LS3 Final Practice Problems
At which of the possible levels is induction occurring? A. Transcriptional B. Post-transcriptional C. Translational D. Post-translational
A. Transcriptional
The ribosome uses energy in form of an ATP hydrolysis step to create a new peptide bond. A. True B. False
B. False
A one base pair mutation lead to a one amino acid mutation of the protein. Therefore the genetic code must be... A. Overlapping B. Non-overlapping
B. Non-overlapping
E. coli cells are growing in a medium containing lactose but no glucose. How would addition of a high concentration of glucose affect expression of the lac operon? a. increase expression of the lac operon b. decrease expression of the lac operon c. not change expression of the lac operon
b. decrease expression of the lac operon
What can we conclude from these data? Data: both glucose and lactose have a constant growth and the other graph glucose is used up - lag time- then lactose used A. Bacteria prefer to consume glucose before lactose B. Bacteria prefer to consume lactose before glucose C. Bacteria don't have a preference for either
A. Bacteria prefer to consume glucose before lactose
Ribosomes are essential to gene expression - where do they bind the mRNA to be translated? CQ A. Cytosol B. Nucleus C. ER membrane D.Nuclear membrane
A. Cytosol
If you wanted to clone the promoter and enhancer of a particular gene, should you use a genomic or cDNA library? A. Genomic B. cDNA
A. Genomic
Which end of the polypeptide exits from the ribosome first? A. N terminus B. C terminus C. 5' end D. 3' end
A. N terminus
Which amino acid is encoded by the codon UUU? A. Phe B. Ala C. His D. Cys
A. Phe
Which of the following is NOT true of the lac operon? A. The lacI gene is controlled from the same promoter as the lacZ gene. B. The operator region regulates transcription through interaction with the Lac repressor protein. C. The Lac repressor protein is constitutively expressed. D. Transcription produces a single polycistronic mRNA containing the lacZ, lacY, and lacA genes.
A. The lacI gene is controlled from the same promoter as the lacZ gene.
Consider the following genotype for the bacterial lac operon: I+O+Z+ If the inducer is present then B-gal will be produced A. True B. False
A. True
4. What is the purpose of including the β-galactosidase gene in a plasmid? Select all that apply. A. β-galactosidase is a nega0ve selectable marker. B. β-galactosidase is a posiQve selectable marker. C. β-galactosidase confers resistance to several anQbioQcs. D. Presence of β-galactosidase indicates cloned DNA segment is present. E. Absence of β-galactosidase indicates cloned DNA segment is present.
A. β-galactosidase is a nega0ve selectable marker. E. Absence of β-galactosidase indicates cloned DNA segment is present.
How many DNA fragments are generated when we cut the plasmid with BamHI (there are two of them on the cloning plasmid)? A. 1 B. 2 C. 3 D. 4
B. 2
How many tRNAs are needed at least to translate all 6 Leucine codons? A. 2 B. 3 C. 4 D. 5 E. 6
B. 3
Which one of the following mRNA sequences could encode for the pep9de Met-Ala-His-Ser? A. AUGAAUCACUCU B. AUGGCUCACAGC C. UCUCACGCUAUG D. AUGAAUCAUUCA
B. AUGGCUCACAGC
Which of the following occurs in prokaryotes but not in eukaryotes? A. Post-transcriptional splicing B. Concurrent transcription and translation C. Translation in the absence of a ribosome D. Gene regulation
B. Concurrent transcription and translation
Consider the following haplotype for the bacterial lac operon: I-O+Z+ There is also a plasmid with the following haplotype: I+O+ZA. Q: If there is no inducer present then B-gal will be produced A. True B. False
B. False
What would happen in a GAL4 mutant strain? A. GAL1 would always be expressed (constitutive expression) B. GAL1 would never be expressed C. GAL1 would remain inducible
B. GAL1 would never be expressed
Refer to the image below. What is the function of the AGU on the loop of the tRNA? A. It attaches to the amino acid B. It base pairs with a codon of mRNA C. It stabilizes the tRNA-amino acid complex D. It is the active site of this ribozyme
B. It base pairs with a codon of mRNA
How many reading frames are there in a double stranded DNA? A. Three B. Six C. Zero, reading frames are only in RNA D. 2 x # base pairs
B. Six
Suppose you insert a gene between the BamHI and SalI sites (on the tetracycline resistance) in pBR322, what will be the drug resistance of the resulting plasmid? A. Tet^r, Amp^r B. Tet^s, Amp^r C. Tet^r, Amp^s D. Tet^s, Amp^s
B. Tet^s, Amp^r
What can we conclude from this experiment? A. The inducer and substrate function are the same B. The inducer and substrate function are likely separate C. We can't tell
B. The inducer and substrate function are likely separate
Which of the following statements is true about protein synthesis in prokaryotes? A. Extensive RNA processing is required before the prokaryotic transcripts can be translated. B. Translation can begin while transcription is still in progress C. Translation requires antibody activity D. Prokaryotes require no initiation or elongation factors.
B. Translation can begin while transcription is still in progress
Why would most cells be colorless when plated on glucose + X-gal? A. X-gal is not a substrate for β-galactosidase. B. X-gal is not an inducer for the lac operon C. Glucose inhibits induction
B. X-gal is not an inducer for the lac operon
A student clones a DNA insert into the SalI site of pBR322. Select all answers that describe the media on which she could expect growth of E. coli containing the recombinant plasmid. A. nutrient agar with streptomycin B. nutrient agar with no antibiotics C. nutrient agar with tetracyline D. nutrient agar with ampicillin and tetracycline E. nutrient agar with ampicillin
B. nutrient agar with no antibiotics E. nutrient agar with ampicillin
Which colonies have an insert? A.Blue B.White C.Can't tell
B.White
A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro- COOH. Which of the following sequences is the coding strand of the DNA that codes for this peptide? A. 3' UUU-CCC-AAA-GGG-UUU-CCC 5' B. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG 5' C. 5' TTT-CCC-AAA-GGG-TTT-CCC 3' D. 5' GGG-AAA-TTT-AAA-CCC-ACT 3' E. 5' ACT-TAC-CAT-AAA-CAT-TAC 3'
C. 5' TTT-CCC-AAA-GGG-TTT-CCC 3'
Which of the following sequences could a restriction enzyme recognize? A. AGAAGA B. ACTTCA C. AGTACT D. AAAAAA
C. AGTACT
A ribozyme is ______ . A. The catalyst that causes association between the small and large ribosomal subunits B. A ribosome (protein + rRNA) that catalyzes RNA synthesis C. An RNA with catalytic activity D. None of the above
C. An RNA with catalytic activity
Which effect would this fusion protein have on transcription of the lac operon? A. Constitutive expression in the presence of Glucose regardless of lactose levels B. Constitutive expression in the absence of Glucose regardless of lactose levels C. Constitutive expression in the presence of lactose regardless of Glucose levels D. Constitutive expression in the absence of lactose regardless of Glucose levels
C. Constitutive expression in the presence of lactose regardless of Glucose levels
Which enzyme will you need to ligate the fragments together? A. DNA Pol I B. DNA Pol III C. DNA Ligase D. Primase
C. DNA Ligase
You are interpre9ng data on a DNA microarray. You expose the microarray to a mixture of two cDNA populations: one from cells that were not treated with a glucocorticoid hormone (untreated controls; labeled with a red fluorescent dye) and a population from cells that were treated with glucocorticoid hormones (glucocorticoid-treated; labeled with green fluorescent dye). You look at a spot on the chip representing the gene for glutamyltransferase, a gene that is turned on after glucocorticoid treatment, but is not expressed in its absence. What color should the spot representing the glutamyltransferase gene be? A. Red B. Yellow C. Green D. Black
C. Green
Which of the following conditions gives results in fully activated transcription for AraBAD operon? A) High glucose, high arabinose B) Low glucose, low arabinose C) High glucose, low arabinose D) Low glucose, high arabinose
D) Low glucose, high arabinose
Which of the following enzymes has a 3' sticky end? A. CT^GCAG B. G^GATCC C. CC^GG D. AGATC^T
D. AGATC^T
What does this diagram tell us about the effort / energy required to metabolize lactose vs glucose? A. There should be no difference because different enzymes are required B. There are more steps in the breakdown of lactose than of glucose so it might be more energy consuming C. There are more steps involved in the breakdown of lactose so it might proceed more slowly than glucose consumption D. Both B and C
D. Both B and C
What would be the consequence of a nonfunctional RF3 GTPase domain? A. Translation would not initiate B. Elongation would remain incomplete or stall C. The polypeptide would not be released D. RF2 would not be released
D. RF2 would not be released
MutaQons in which of the following lac operon genes or regions are cis in their effect on the regulaQon of the operon? A. The lacI structural gene B. The lacZ structural gene C. The lacA structural gene D. The lacO operator E. The lacY structural gene
D. The lacO operator
The reading frame of mRNA is: A. all of the nucleotides of an mRNA molecule. B. any three nucleotides that can base pair with an anticodon. C. the first three nucleotides of a gene. D. a continuous, nonoverlapping set of three-nucleotide codons.
D. a continuous, nonoverlapping set of three-nucleotide codons.
Overexpression of a human protein in bacteria: A. requires a bacterial vector with a eukaryotic promoter sequence B. all of the above C. always results in a properly folded, active protein. D. requires a bacterial vector with a bacterial promoter sequence E. requires a bacterial vector with eukaryotic ribosome binding sites
D. requires a bacterial vector with a bacterial promoter sequence
A polylinker is a: A. DNA sequence that allows for selection of cells that contain the vector. B. synthetic DNA fragment used in to visualize colonies that contain the DNA of interest. C. synthetic DNA fragment inserted into a vector that allows replication of the vector in the host cell. D. molecule used to ligate DNA fragments together. E. synthetic DNA fragment that contains multiple restriction enzyme sites.
E. synthetic DNA fragment that contains multiple restriction enzyme sites.
Restriction enzymes: A. are found in a wide variety of mammalian cell types. B. cleave invading bacterial DNA. C. always produce sticky ends. D. are necessary for joining two DNA fragments together. E. typically cleave at palindromic sequences
E. typically cleave at palindromic sequences
If ribosome paired upstream rather than on the end of Region 1 would there be more or less attenuation.
No attenuation because regions 2 and 3 would be pairing
Consider the following conditions. In order to maximize efficiency, under which conditions should E. coli turn on its lac operon? (On or Off) glucose (+) and lactose (+)
Off
Consider the following conditions. In order to maximize efficiency, under which conditions should E. coli turn on its lac operon? (On or Off) glucose (+) and lactose (-)
Off
Consider the following conditions. In order to maximize efficiency, under which conditions should E. coli turn on its lac operon? (On or Off) glucose (-) and lactose (-)
Off
Consider the following conditions. In order to maximize efficiency, under which conditions should E. coli turn on its lac operon? (On or Off) glucose (-) and lactose (+)
On
Which of the following is NOT true of the formation of a bacterial translation initiation complex? a. IF-3 binding to GTP is required for the charged tRNA to associate with the first mRNA codon. b. N-formylmethionyl-tRNAfMet binds in the P site. c. IF-1, IF-2, and IF-3 dissociate upon the 50S subunit binding. d. The 30S ribosome associates with the mRNA before the 50S ribosome.
a. IF-3 binding to GTP is required for the charged tRNA to associate with the first mRNA codon.
Which one of the following statements is a feature of the wobble hypothesis? a. When inosine (I) is the first nucleotide of an anticodon, at least three different codons for the same amino acid can be recognized. b. An amino acid-specific tRNA molecule can recognize only one codon. c. The wobble occurs only in the third base of the anticodon. d. tRNA molecules can recognize codons that specify two different amino acids.
a. When inosine (I) is the first nucleotide of an anticodon, at least three different codons for the same amino acid can be recognized.
How does cAMP affect the expression of the lac operon? a. cAMP binds to the CRP, increasing its affinity for a DNA site near the promoter. b. cAMP binds to the Lac repressor, increasing its affinity for a DNA site near the promoter. c. cAMP binds to the CRP, decreasing its affinity for a DNA site near the promoter. d. cAMP binds to the Lac repressor, decreasing its affinity for a DNA site near the promoter.
a. cAMP binds to the CRP, increasing its affinity for a DNA site near the promoter.
Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by increasing the distance between sequences 2 and 3? a. increased attenuation and thus decreased transcription b. decreased attenuation and thus increased transcription c. no attenuation, and thus transcription would proceed at the maximum level
a. increased attenuation and thus decreased transcription
The bacterial Shine-Dalgarno mRNA sequence is specifically recognized by: a. the 16S rRNA of the 30S subunit. b. the 23S rRNA of the 50S subunit. c. protein S5 of the 30S subunit. d. N-formylmethionyl-tRNAfMet.
a. the 16S rRNA of the 30S subunit.
Which site on the ribosome is NEVER occupied by a tRNA linked to a nascent polypeptide chain? a. the E site b. the A site c. the P site
a. the E site
The partial sequence of one strand of a double-stranded DNA molecule is: 5´- - -GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG- - - 3´ The cleavage sites for the restriction enzymes EcoRI and PstI are shown below. Write the sequence of both strands of the DNA fragment created. When this DNA is cleaved with both EcoRI and PstI, what double-stranded sequence fragment is produced?
5'-GAAAGTCCGCGTTATAGGCATG-3' 3'- ACGTCTTTCAGGCGCAATATCCGTACTTAA-5'
Scientists sometimes use synthetic molecules in the lab that can act as inducers and/or substrates for β-galactosidase (lacZ). Consider the molecule IPTG. IPTG mimics allolactose and can bind the Lac repressor. You add IPTG to a culture of E. coli that contains no sugar of any kind. How will lac operon expression be affected? A) The lac operon will be activated B) The lac operon won't be activated C) The lac operon will be unaffected
A) The lac operon will be activated
A particular triplet of bases in the coding strand of DNA is 5'-TGA-3'. Which of the following is the anticodon component of the tRNA that binds the mRNA codon transcribed from this DNA? A. 3' - ACU - 5' B. 3' - AGU - 5' C. 3' - UCT - 5' D. 3' - UCA - 5'
A. 3' - ACU - 5'
Which role do ATP and GTP play in translation? A. ATP is used for bond formation, GTP for conformational changes B. GTP is used for bond formation, ATP for conformational changes C. Both are used for bond formation D. Both are used for structural changes
A. ATP is used for bond formation, GTP for conformational changes
Which of the following describes the function of the lacO region of the lac operon? A. Mutation of this region leads to constitutive expression of the operon. B. It encodes for the galactoside permease protein. C. It encodes for the Lac repressor protein. D. It contains the promoter for the operon.
A. Mutation of this region leads to constitutive expression of the operon.
Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by changing the two Trp codons in the leader peptide gene to His codons? A. The attenuation system would respond more to histidine than to tryptophan concentration. B. The attenuation system would continue to respond more to tryptophan than to histidine concentration.
A. The attenuation system would respond more to histidine than to tryptophan concentration.
Which of the following is NOT true of genomic and cDNA libraries? A. cDNA libraries contain one cDNA per gene expressed in a cell B. Genomic libraries usually contain larger fragments C. Genomic libraries contain fragments of genomic DNA that are generated by partial digests with restriction enzymes. D. cDNA libraries contain cDNAs made from mRNA. E. cDNA libraries only contain sequences from transcribed genes.
A. cDNA libraries contain one cDNA per gene expressed in a cell
Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by changing several nucleotides in sequence 3 so that it can base-pair with sequence 4 but not with sequence 2? A. increased attenuation and thus decreased transcription B. Increased attenuation and thus decreased transcription, because pairing of sequences 3 and 4 would almost always occur. C. decreased attenuation and thus increased transcription D. no attenuation, and thus transcription would proceed at the maximum level
A. increased attenuation and thus decreased transcription
A lac operon of genotype lacI+ lacP+ lacO+ lacZ+ lacY- will produce b-galactosidase and BUT NOT lac permease when: A. lactose is present B. lactose is absent C. in the presence OR absence of lactose D. when glucose is present E. all of the above
A. lactose is present
Ligation reactions occur most efficiently between DNA fragments: A. that have complementary sticky ends. B. where one fragment has a sticky end and the other has a blunt end. C. that have sticky ends. D. that have blunt ends. E. that are cleaved with different restriction enzymes.
A. that have complementary sticky ends.
You have introduced a mutation into CAP that causes it to lose its ability to bind cAMP. How will this affect expression of the lac operon? A) The lac operon will always be activated B) The lac operon will never be activated C) The lac operon will be unaffected
B) The lac operon will never be activated
You have introduced a mutation into lacI that causes the Lac repressor to lose its ability to bind allolactose. How will this affect expression of the lac operon? A) The lac operon will always be activated B) The lac operon will never be activated C) The lac operon will be unaffected
B) The lac operon will never be activated
You perform two vitro translation experiments: one includes wild type IF2 and the other includes a mutant version of IF2 that cannot hydrolyze GTP. Which of these centrifugation results corresponds to the experiment to which mutant IF2 was added? A. more protein present on the 70s peak (skewed towards 70S) B. centered at the 50S peak with rarely anything on the 70S and 30S
B. centered at the 50S peak with rarely anything on the 70S and 30S
E. coli cells are growing in a medium containing lactose but no glucose. How would a mutation that completely inactivates galactoside permease affect expression of the lac operon? A. increase expression of the lac operon B. decrease expression of the lac operon C. not change expression of the lac operon
B. decrease expression of the lac operon
Which one of the following polypeptide sequences will be made from the RNA sequence shown, translating from the first start codon to the stop codon? 5'-CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU - 3' A. Arg-His-Ala B. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly-Tyr-Pro-Phe C. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly D. Met-Pro-Lys-Ile
C. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly
Based on the results of Singer and Nirenberg's experiments where they determined the 5' UUUUU 3' coded for phenylalanine in the protein, could they also determine whether the genetic code was overlapping or non-overlapping? A. Yes, because the template they used was always in multiples of three bases. B. Yes, because they always ended up with the same product. C. No, because all the products would be the same irrespective of overlapping or non-overlapping. D. No, because they would have to include a start codon to know where the reading frame started.
C. No, because all the products would be the same irrespective of overlapping or non-overlapping.
Gene expression is o\en assayed by measuring the level of mRNA produced from a gene. If one is interested in knowing the amount of a final active gene product, a potential problem of this method is that it ignores the possibility of _____. A. Chromatin remodeling B. Alternative splicing C. Translational control D. Transcriptional control
C. Translational control
A lac operon of genotype lacI- lacP+ lacO+ lacZ+ lacY+ produces b-galactosidase AND permease when: A. lactose is present B. lactose is absent C. in the presence OR absence of lactose D. when glucose is present E. all of the above
C. in the presence OR absence of lactose
E. coli cells are growing in a medium containing lactose but no glucose. How would a mutation that prevents Lac repressor binding to the operator affect expression of the lac operon? A. increase expression of the lac operon B. decrease expression of the lac operon C. not change expression of the lac operon
C. not change expression of the lac operon
The genetic code is degenerate because: A. one particular amino acid can only be encoded by one codon. B. not all possible codons are used to code for amino acids. C. one particular amino acid can be encoded by more than one codon. D. one particular codon can code for more than one amino acid
C. one particular amino acid can be encoded by more than one codon.
A positive result for the yeast two-hybrid analysis means that: A. two fusion proteins interact with each other and because the Gal4p binding domain on one fusion protein binds to the reporter gene and the Gal4p activation domain of the other fusion protein interacts with RNA polymerase, the reporter gene is activated B. two fusion proteins, one containing the Gal4p binding domain and one containing the Gal4p activation domain, have interacted through their Gal4p domains turning off transcription of the reporter gene C. two fusion proteins, one containing the Gal4p binding domain and one containing the Gal4p activation domain, have interacted through their resulting in transcription of the reporter gene. D. two fusion proteins, one containing the Gal4p binding domain and one containing the Gal4p activation domain are being expressed in the same yeast cell
C. two fusion proteins, one containing the Gal4p binding domain and one containing the Gal4p activation domain, have interacted through their resulting in transcription of the reporter gene.
When transformed into bacteria, which vector would lead to expression of a fusion protein? A. the vector containing the coding sequences of two proteins; each sequence is mutated so the two proteins will bind when they are expressed B. the vector containing the coding sequences of two proteins; each sequence is located within a separate selectable marker C. the vector containing the coding sequences of two proteins; each sequence is located within a different polylinker D. the vector containing the coding sequences of two proteins located adjacent to one another within a polylinker E. the vector containing the coding sequences of two proteins; one located within a polylinker and one within a selectable marker
D. the vector containing the coding sequences of two proteins located adjacent to one another within a polylinker
14C-labeled lysine was added to an in vitro translation system consisting of purified components necessary for E. coli translation and the rest of the amino acids in unlabeled form. In one experiment, the in vitro translation was performed in the absence (-) of RNA template. In a second reaction, in vitro translation was performed in the presence (+) of poly(U) RNA template. The amount of radioactive polypeptide produced was measured as acid precipitable cpm. Which of the results, A, B, C, or D, would be expected for these two experiments? a. D ((-) is 30 cpm (+) is 30 cpm) b. C ((-) is 0 cpm (+) is 0 cpm) c. A ((-) is 30 cpm (+) is 0 cpm) d. B ((-) is 0 cpm (+) is 30 cpm)
b. C ((-) is 0 cpm (+) is 0 cpm)
Name the type of chemical bonds that link a codon in mRNA to an anticodon in tRNA a. Phosphodiester b. Hydrogen c. Amide or peptide d. Noncovalent bonds, including hydrogen bonds and van der Waals forces
b. Hydrogen
Which of the following is NOT true of the lacI region of the lac operon? a. It produces a diffusible product that can regulate the expression of the operon. b. It is bound by the Lac repressor when lactose is unavailable. c. Its mutation leads to constitutive expression of the operon. d. It is transcribed separately from the operon.
b. It is bound by the Lac repressor when lactose is unavailable.
Which of the following is NOT a characteristic of a riboswitch? a. Ligand-binding to a riboswitch may sequester the Shine-Dalgarno sequence. b. They exert gene expression control only at the level of translation. c. They are structures that can form in the 5' untranslated region of some mRNA molecules. d. They may physically bind to small-molecule metabolites.
b. They exert gene expression control only at the level of translation.
The products of the hydrolysis of lactose by β-galactosidase are: a. glucose and ribose. b. galactose and glucose. c. galactose and allolactose. d. glucose and allolactose.
b. galactose and glucose.
Which of the following scenarios leads to the HIGHEST level of lac operon expression? a. high glucose levels, lactose absent b. low glucose levels, lactose present c. low glucose levels, lactose absent d. high glucose levels, lactose present
b. low glucose levels, lactose present
Which of the following is NOT a function of EF-G in bacterial translation? a. the hydrolysis of GTP b. the hydrolysis of the terminal peptidyl-tRNA bond c. the mediation of elongation d. the separation of the ribosome from the mRNA at termination
b. the hydrolysis of the terminal peptidyl-tRNA bond
Translate the following mRNA into protein, starting from the first initiation codon: 5'CCGAUGCCAUGGCAGCUCGGUGUUACAAGGCUUGCAUCAGUACCAGUUUGAAUCC-3' a. Arg-Cys-His-Gly-Ser-Val-Leu-Gln-Gly-Leu-His-Tyr-Gln-Phe-Gln-Phe b. Met-Ala-Ala-Arg-Cys-Tyr-Lys-Ala-Cys-Ile-Ser-Thr-Ser-Leu-Asn c. Met-Pro-Trp-Gln-Leu-Gly-Val-Thr-Arg-Leu-Ala-Ser-Val-Pro-Val-(stop) d. Pro-Met-Pro-Trp-Gln-Leu-Gly-Val-Thr-Arg-Leu-Ala-Ser-Val-Pro-Val-(stop)
c. Met-Pro-Trp-Gln-Leu-Gly-Val-Thr-Arg-Leu-Ala-Ser-Val-Pro-Val-(stop)
Which of the following is NOT true of the second step of translational elongation in bacteria? a. The growing polypeptide chain is transferred to the tRNA in the A site. b. The α-amino group of the A-site amino acid attacks the carbonyl carbon of the P-site amino acid. c. The carboxyl group oxygen of the A-site amino acid is the nucleophile in peptide bond formation. d. A peptide bond is formed between the two amino acids bound by the tRNAs in the A and P sites.
c. The carboxyl group oxygen of the A-site amino acid is the nucleophile in peptide bond formation.
The following RNA polymer is added to an E. coli extract, where it can be translated in all three possible reading frames. Which amino acids can be polymerized into polypeptides in this system? 5'-AUAUAUAUAUAUAUAUAUAUAUAUAUAU-3' a. Tyrosine Two amino acids can be incorporated into a polymer, and the only polymer produced is poly(Tyr-Ile). b. Isoleucine Two amino acids can be incorporated into a polymer, and the only polymer produced is poly(Tyr-Ile). c. Tyrosine and Isoleucine Two amino acids can be incorporated into a polymer, and the only polymer produced is poly(Tyr-Ile).
c. Tyrosine and Isoleucine Two amino acids can be incorporated into a polymer, and the only polymer produced is poly(Tyr-Ile).
The binding of tryptophan to the Trp repressor protein results in: a. the dissociation of the repressor from the operator sequence. b. the recruitment of RNA polymerase. c. a conformational change in the repressor that allows the repressor to bind the operator. d. an increase in the expression of tryptophan biosynthetic enzymes.
c. a conformational change in the repressor that allows the repressor to bind the operator.
The result obtained in Jacob and Monod's merodiploid analysis that suggested the lacI region acts in trans to regulate the lac operon was that a nonfunctional: a. lacO mutant is rescued by a wild-type lacO allele. b. lacI mutant cannot be rescued by a wild-type lacI allele. c. lacI mutant is rescued by a wild-type lacI allele. d. lacO mutant cannot be rescued by a wild-type lacO allele.
c. lacI mutant is rescued by a wild-type lacI allele.
Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by removing sequence 4? a. increased attenuation and thus decreased transcription b. decreased attenuation and thus increased transcription c. no attenuation, and thus transcription would proceed at the maximum level
c. no attenuation, and thus transcription would proceed at the maximum level
Which of the following steps of translation does NOT specifically require the hydrolysis of GTP? a. release of EF-Tu from the aminoacyl-tRNA inserted at the A site b. dissociation of certain release factors during termination c. the peptidyl transferase reaction d. the movement of the ribosome one codon toward the 3ʹ end of the mRNA
c. the peptidyl transferase reaction
Which of the following BEST describes the composition of the bacterial translation initiation complex? a. 30S and 50S subunits, mRNA start codon paired with the anticodon of fMet-tRNAfMet, fMettRNAfMet bound in the P site, A site is open, GTP is bound by IF-2 b. 30S and 50S subunits, mRNA start codon paired with the anticodon of fMet-tRNAfMet, fMettRNAfMet bound in the A site, P site is open, GTP is bound by IF-2 c. 30S and 50S subunits, mRNA start codon paired with the anticodon of fMet-tRNAfMet, fMettRNAfMet bound in the A site, P site is open d. 30S and 50S subunits, mRNA start codon paired with the anticodon of fMet-tRNAfMet, fMettRNAfMet bound in the P site, A site is open
d. 30S and 50S subunits, mRNA start codon paired with the anticodon of fMet-tRNAfMet, fMettRNAfMet bound in the P site, A site is open
Which one of the following bacterial translational proteins is NOT a GTP-binding protein? a. EF-G b. EF-Tu c. IF-2 d. RF-1
d. RF-1
Which of the following is NOT true of the lac operon? a. The Lac repressor protein is constitutively expressed. b. Transcription produces a single polycistronic mRNA containing the lacZ, lacY, and lacA genes. c. The operator region regulates transcription through interaction with the Lac repressor protein. d. The lacI gene is controlled from the same promoter as the lacZ gene.
d. The lacI gene is controlled from the same promoter as the lacZ gene.
Which of the following is TRUE of the mechanism of transcription attenuation of the trp operon? a. The ribosome stalls at the adjacent Trp codons when the levels of tryptophan in the cell are high. b. When sequences 2 and 3 of the leader sequence associate, transcription is terminated prematurely. c. The leader peptide mechanism is analogous to a repressor protein. d. The stalling of the ribosome at region 1 of the leader sequence inhibits the formation of the terminator structure
d. The stalling of the ribosome at region 1 of the leader sequence inhibits the formation of the terminator structure
Catabolite repression of the lac operon restricts expression when: a. lactose is present. b. glucose is absent. c. lactose is absent. d. glucose is present.
d. glucose is present.
The result obtained in Jacob and Monod's merodiploid analysis that suggested the lacO region acts in cis to regulate the lac operon was that a nonfunctional: a. lacI mutant cannot be rescued by a wild-type lacI allele. b. lacI mutant is rescued by a wild-type lacI allele. c. lacO mutant is rescued by a wild-type lacO allele. d. lacO mutant cannot be rescued by a wild-type lacO allele.
d. lacO mutant cannot be rescued by a wild-type lacO allele.
The Lac repressor protein binds to the: a. operator in the presence of allolactose. b. operator regardless of the presence or absence of allolactose. c. lacZ gene in the presence of allolactose. d. operator in the absence of allolactose.
d. operator in the absence of allolactose.
What if there was a mutation of region 2 that could no longer base pair, would you get attenuation?
yes
