Genetics Test Week 6 Problems

1.) A:T changed to G:C 2.) A:T changed to T:A 3.) AAGCTTATCG changed to AAGCTATCG 4.) CAGCAGCAGCAGCAGCAG changed to CAGCAGCAGCAGCAGCAGCAGCAG 5.) AACGTTATCG changed to AATCTTATCG 6.) AACGTCACACACACATCG changed to AACGTCACATCG 7.) AAGCTTATCG changed to AAGCTTTATCG

1.) Transition and Base Substitution and Deamination 2.) Transversion and Base Substitution 3.) Deletion and X-Ray Irridiation 4.) Insertion and Slipped Mispairing 5.) Transition and Bass Substitution and Deamination 6.) Slipped mispairing 7.) Insertion and Intercalator

shows examples of base substitutions introduced by the mutagens 5-bromouracil, hydroxylamine, ethylmethane sulfonate, and nitrous acid. Which of these mutations cause transitions and which cause transversions?

All are transitions

The mutagen 5-bromouracil (5-BU) can either resemble T or C depending on its tautomeric state. Figure 7.13a first shows 5-BU incorporated into DNA as the T-like tautomer, but then it changes its state to the C-like tautomer during the next round of DNA replication. The result was a T:A à C:G substitution. Suppose that the tautomeric states of 5-BU during the two rounds of replication were reversed. What kind of mutation would result?

C:G —> T:A C replaces T turns to T replacing C — transition

When a particular mutation identified by the Ames test is injected into mice, it causes the appearance of many tumors, showing that the substance is carcinogenic. When cells from these tumors are injected into other mice not exposed to the mutagen, almost all of the new mice develop tumors. However, when mice carrying mutagen-inducing tumors are mated to unexposed mice, all of the progeny are tumor-free. Why can the tumor be transferred horizontally (by injecting cells) but not vertically (from one generation to the next)?

Horizontal transfer is of somatic cells. Vertical transmission is from the germline cells. So the mutation is only in the somatic cells and not in the germline.

When the His- Salmonella strain used in the Ames test is exposed to substance X, no His+ revertants are seen. If, however, rat liver supernatant is added to the cells along with substance X, revertants do occur. Is substance X a potential carcinogen for human cells? Explain.

Rat liver enzymes change X to a mutation that causes a reversion. It's cancerous if humans have similar enzymes as the rats do.

The following pedigree shows the inheritance of amelogenesis imperfecta, a condition that affects the structure and integrity of the teeth and is caused by a completely penetrant, dominant allele. DNA analysis of blood obtained from affected individuals III-1 and III-2 shows the presence of the same disease-causing mutation in one of the two copies of an autosomal gene that is not seen in DNA from the blood of any of the parents in generation II. Explain this result, using spermatogenesis and mutation rates. Do you think this type of inheritance pattern is rare or common?

The mutation is in the II-2 father's spermatagonia so that it happens early in the germline development. This would be rare, because it has to happen in a specific time in sperm development. Spermatogonia is undeveloped and go through spermatogenesis to form mature spermatozoa.

In human DNA, 70% of cytosine residues that are followed by guanine (CpG dinucleotides, where p indicates the phosphate in the phosphodiester bond between these two nucleotides) are methylated to form 5-methylcytosine. The figure below shows how 5-methylcytosine an undergo spontaneous deamination to become thymine. a. Methylated CpG dinucleotides are hotspots for point mutations in human DNA. Propose a hypothesis that explains why. b. Simply assume that human DNA has equal number of C:G and A:T base pairs and that the sequence is random. How frequently in the human genome would you expect to find the base sequence CpG? c. It turns out that the frequency of CpG in human DNA is much lower than predicted by the calculation in part b (even taking into account that the actual CG content in human DNA is <50%). Explain why this might be the case.

a.) A change from C:G to T:A is a transition by deamination. It may not get repaired all of the time. So there are a lot of mutations, so it's a hotspot b.) 50% A and T, 50% C and G 25% of each Because CoG is both C and G, it is 1/4 * 1/4 = 1/16 CpG Freq = 70% so 1/16 * 0.70= 4.375% c.) Frequency is much lower because Methylated Cytosine is constantly being delaminated to become Thymine, so it reduces amount of C. CpG can't methylated as many C.