Genetics Learnsmart Exam 3
Which regions of a bacterial promoter play a key role in promoting transcription?
-35 and -10
The following numbers represent the order of nucleotides in a region of a bacterial gene that includes the first transcribed nucleotide. If transcription is proceeding to the right, which of these would be the correct representation of the conventional system used by geneticists to number nucleotides in a gene?
-5 -4 -3 -2 -1 +1 +2 +3 +4 +5
These steps are from the mechanism of quorum sensing in Vibrio fischeri. Arrange them in the correct order, starting with the earliest on top.
1. LyxI synthesizes and releases autoinducer 2. Autoinducer enters the cell 3. Autoinducer reaches a threshold 4. Autoinducer binds LuxR 5. Bioluminescence operon is transcribed
The transcribed portion of the human dystrophin gene is 2.5 million nucleotides, or 2,500kb. However, the dystrophin mRNA is only 14kb after splicing. Match the correct sizes.
2,500kb primary transcript 14kb exons 2,486kb introns
DNA footprinting experiments have revealed that the lac operon has a total of _____ operator sites.
3
How many kids of RNA polymerase enzymes are found in eukaryotes?
3
Part of the coding region is shown here: 5'- TTCCCATTTCGATGGGATACGATGG -3' 3'-AAGGGTAAACGTACCCTATCGTACC -5'
5'- UUCCCAUUUCGAUGGGAUACGAUGG -3'
If a protein acts in a complex of four identical polypeptides and a dominant negative allele A is present, select the combinations of polypeptides that might be non-functional complexes: A a+ a+ a+ A A A A A A A a+ A A a+ a+ a+ a+ a+ a+
A a+ a+ a+ A A A A A A A a+ A A a+ a+
Initiation
A complex forms between the ribosomal subunits, one mRNA molecules and the first tRNA molecule.
A nonsense mutation changes a codon for serine (UCA) to a stop codon (UAA). Which of the following mutations could suppress the effects of this mutation?
A mutation that changes tRNAser anticodon from 5' UGA 3' to 5' UUA 3'
Which of the following mutations could act as gain-of-function alleles?
A mutation that increases the activity of a protein. A mutation that causes a protein to be expressed in a different location. A mutation that confers a new activity on a protein.
The complementarity rule used in transcription is similar to the _____ rule, except that _____ substitutes for thymine in the RNA.
AT/GC Uracil
Which of the following are possible functions of posttranslational modifications to proteins?
Activation of enzyme function Localization to a particular subcellular compartment Proper protein folding
Elongation
Amino acids are linked together in the order designated by the codons
Which two mechanisms control expression of the trp operon in E. coli?
Attenuation Repression
Which of the following nucleotides are used during transcription
CTP and GTP UTP and ATP
A loss-of-function mutation ?
Can reduce the amount of functional protein Can occur within the coding region Can occur outside the coding region
Choose the two requirements that will ensure that a cell with nonsense suppressing mutation can survive.
Cells must have another tRNA that can recognize the same codon as the suppressing tRNA before it was mutated. The suppressing tRNA must bind stop codons inefficiently.
What are snRNPs?
Components of the spliceosome
The central dogma of genetics can be summed up by which of the following ?
DNA --> mRNA --> polypeptide
Reverse transcriptase refers to the production of _____.
DNA using RNA as a template
The poly-A tail added to eukaryotic transcripts serves _____.
Enhance the efficiency of translation To increase the stability of the mRNA in the cytoplasm
The energy for translocation of the ribosome along an mRNA during translation is provided by the hydrolysis of _____.
GTP
In what type of cell do the terms transcript and mRNa refer to the same molecule?
In a bacterium
Why is the length of a eukaryotic mRNA shorter than the length of the DNA sequence?
Introns are removed by splicing after transcriptions
Which of the following are regulatory DNA elements of the lac operon?
Operator Promoter
Which of the following are possible posttranslational modifications ?
Peptide cleavage Addition of a phosphate group Addition of a carbohydrate
From crystallization studies, it has been shown that the component making up most of the mass in the central part of the ribosome is the ribosomal
RNA
Which RNA polymerase transcribes genes that encode proteins in eukaryotes?
RNA polymerase II
Which of the following are functions of the 5' cap of eukaryotic mRNAs?
Recognition of the transcript by translation initiation factors Stabilizes the mRNA in the cytoplasm
What are enhancers?
Regulatory elements in eukaryotes that stimulate transcription
_____ are allosteric RNA leaders that bind small effector molecules to control gene expression.
Riboswitches
How does an effector molecule influence gene expression?
The effector molecule binds to a regulatory protein and affects its ability to bind DNA.
Which of the following best defines a primary transcript?
The mRNA of eukaryotes that is produced in the nucleus and has yet to be processed
Termination
The newly produced polypeptide is released from the ribosome
Mutations in the 5' UTR or 3' UTR of an mRNA molecule are most likely to affect what?
The stability of the mRNA The mRNA's ability to be translated
Select the three codons that will lead to termination of translation:
UAA UAG UGA
A loss-of-function allele that produces a protein that functions less effectively than the wild-type protein is _____.
a hypomorphic allele
One stretch of eukaryotic genomic DNA can lead to the production of more than one polypeptides due to _____.
alternative splicing of introns
In the trp operon, tryptophan acts as ____.
an effector
In the trp operon, the interaction between the translation machinery and a portion of the RNA leader called the _____ determines whether or not transcription will terminate prematurely.
attenuator
Extrinsic termination is a term used for the type of transcription termination in _____.
bacteria that requires the Rho protein
The addition of a methylated "backward G" to the 5' end of a eukaryotic mRNA is a process known as _____.
capping
Inducible operons usually encode _____ enzymes, and repressible operons usually encode ______ enzymes.
catabolic anabolic
Pathways that break down complex molecules into smaller units are termed _____ while pathways that construct end product molecules from simpler units are called _____.
catabolic anabolic
A DNA segment that must be adjacent to the gene(s) it regulates is called a _____-acting element.
cis
Antisense RNA is an RNA strand that is ____ to an mRNA molecule
complementary
Mutants whose genes are unregulated are called _____ mutants.
constitutive
In which cellular location would ribosomes be found for both prokaryotic and eukaryotic cells
cytosol
In certain Drosophila Antennepedia (Antp) mutants, the protein Antp is expressed in the cells that are precursors of antenna. These mutants develop legs in place of antennae which is an example of _____.
ectopic expression
A small molecule that binds to an allosteric protein or an RNA molecule and causes a conformational change is called a(n)
effector
Cyclic AMP is a(n) _____.
effector molecule that is involved in the positive control of the lac operon.
The genes in the trp operon encode _____.
enzymes used in tryptophan biosynthesis
Regions of DNA that are represented in a mature transcript are _____.
exons
Arranging the four RNA nucleotides A, G, C and U in groups of three with all possible combinations leads to a set of codons called the
genetic code
In catabolite repression, transcription is influenced by the presence of _____.
glucose
A disease known as Barakat Syndrome, characterized by renal failure and other symptoms, is caused by deletion or hypomorphic mutation of a single copy of GATA3 in humans. GATA3 is therefore a _____.
haploinsufficient gene
A mutation in the gene encoding the Ras protein results in a Ras protein with increased activity. This is a(n) _____ mutation.
hypermorphic
An inducer is a small effector molecule that causes transcription to _____.
increase
A pathway that is turned on only in the presence of certain molecules in the cell's environment is under _____ regulation.
inducible
The addition of lactose to a bacterial medium causes a 1000-fold increase in the synthesis of the two proteins Lac permease and beta-galactosidase. This phenomenon is termed _____.
induction
The three stages of transcription are called
initiation elongation termination
A group of three nucleotides that signals the beginning of translation is called the _____ _____.
initiation codon
Sequences of DNA that are not represented in the mature mRNA are called _____.
introns
What is the product of lacZ? lacY? lacA?
lacZ: beta-galactosidase lacY: lac permease lacA: transacetylase
In this diagram representing splicing, the letter A denotes a _____ structure.
lariat
Mutations in genes encoding molecules that are involved in gene expression, such as, for example, rRNA genes, are often _____ in homozygotes and can cause altered dominant phenotypes in heterozygotes.
lethal
When the tryptophan level in the cell is _____, the ribosome pauses in region 1 of the trp mRNA leader, causing region 2 to bind to region 3 and transcription to continue.
low
Which Vibrio fischeri genes encode the quorum-sensing proteins?
luxR luxI
A mutation in the promoter region ?
may alter the amount of protein produced by the gene
The allele of the Huntington disease gene that is associated with development of Huntington disease produces an oddly functioning protein that has an extra glutamine amino acids, causing neural degeneration. This allele is an example of a(n) ?
neomorphic mutation
A missense mutation that changes the properties of a single amino acid in a protein is a _____.
nonconservative substitution
A base substitution that changes a UGG codon for tryptophan to UAG is a
nonsense
A loss-of-function allele that results in a complete lack of gene function is a _____.
null allele
In the lac operon, the repressor binds to a DNA sequence called the _____ site. This site is near the lac promoter.
operator
Because there is an overlap between the sequences of the lac _____ and lac _____, binding of the repressor to the DNA will inhibit RNA polymerase from binding. As a result, the expression of the lac operon genes is blocked.
operator promoter
During elongation, the enzyme that catalyzes the transfer of the polypeptide in the P site to the amino acid in the A site is
peptidyl transferase
About 250 adenine nucleotides, called a _____ _____, are enzymatically added to a eukaryotic mRNA after it is transcribed.
poly-A tail
A _____ is a larger polypeptide that is cleaved posttranslationally to produce several smaller polypeptides.
polyprotein
Allolactose is a small effector molecule that binds to the Lac repressor and _____.
prevents it from binding to DNA
In the lac operon, some of the nucleotides of the operator are also part of the _____.
promoter
Studies of the crystal structure of the 50S ribosomal subunit showed that the catalytic component of peptidyl transferase is _____.
rRNA
Noncoding genes include those for ?
rRNAs, tRNAs, snRNAs
During termination of translation in bacteria, a stop codon is recognized by a(n)
release factor
A pathway that is turned off when the cell has enough of the end product is under _____ regulation.
repressible
Translation takes place on a structure called the _____.
ribosome
In attenuation, the level of an amino acid governs the conformation of the leader indirectly. However, leaders that act as _____ change conformation by binding a particular effector directly.
riboswitches
An RNA molecule that has catalytic activity is called a(n)
ribozyme
The term sRNAs refers to _____RNA molecules that regulate translation by base-pairing with mRNAs in bacteria.
s
Mutations in eukaryotic genes that change the _____ recognition sequences may affect the number of exons contained in the mature mRNA.
splice
RNA splicing requires the aid of a multicomponent structure called the _____.
spliceosome
Costitutive mutants _____.
synthesize certain proteins all the time
During RNA splicing, a lariat structure forms when _____.
the 5' end of the intron attaches to the branch site
The conversion of a riboswitch from one conformation to another is due to _____.
the binding of a small molecule
Allolactose is _____ of the lac operon.
the inducer
When lactose is depleted from the environment, _____.
the repressor reverts to its DNA-binding shape
A bacterial cell has a nonsense suppressor mutation. In order for this bacterial cell to survive?
the suppressing tRNA must be able to bind inefficiently to stop codons.
A protein that can diffuse through the cytoplasm and act at DNA target sites elsewhere in the genome is called a _____-acting element.
trans
A eukaryotic _____ must be processed before becoming a mature _____.
transcript mRNA
The synthesis of an RNA molecule from a DNA template is called _____.
transcription
