) Transcription occurs
One method to clone a mammal involves nuclear transfer, in which a somatic cell nucleus from a donor mammal is transferred to a recipient egg cell with its nucleus removed. This method results in few live births overall due to a high prevalence of developmental abnormalities. Notably, the probability of a live birth is significantly greater for embryos cloned from the nuclei of undifferentiated embryonic stem cells than for embryos cloned from the nuclei of differentiated somatic cells. Select the best explanation of why embryos cloned from undifferentiated embryonic stem cells have greater developmental success than embryos cloned from differentiated somatic cells.
Patterns of epigenetic markers are different in stem cells and somatic cells, with stem cells having epigenetic patterns more closely associated with early development.
A template strand of DNA contains the following nucleotide sequence. Use this? codon table to translate the amino acid sequence for each mutation. Match the translated amino acid sequence to the appropriate mutation. All amino acid sequences are written in the amino-to-carboxyl direction. A) Transition at nucleotide 11 B) Transition at nucleotide 13 C) Deletion at nucleotide 7 D) Transversion of T to A at nucleotide 15 E) Addition of TGG after nucleotide 6 F) Transition at nucleotide 9 1) Met Thr Gly Asn Gln Leu Tyr 2) Met Thr Gly Ser Gln Leu Tyr 3) Met Thr Ala lle Asn Tyr lle 4) Met Thr Thr Gly Asn Gln Leu Tyr 5) Met Thr Gly Asn His Leu Tyr 6) Met Thr Gly Asn
Refer to photo
What is NOT a reason that mutations are important?
Mutations provide genetic stability (Therefore mutations do not provide genetic stability)
Classify each of the characteristics below as pertaining to gene regulation in either prokaryotes or eukaryotes. - A 5' cap and 3' cap poly-A tail are added to mRNA. - Genes are located on one chromosome. - Transcription occurs in the nucleus, whereas translation occurs in the cytoplasm. - mRNA transcripts typically specify one protein. - Transcription and translation occur in the cytoplasm. - Some genes are organized into operons, and mRNA transcripts often specify more than one protein.
Prokaryotic gene regulation: - Genes are located on one chromosome. - Some genes are organized into operons, and mRNA transcripts often specify more than one protein. - Transcription and translation occur in the cytoplasm. eukaryotic gene regulation: - A 5' cap and 3' cap poly-A tail are added to mRNA. - Transcription occurs in the nucleus, whereas translation occurs in the cytoplasm. - mRNA transcripts typically specify one protein.
When the level of glucose in the environment is low, abundant cyclic adenosine monophosphate (cAMP) binds the catabolite activator protein (CAP) to form the CAP-cAMP complex, which binds DNA. When CAP-cAMP binds DNA, the efficiency of RNA polymerase binding is increased at the lac operon promoter, which increases transcription of the structural genes. However, when glucose levels are high, the CAP-cAMP complex does not form and RNA polymerase cannot bind to the promoter efficiently. (Refer to picture) (A) Is the lac operon inducible or repressible? (B) What type of protein regulates structural-gene expression as a result of low glucose level? (C) What type of overall gene regulation occurs as a response to low glucose level?
(A) inducible (B) activator (C) positive
What are some scenarios that are likely due to epigenetic modifications.
-During development, undifferentiated stem cells with the potential to develop into any cell type have many regions of euchromatin, in which genes associated with pluripotency are active. The chromatin is reconfigured when cells differentiate, and these regions become heterochromatin. -Female rats exposed to dioxin, a toxin, during pregnancy have offspring with a high rate of kidney disease. Females from the first generation who were not directly exposed to the toxin during pregnancy also have offspring with disease. This pattern continues for three generations. -In mice, methylation of an allele of the agouti gene locus determines coat color. When methylated, the coat is brown, and when unmethylated, the coat is yellow. Pregnant yellow female mice are fed a diet rich in methyl groups and have offspring with brown coats.
Low levels of glucose lead to what?
-cAMP levels increase -permease levels increase -β-galactosidase levels increase AND -lac operon is activated
Classify each characteristic as being commonly found in bacterial genomes, in eukaryotic genomes, or in both genomes. - - - - - - - - -
Bacterial genomes only: -generally have one chromosome -have very few noncoding regions in the DNA -often contain plasmids Eukaryotic genomes only: -meiosis divides pairs of chromosomes -chromosomes are generally linear -nucleus contains chromosomes Characteristic of both: -composed of nucleotides -must be replicated before cell division takes place -contain genes that code for proteins
You discovered a mouse gene with an unknown function. You do not know the location or sequence of this gene in the mice genome, but a similar gene has been isolated and sequenced in yeast. How might you determine whether this gene is essential for development in mice?
Create a targeting vector using a cloned copy of the gene to develop a knockout mouse. If the gene is essential for development, no offspring homozygous for knockout will be born.
Suppose an operon has the following characteristics: (1) The operon codes for structural proteins that convert compound Q to compound B. (2) The operon is controlled by a constitutively expressed regulatory gene called reg. (3) In wild-type individuals, the operon is transcribed in the absence of compound B but not in the presence of compound B. (4) In reg- mutants, the operon is constitutively transcribed. Is this operon inducible or repressible? Why?
It is repressible because wild-type transcription is repressed in the presence of compound B.
In order to determine whether radiation associated with the atomic bombings of Hiroshima and Nagasaki produced recessive germ-line mutations, scientists examined the sex ratio of the children of the survivors of the blasts. Why might an increase in germ-line mutations be expected to alter the sex ratio?
More males than females are expected to die of sex-linked recessive lethal mutations because males have only one X chromosome.
Suppose that you are studying an inducible operon that contains two genes required for the metabolism of compound xyz. Gene A encodes enzyme A, and gene B encodes enzyme B. When compound xyz is absent, the operon is repressed, but when compound xyz is present, the operon is induced. You have isolated four distinct mutants, numbered 1, 2, 3, and 4, which have the effects shown in the table below, where + indicates that the enzyme is synthesized and - indicates that the enzyme is not synthesized. Identify the component of the operon that is mutated in each mutant. (Refer to picture)
Mutant 1- gene B Mutant 2- operator Mutant 3- gene A Mutant 4- promotor
What are reasons that mutations are important?
Mutations can cause diseases and disorders. Mutations are the raw material of evolution. AND Mutations help researchers understand biological processes.
The following DNA non-template sequence (coding sequence) is transcribed from left to right. Use the sequence to determine the type of mutation and the type of base substitutions that apply to each scenario. Place only one statement for each scenario. ATGTTACGCCCAAGC Scenarios: -An adenine substituted for nucleotide 5 -A guanine substituted for nucleotide 12 -An adenine substituted for nucleotide 15 Statements: -misense and transition -silent and transition -nonsense and transversion -nonsense and transition -missense and transversion -silent and transversion
Refer to image
James Noonan and his colleagues set out to study genome sequences of an extinct species of cave bear. They extracted DNA from 40,000-year-old bones from a cave bear and used a metagenomic approach to isolate, identify, and sequence the cave-bear DNA. Why did they use a metagenomic approach when their objective was to sequence the genome of one species, the cave bear?
The cave bear samples could be heavily contaminated so scientists used metagenomics to sequence all of the DNA. They then compared the sequences obtained with modern bear DNA to identify which DNA fragments were from the cave bear.
Monozygotic twins have identical DNA sequences, yet twins can differ in some physical or behavioral traits. What evidence suggests that epigenetic effects may cause these phenotypic differences in monozygotic twins?
Younger twins have more similar DNA methylation and histone acetylation patterns than older twins.
Suppose that a mutant form of GAL80 protein lacks the domain that binds to GAL4 protein. Yeast cells with this mutant GAL80 will:
always activate the genes needed for galactose metabolism even in the absence of galactose
In a negative repressible operon, the regulator protein is synthesized as ___________.
an inactive repressor
Which type of DNA mutation results in a change in the reading frame of an mRNA?
deletion of a single nucleotide
DNA-binding proteins interact _________with DNA usually via _______.
dynamically; hydrogen bonds
After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the 10th position within the coding region of a gene. This mutation led to a change of proline into serine at the fourth position in the resulting peptide. Using this information and the sequences listed below, select all the types of mutations that occurred. -transversion -induced -spontaneous -missense -transition -silent -point
induced, missense, transition, and point
Consider the following partial diploid strain of E. coli: lacI+ O+ lacZ+ lacY-/lacIS Oc lacZ- lacY+. Under what conditions will this strain make b-galactocidase?
never
A cell with mutated DNA may not be able to produce proteins accurately. What can lead to mutations in the DNA?
uncorrected DNA replication errors, exposure to X-ray radiation, AND chemicals in some pesticides
In Escherichia coli, the tryptophan operon encodes structural genes, including trpC, trpB, and trpA, that encode the tryptophan synthetase protein complex. A repressor protein encoded by the trpR gene regulates the trp operon. In the presence of high levels of tryptophan, tryptophan molecules bind the repressor protein and allow the repressor to recognize and bind to the operator, called trpO, and repress the expression of the structural tryptophan synthetase genes. In the absence of tryptophan, the repressor is unable to bind the operator and gene expression can occur. Assume any minus symbol represents a null mutant. What is the type of expression of each functional structural gene for the three bacterial strains below? (A)trpR- trpO+ trpA- trpB+ trpC+ a) for trpA b) for trpB c) for trpC (B) trpR+ trpOC trpA+ trpB- trpC- a) for trpA b) for trpB c) for trpC (C) trpR- trpO+ trpA- trpB+ trpC+ / trpR+ trpO+ trpA+ trpB+ trpC- a) for trpA b) for trpB c) for trpC
(A) a) no expression b) constitutive c) constitutive (B) a) constitutive b) no expression c) no expression (C) a) repressible b) repressible c) repressible
Suppose a heterozygous man that is affected by a rare heritable disorder has children with a homozygous unaffected woman, producing two unaffected children. The man knows that his father was also affected by the disorder, but his mother was unaffected. (A) Is the gene responsible for the disorder likely maternally or paternally imprinted? (B) If the affected man has a son and a daughter, what is the probability of the children developing the disorder? (C) If the unaffected son has children with a homozygous affected woman and produces a boy and a girl, what is the probability of each of their children developing the disorder?
(A) maternal because the father of the affected man was also affected by the disorder, but the man has unaffected offspring (B) son = 0.5, daughter = 0.5 (C) son = 0.0, daughter = 0.0
Suppose a researcher studied gut tissue samples from patients with Crohn's disease, an inflammatory gut disorder, and normal controls. He found that the identity and relative abundance of gut bacterial species varied within both the Crohn's and the control populations. He also discovered general differences between the two populations. The guts of Crohn's patients had reduced levels and diversity of bacteria from the phylum Firmicutes compared to those of controls. The guts of Crohn's patients also had higher levels of bacteria from the phylum Proteobacteria than those of controls. (A) Which type of study did the researcher perform? (B) Which conclusions might you be able to draw from the data?
(A) metagenomic (B) -Bacteria from the phylum Proteobacteria may contribute to the development of Crohn's disease. AND -Two normal individuals may have different compositions of bacteria in their guts.
(A) Which types of mutations in the lac operon stop Escherichia coli from utilizing lactose as a carbon source? (B) Suppose a scientist generates random mutations in E. coli and picks four strains to study. The scientist measures the protein level of β-galactosidase for each strain in the presence of different carbon sources, as shown in the table below. (Refer to photo) Match each type of mutation to the corresponding data. -operator deletion -defective promoter CAP-cAMP binding site -superrepressor mutation -repressor gene deletion
(A) promoter deletion AND superrepressor mutation (B) mutant 1- operator deletion mutant 2- repressor gene deletion mutant 3- superrepressor mutation mutant 4- defective promoter CAP-cAMP binding site
A linear piece of DNA was broken into random, overlapping fragments and each fragment was then sequenced. The sequence of each fragment is shown below, listed in a random order. 5'-ATCAAAAGC-3' 5'-TCAAAAGCATAGAGGTACC-3' 5'-GAGGTACCCTTC-3' 5'-CTATCAAAAGCAT-3' 5'-AAAAGCATAGAGGTACC-3' 5'-AAGCATAGAGGTACC-3' Using the overlapping regions shared between sequences, create a contig sequence of the original fragment by placing the sequence that is closest to the 5' end first and moving towards the 3' end.
*5' end* 5'-CTATCAAAAGCAT-3' 5'-ATCAAAAGC-3' 5'-TCAAAAGCATAGAGGTACC-3' 5'-AAAAGCATAGAGGTACC-3' 5'-AAGCATAGAGGTACC-3' 5'-GAGGTACCCTTC-3' *3' end*
The lac operon in E. coli controls the gene expression of the enzymes that digest lactose in the cell. In the presence of lactose the lac operon will turn on and the genes will be expressed. Place the events of gene regulation by the lac operon in order of their occurrence, from the introduction of lactose to the environment to when the cell begins to digest lactose. -Lactose enzyme genes are expressed by the operon. -The repressor is inactivated by allolactose. -RNA polymerase binds to the promoter region. -The repressor is removed from the operator.
*Lactose is introduced to the environment.* -The repressor is inactivated by allolactose. -The repressor is removed from the operator. -RNA polymerase binds to the promoter region. -Lactose enzyme genes are expressed by the operon. *The cell begins to digest lactose.*
Arrange the following steps of the regulation of the trp operon in order of occurrence. -The trp repressor protein binds to the operator. -Tryptophan binds to the trp repressor protein and induces a conformational change. -Products of the trp genes synthesize tryptophan. -RNA polymerase binds to the promoter, allowing transcription of the trp genes to proceed. -The trp repressor protein blocks RNA polymerase from binding to the promoter. -Sufficient quantities of tryptophan make further synthesis unnecessary.
*Levels of tryptophan in the cell are low* -RNA polymerase binds to the promoter, allowing transcription of the trp genes to proceed. -Products of the trp genes synthesize tryptophan. -Sufficient quantities of tryptophan make further synthesis unnecessary. -Tryptophan binds to the trp repressor protein and induces a conformational change. -The trp repressor protein binds to the operator. -The trp repressor protein blocks RNA polymerase from binding to the promoter. *Transcription of the trp gene stops*
Each answer box represents a mechanism by which eukaryotes can regulate gene expression. Determine which of the five mechanisms each example represents. Not all examples will be used. Mechanisms: -Changes in chromatin structure -Activity of transcription apparatus -RNA processing -RNA interference -Initiation of translation Examples: -The RISC degrades mRNA complexed with miRNA or siRNA. -Alternative splicing produces different transcripts from the same gene. -Methylation of CpG islands represses promoter activity. -Chromosomal translocation may cause a gene to be regulated in a way intended for a different gene. -RNA granules control the availability of mRNA for translation. -Transcriptional activators increase promoter activity by interacting with the RNAPII holoenzyme.
-Changes in chromatin structure—> Methylation of CpG islands represses promoter activity. -Activity of transcription apparatus—> Transcriptional activators increase promoter activity by interacting with the RNAPII holoenzyme. -RNA processing—> Alternative splicing produces different transcripts from the same gene. -RNA interference—> The RISC degrades mRNA complexed with miRNA or siRNA. -Initiation of translation—> RNA granules control the availability of mRNA for translation.
Drosophila sex determination involves the regulation of alternative RNA splicing by the sex-lethal (Sxl), transformer (tra), and doublesex (dsx) genes. Match each effect on Drosophila sexual development with the gene deletion that would cause it. -Sxl deletion -tra deletion -dsx deletion Effects: -absence of female-determining regulatory protein yields male traits in females -absence of male-determining regulatory protein yields female traits in males -male-specific splicing of dsx yields male traits in females -male-specific splicing of tra yields male traits in females
-Sxl deletion—> male-specific splicing of tra yields male traits in females -tra deletion—> male-specific splicing of dsx yields male traits in females -dsx deletion—> absence of female-determining regulatory protein yields male traits in females AND absence of male-determining regulatory protein yields female traits in males
siRNA and miRNA inhibit gene expression by all of the what?
-cleaving mRNA -altering chromatin structure AND -stimulating RNA degradation
Shotgun sequencing DOES:
-depend on overlapping sequences -depend on high-efficiency sequencing AND -provide multiple copies of some sequences
A mutant strain of E. coli produces β-galactosidase in the presence and in the absence of lactose. Where in the operon might the mutation in this strain occur and why?
-in the operator region, where the mutation leads to the failure of the operator to normally bind the repressor AND -in the lacI gene, which leads to an inactive lac repressor
Classify each scenario as the result of epigenetics, the environment, both, or neither. -Chris's high sugar diet causes a demethylation of genes associated with Type 2 diabetes -Matt is taller than his dad because Matt eats a more nutritious diet. -DNA methylation decreases as cells age. -The offspring of a mouse are anxious because she experienced stress while pregnant. -A newborn is diagnosed with Down syndrome even though it does not run in the family. -A patient has Angelman syndrome because his mother has the syndrome. -An essential gene in the fruit fly is inactive at 29 deg. Celsius and active at 22 deg. Celsius.
Epigenetic only: -A patient has Angelman syndrome because his mother has the syndrome. -DNA methylation decreases as cells age. Environmental only: -An essential gene in the fruit fly is inactive at 29 deg. Celsius and active at 22 deg. Celsius. -Matt is taller than his dad because Matt eats a more nutritious diet. Both: -The offspring of a mouse are anxious because she experienced stress while pregnant. -Chris's high sugar diet causes a demethylation of genes associated with Type 2 diabetes Neither: -A newborn is diagnosed with Down syndrome even though it does not run in the family.
White eyes in Drosophila melanogaster result from an X-linked recessive mutation. Occasionally, white-eyed mutants give rise to offspring that possess white eyes with small red spots. The number, distribution, and size of the red spots are variable. Explain how a transposable element, or transposon, could be responsible for this spotting phenomenon.
Excision of a transposable element out of the eye color locus during eye development produces a patch of cells that produce red pigment.
Identify each feature in the following diagram which depicts the generation of a recombinant plasmid from plasmid and donor DNA.
Refer to photo
Tissue-specific microarray analysis facilitates the comparison of gene expression in different tissues. In order to prepare a sample for microarray analysis, messenger RNA (mRNA) is extracted from a particular tissue, reverse transcribed to generate complementary DNA (cDNA), and labeled with a fluorescent probe. The microarray below shows comparison of gene expression in tumor and normal tissues. The cDNA from tumor tissue was labeled with red fluorescent probes, whereas the cDNA from the normal tissue was labeled with green fluorescent probes. Gene B is primarily expressed only in tumor tissue, whereas gene C is primarily expressed in normal tissues. Genes D and A are responsible for basic cellular functions and are equally expressed in tumor and normal tissues. Match the spots on the microarray with the appropriate genes based on the information provided. If there are multiple possible answers for a particular gene, choose any of the possible options.
Study the picture
An alteration in the nucleotide sequence of a gene can alter the gene product. Each sentence below is made up of three-letter words, representing mRNA codons. THE FAT CAT SAT THE FOX WAS RED SHE HAS THE DOG The same sentences are written below with a substitution, deletion, or insertion, much as a gene may have a substitution, deletion, or insertion mutation. Identify which sentence represents a substitution, which represents a deletion, and which represents an insertion. A) THE FOX WTS RED B) THE FAT ACA TSA T C) SHE HAS THE DG
Substitution- (A) Deletion- (C) Insertion- (B)
Enhancer I can stimulate the transcription of gene A, but the insulator blocks its effect on gene B. Enhancer II can stimulate the transcription of gene B, but the insulator blocks its effect on gene A. What would be the effect of moving the insulator to a position between enhancer II and the promoter for gene B? (Refer to picture)
The newly positioned insulator prevents enhancer II from stimulating the transcription of gene B.
In eukaryotes, transcription factors and enhancer sequences are used to regulate transcription. Classify the following statements as true or false. -Enhancer sequences can be located thousands of base pairs upstream from the transcription start site. -Enhancer sequences directly alter transcription levels. -Transcription factors bind to the entire enhancer sequence. -Transcription factors are composed of amino acids. -Transcription factors always decrease transcription levels.
True: -Transcription factors are composed of amino acids. -Enhancer sequences can be located thousands of base pairs upstream from the transcription start site. False: -Enhancer sequences directly alter transcription levels. -Transcription factors bind to the entire enhancer sequence. -Transcription factors always decrease transcription levels.
