Microbiology Exams 1-3 Review

You contract measles virus. In virology class, you learn that this virus has 9 unique antigens and 11 unique epitopes. How many different T-helper cells will be specific for this measles virus?

1 for each epitope; 11

T/F: When people misuse antibiotics, their body can develop resistance to the drugs.

False -when people misuse antibiotics its the bacteria that become resistant not the persons body

This is a blood smear taken from a person with a blood infection. The correct morphology and arrangement of the bacteria shown in this image are

Streptococci

A tRNA with the anticodon 3' ACA 5' will carry the amino acid _________. a. Thr b. Cys c. Glu d. Gly

b. Cys

H2S is going to donate electrons to an electron acceptor. Using which of the following electron acceptors would yield the most energy that could be used to generate ATP? a. S b. Fe3+ c. NO3- d. H2O e. all the same

b. Fe3+

Coronavirus spikes consist of two subunits, S1 and S2, and it is well known that S2 is relatively conserved whereas S1 is more rapidly evolving. The S1 subunit substitutes some amino acids within a small region of the Coronavirus spikes. This is a real life example of_______________. a. antigenic shift b. antigenic drift c. neither

b. antigenic drift

In what order will the following be laid down during DNA replication? a. L then J then K b. K then J then L c. All three will be laid down at the same time

a. L then J then K

In the nitrogen cycle, N2 is reduced to __________ during nitrogen fixation. a. NH3 b. N2 c. NO2- d. NH4+

a. NH3

You find an enzyme that is regulated when a ~P bond is added to the enzyme. This binding causes the shape of the enzyme to change such that it cannot bind substrate as well. This is an example of a. Feedback inhibition b. Positive covalent modification c. Negative allosteric regulation d. Negative covalent modification e. Positive allosteric regulation

d. Negative covalent modification

Two bacteria have been isolated from the soil, and each one uses H2 as the initial electron donor. Which one will produce the most ATP? a. One that uses H+ as the final electron acceptor b. One that uses H2O as the final electron acceptor c. One that uses S as the final electron acceptor d. One that uses NO3- as the final electron acceptor e. You cannot tell from the given information.

d. One that uses NO3- as the final electron acceptor

If you could pack these items one inside the other, starting with the smallest inside and working out to the largest, how would you arrange them inside to outside? a. Protozoan, macrophage, bacterium, prion, virus b. Macrophage, protozoan, bacterium, virus, prion c. Prion, virus, protozoan, macrophage, bacterium d. Bacterium, macrophage, protozoan, virus, prion e. None of these is correctly ordered

e. None of these is correctly ordered

You are performing a Gram stain on a bacterium that doesn't produce endospores. What color will the cells appear if you do every step correctly?

either pink or purple -typically gram-positive bacteria are the most likely to make spores, but not all of them produce spores so we don't know if we don't observe spores, it could be either

You isolate a spore-forming bacterium that produces an endospore in the terminal position with swollen sporangium. You perform an endospore stain on your new bacteria and realize you forgot to use the secondary stain. What will you see under the microscope? (assume the organism is sporulating)

green spores and red/orange germinating cells

Your cat contracts tetanus so the vet gives him an anti-toxin shot. Three years later, your cat steps on a rusty nail and contracts tetanus again. Your vet tells you that you don't need to worry because the anti-toxin shot will provide protection for the second occurrence of tetanus . Do you agree with your vet? yes or no

no

Assuming that aerobic respiration is available, beta oxidation of an 8 carbon fatty acid will yield ___ ATP/GTP molecules. a. 59 b. 9 c. 35 d. 38 e. 63

not a

For the mRNA given below, what is the anti-codon for the tRNA carrying the 2nd amino acid incorporated in the protein (before post-translational modifications)? 5'AUGCGCAUGAAGGACUGGUGCCUACAAUGCUAACGUCUGGUGACUGCAGCUGGUACC 3' a. 5' CGC 3' b. 3' GAU 5' c. 5' CUA 3' d. 3' GCG 5' e. 3' AGA 5'

not a

Which of the following is the least energetic catabolic pathway? a. Anaerobic Respiration of Glucose b. Beta Oxidation of a Lipid c. Fermentation d. Aerobic Respiration of Glucose e. Catabolism of a Protein

not a

You isolate a bacterial chromosome that has a mutation in its ori. Which of the following could be true? a. Translation may not begin. b. DNA replication may not begin. c. None of the above could be true. d. Transcription may not begin. e. Transcription may not be able to end.

not a

You perform a chemorepellent assay on a bacterial strain to determine if it can swim away from a toxic chemical-soaked disk. You check the plates the next day and see the following results. From these results, is this bacterial strain motile? a. Yes, the bacteria swam away from the disk b. Yes, the bacteria swam toward the disk c. No, the bacterium was unable to swim away from the disk d. No, the repellent inhibited the growth of the bacteria e. Cannot determine

not a

Your pet bacterium, Brennan, is eating a snack. He is metabolizing fructose 1,6-diphosphate, glyceraldehyde 3-phosphate and acetyl-CoA molecules via anaerobic respiration. From which will he get more energy? a. Acetyl-CoA b. The energy yield would be the same. c. Fructose 1,6-diphosphate d. Glyceraldehyde 3-phosphate

not a

Your physician suggests that your baby is breast fed to help avoid infections. What antibody will the baby get from the breast milk that will help avoid infections? a. IgG b. IgM c. IgA d. IgE e. all of the above

not a

Given the following prokaryotic mRNA, how many ATP or GTP will be utilized to perform translocations during translation? (You may need to scroll to the right to see the entire sequence.) 5'GCCCAAGGACGUAUGCGAUUUGUGGAUUAGCGCUAGUUAAUUCUGAGUCCGGUAGUU 3' a. 3 b. 6 c. 0 d. 5 e. 4

not a. 3

Which of these represent the structure of Gram-negative peptidoglycan? a. A b. B c. C d. A and B e. A, B, and C f. none

not b

You are a bacterial geneticist studying the ligase enzyme. To better understand its function, you knockout (delete) the ligase gene in your laboratory bacterial strain. What type bond would you expect to be decreased in the bacteria, and where would you expect to see unformed bonds during DNA replication? a. hydrogen bond; 3' end of the replaced RNA primers. b. phosphodiester bond; 5' end of the previous Okazaki fragments. c. phosphodiester bond; 3' end of the replaced RNA primers. d. hydrogen bond; 5' end of the previous Okazaki fragments.

not b

You contract Rotavirus (which causes stomach flu). In virology class, you learn that this virus has 7 unique antigens and 12 unique epitopes. How many different T-helper cells will be specific for this Rhinovirus? a. 1 norovirus specific b. 1 for each antigen; 7 c. 1 for each epitope; 12 d. 1 for each antigen and 1 for each epitope; 19

not b

You isolate a new organism and analyze its mRNA. You find that the mRNA contains one gene and no Shine Dalgarno sequence. What type of organism would this most likely be? a. protozoan b. neither bacterium nor protozoan c. bacterium or protozoan d. bacterium

not b

If you evenly spread 37 E. coli cells onto an agar plate. After 24 hours incubation, how many colonies would you expect to see? Assume the colonies would be visible within this time frame. a. 3.7 b. 37 c. 370 d. 37,000 e. 3.7 x 10^6

not c

This is a bacterial growth curve in a closed culture system. During which phase(s) do you predict lysozyme would function if you add it to this culture? a. w b. x c. w, x d. w, x, y e. w, x, y, z

not c

You isolate a novel virus that causes severe inflammation. Which of the following could be true about this new virus? a. It has a phospholipid bilayer plasma membrane surrounding cytoplasm b. It could have a DNA genome surrounded by a protein shell c. It could have an RNA genome surrounded by a protein shell d. None listed could be true e. It could have a DNA or RNA genome surrounded by a protein shell

not c

You have an IgM antibody and an IgG antibody both specific for the same epitope on a surface protein of Hepatitis B. How will they differ? a. Both the variable and constant light and heavy chains will be different from one another. b. Only the variable region of the light chain will be different c. Only the constant region of the heavy chain will be different d. The variable region of both the heavy and light chain will be different

not d

You isolate a new bacterium that carries out the reaction NH4+ + 2H2O --> NO2- + 8H+ + 6e-. Theoretically, what nutritional group could this microbe belong to? a. chemoorganoheterotrophs b. chemolithoautotroph c. photoorganoheterotroph d. a or b e. all of the above

not d

You isolate a piece of nucleic acid that has mutations in the Shine-Dalgarno sequence. Assuming the mutations cause the Shine-Dalgarno sequence to lose its function, which of the following could be true? a. The ribosome would not align as well with this mRNA b. The mRNA-ribosome complex would not dissociate as well at the end of protein synthesis c. Cannot be determined from the given information d. RNA polymerase would not bind to this mRNA as well e. RNA polymerase would not recognize this mRNA as well

not d

In sewage treatment, which of the following microbes would least efficiently remove BOD? a. Anaerobic Chemolithotrophs b. Fermenters c. Aerobic Respirators d. Aerobic Chemolithotrophs e. Anaerobic Respirators

not d. Aerobic Chemolithotrophs

An electron transport chain converts ADP to ATP in all of the following EXCEPT: a. fermentation and chemolithotropy b. fermentation c. all the above d. respiration e. chemolithotropy

not e

You swab the inside of your friend's nose and place the swab into a tube of sterile, liquid broth. You incubate the tube for 24 hours at 37 degrees Celsius (C). The next day pour all the liquid broth onto an agar plate and incubate the plate for 24 hours at 37 degrees C. If 180 bacterial colonies have grown on the plate, how many bacterial cells were in the liquid broth before you poured it onto the plate? You can assume the swab was sterile before you began. a. 90 b. 180 c. 1.8 x 10^6 d. 360 e. not enough information is given to determine

not e

You perform a Gram stain on a bacterium that is producing endospores. What color will the vegetative cells most likely appear after a properly prepared Gram stain?

purple

You go to Africa and get bitten by a tsetse fly and develop sleeping sickness. Your doctor tells you the sleeping sickness parasite has 7 unique antigens and 13 unique epitopes. How many different B cells will be specific for the sleeping sickness parasite?

1 for each epitope: 13

What is the total energy yield of the TCA cycle for one pyruvate, including the intermediate step when pyruvate goes to acetyl-CoA?

1 GTP, 4 NADH, 1 FADH2

SHORT ANSWER: Please complete the following table using the following terms ("fill in" each blank by denoting 1, 2, 3, etc..). If an electron donor may also serve as an electron acceptor, then you may use that item more than once, but you must use a different electron donor for each metabolism. Electron acceptors may be used more than once. Initial e- donors for: 1) anaerobic respiration 2) fermentation 3) anaerobic chemolithotropy Pathways used: 4) anaerobic respiration 5) fermentation 6) anaerobic chemolithotropy Final e- acceptors for: 7) anaerobic respiration 8) fermentation 9) anaerobic chemolithotropy

1) Fructose 1, 6-diphosphate 2) Sugar 3) H2 4) Glycolysis, Intermediate Step of TCA, TCA, ETC 5) Glycolysis 6) ETC 7) NO3- 8) Pyruvate 9) NO3-

You're studying for your Microbiology exam, and one of your study buddies says that the innate response only occurs during the primary immune response and that the adaptive immune response is only during the secondary response. 1) Is your study buddy correct? 2) When does innate immunity occur? 3) When does adaptive immunity occur? Both primary and secondary responses

1) No 2) both primary and secondary responses 3) both primary and secondary responses

SHORT ANSWER: Please describe how at least 3 example differential stains work. Be sure to describe (a) what does the stain differentiate, and (b) what does a positive result look like and mean, and what does a negative result look like and mean? In your answer, please number your strains 1, 2 and 3. Example: 1. Stain type - (a) What does the stain differentiate? (b) What does a positive result look like and mean, and what does a negative result look like and mean?

1. Gram Stain: (a) differentiates between gram-negative and gram-positive bacteria via cell wall type structural characteristics, (b) a gram-positive bacterium will stain purple meaning that they have a thicker peptidoglycan layer (c) a gram-negative bacterium will stain pink meaning that they have a thinner peptidoglycan layer. 2. Acid-fast Stain: (a) determines the presence/production of a mycolic acid waxy-layer around the bacterium's cell wall (neither specific to gram -/+) , (b) acid-fast cells will stain hot pink meaning that they produce mycolic acid and have a waxy layer present which requires the addition of heat to allow stains to penetrate the waxy layer, (c) a non-acid-fast cell will stain blue meaning that they do not produce mycolic acid nor do they have the waxy layer present. 3. Endospore Stain: (a) determines the presence and production of endospores and spore-producing bacteria, (b) spore producing cells will stain pink with green endospores meaning that there are clearly spore present, being produced by the bacterium, (c) non-spore forming cells will stain pink with no green endospores, no green anything, meaning that there are no spores present nor being formed.

According to these graphed data, this drug could be targeting (disregard the increasing mortality of the Eukaryote, 1st rule of Toxicology is: too much of anything is toxic)

70S ribosomes and peptidoglycan -this drug is probably binding to a 70S variable sequence that is only in prokaryotes, not eukaryotes because the eukaryotes are not dying

SHORT ANSWER: You are designing antimicrobial drugs. You have developed drugs that function by inhibiting the following functions. Please indicate if these drugs will work (yes or no) on the following types of organisms. Please briefly explain your answer for each and label your answers 1A, 1B, etc. 1. Inhibiting the formation of tetrapeptides in peptidoglycan Gram positive bacteria Gram negative bacteria Archaebacteria Protozoa 2. Inhibiting lysosome function Gram positive bacteria Gram negative bacteria Archaebacteria Protozoa

1.Inhibiting the formation of tetrapeptides in peptidoglycan a. Gram positive bacteria - yes b/c have peptidoglycan b. Gram negative bacteria - yes b/c have peptidoglycan c. Archaebacteria - no, absent peptidoglycan d. Protozoa - no , absent peptidoglycan 2. Inhibiting lysosome function a. Gram positive bacteria - no membrane bound organelles b. Gram negative bacteria - no membrane bound organelles c. Archaebacteria - no membrane bound organelles d. Protozoa - yes, they have membrane bound organelles including lysosomes

There are 4 proteins on the surface of one protozoan that serve as antigens. Protein X has 2 different antibody binding sites, Protein Y has 2, and Protein Z has 6. How many different B cells will be specific for this protozoan?

10 different B cells; one for each epitope

Given the following non-template DNA strand, what would be the mRNA produced during transcription? (A is the +1) 5'TATTGGAGCAGTAGCTGATCGTGGATCACTAAACCTGAGGACGTAAGATGCATCGTATTGGACTGATCGTGGATCACTAGAACGTA 3'

5'-AAACCUGAGGACGUAAGAUGCAUCGUAUUGGACUGAUCGUGGAUCACUAGAACGUA-3'

You isolate a bacterium that, normally, does not cause illness. However, you find that this bacterium has become pathogenic due to a mutation that has caused it to produce a capsule. Why has the development of this new, external structure increased this bacterium's pathogenicity?

A capsule prevents phagocytosis by the host's immune response

SHORT ANSWER: You develop a series of antibiotics that inhibit the function of RNA polymerase. Antibiotic A kills yeast cells. Antibiotic B kills bacteria, archaebacteria and the protozoan that causes Giardia. Antibiotic C kills bacteria and archaebacteria. A. Which drug(s) would you expect to achieve selective toxicity in humans and why? (3 points) B. Which of these drugs would have the lowest therapeutic index? Explain your answer. (3 points)

A) C only because it only binds/targets a variable sequence only found in bacteria and archaebacteria and NOT the eukaryotic RNA polymerase (such as humans!) B) A or B (will accept either/or, or both) would have the lowest TI, because it binds/targets RNA polymerase sequence that is conserved in eukaryotes (both the yeast cells and protozoan and probably humans!) -antibiotic A can only bind to sequence host/eukaryote cells seen in yeast; conserved sequence for eukaryotes -antibiotic B targets the enzyme in all of these species so binds to a conserved region not variable -antibiotic C only binds to a highly variable region in the bacteria and is not harmful to the host so this is the most likely drug to achieve selective toxicity Selective toxicity = drug is toxic to the microbe (e.g. bacteria) but not the host (eukaryote); conserved versus variable regions

SHORT ANSWER: Please answer the following questions about Bonnie Bassler's TED Talk. Please denote your answers a-c. a) What bacterial mechanism did Dr. Bonnie Bassler's group discover and briefly explain it like you would to your non-Microbiology friend. b) How does this bacterial mechanism relate to the pathogenesis of the Clostridium tetani infection in Mikey the Tetanus Dog? Be specific about what the bacteria are producing that directly causes signs and symptoms. c) How could Bonnie Bassler's mechanism be targeted to treat Mikey?

A) Dr. Bassler's group discovered Quorum Sensing, a communication mechanism between bacteria, in response to cellular population densities that allows bacteria to control specific processes (i.e., gene expression/regulation to control things like virulence factor expression, adaptation mechanisms, protein secretion, metabolite production, etc.) and coordinate group behaviors. Furthermore, bacteria have specific signal molecules that can be sent to other's within its own population or to bacteria cells of a different population. When a specific bacterial species has a high population density they can signal to each other to use their numbers to take advantage of the opportunity to collectively outcompete other bacteria populations and take over a hosts resources. B) C. tetani bacteria produce an neurotoxin (~type of exotoxin) that gets actively secreted into the bloodstream and binds to neural cell synaptic receptors, inhibiting the cellular functions and blocks neurotransmitters that regulate motor functions such as muscle contraction/relaxation. This leads to rigid spastic paralysis resulting in the clinical symptoms of body stiffness and loss of motor function control. The bacterial gene expression/regulation that encodes for the production and secretion of the harmful neurotoxins can be enhanced by bacterial Quorum Signaling and enables the bacteria to take over the host body. C) The Quorum Sensing signal molecules that are produced by the bacteria can be neutralized or inactivated by a specific molecule targeting drug. Alternatively, the binding sites for these signal molecules can be inhibited via the use of specific competitive-binding complexes to block the signals from being received. Interfering with the cell-to-cell communication resulting in advantageous group behaviors can take the infection opportunity, preventing bacterial pathogenicity, away from the bacterial species. The remaining population can then be further managed with antibiotics capable of targeting the C. tetani bacteria. Lastly, antitoxins can be administered to neutralize the unbound toxins that remain in the bloodstream.

SHORT ANSWER: Briefly explain to your roommate: (Please denote your answers as A and B) A) What is herd immunity and how can herd immunity help protect your immunocompromised (and, therefore, unvaccinated) roommate from getting COVID? B) How is herd immunity acquired?

A) Herd immunity is when a sufficient percent of a population, >80% of the population most recommended by health professionals for COVID-19 (but otherwise depends on the pathogen level of contagiousness), has acquired immune protection (~immunity). Herd immunity indirectly protects those at risk, vulnerable individuals within the population that include the elderly, children, or immunocompromised by controlling the spread of the virus and potential exposure/infection of those at risk; who cannot receive the vaccine nor mount a proper immune response themselves. Herd immunity helps control the spread of the virus by making it harder for the virus to infect a new host. Additionally, it decrease the severity of health effects due to COVID-19 infection which can further help manage rates of hospitalization and deaths due to COVID-19 complications. B) Herd immunity is acquired when >80% of the population has obtained either active naturally acquired immunity, after recovery from previous exposure and infection, which has more severe potential health consequences. Alternatively, active artificially acquired immunity can be obtained from non-infectious inoculation which exposes the immune system to the pathogenic agents so that it can be easily recognized if future infection occurs. Actively acquired immunity enables the host to have long-term immune protection and be prepared to fight an infection by stimulating the formation of the immunologic memory, with a rapid, specific and robust response of the adaptive immune system.

SHORT ANSWER: You isolate a bacterium that performs the following reaction = 8/10 pts were awarded: NO3- ---> NO2- A) Is this an oxidation or reduction? B) Is NO3- serving as the electron acceptor or donor? Acceptor C) What kind(s) of metabolism could this organism be carrying out? D) For each type of metabolism this organism could be performing, indicate what pathways they will use in the process. Glycolysis, Intermediate Step of TCA, Beta-Oxidation, , TCA, ETC E) For each metabolism chosen, please provide a specific example of a half reaction (either a reduction or oxidation half reaction) that would work with the one given (e.g. NO3- ---> NO2- ).

A) Reduction B) Acceptor C) Anaerobic respiration or anaerobic chemolithotrophy D) Glycolysis, Intermediate Step of TCA, Beta-Oxidation, , TCA, ETC E) H2S-->S; Glucose-->CO2

SHORT ANSWER: You get a phone call from your unvaccinated co-worker saying that they tested positive for COVID. This is their first positive test. Please fill in the following information about your co-worker's primary immune response. Please denote your answers a-f. A) What cells present COVID epitopes to CD4 T cells? What surface molecule is required to present epitopes to CD4 T cells? B) What cells present COVID epitopes to CD8 T cells? What surface molecule is required to present epitopes to CD8 T cells? C) What else besides the surface molecule in part A presenting an epitope is needed for the activation and differentiation of naïve CD4 T cells into T-helper cells? D) What cell produces growth factors/cytokines to stimulate the activation of B cells? E) Which cells become plasma cells and what do plasma cells do? F) Which antibody isotype would you isolate from your nasal swab on day 3 after infection with this virus? On day 14 after infection with this virus?

A) macrophages, dendritic APCs, MHCII B) APCs MHCI and TCR, or any nucleated cell C) they need to recognize and bind their specific antigen and cytokines secreted by the differentiated cells D) T-helper cells E) Activated B-cells that undergo clonal selection/expansion produce plasma cells which are essentially short-lived antibody factories that will mostly die after an infection has been cleared, while some will remain as memory B-cells. F) IgM then IgA

SHORT ANSWER: Intercalating agents are far more likely to cause frameshift mutations than DNA-modifying agents. *Please answer each part by denoting A,B,C, etc. A. How do intercalating agents cause mutations? (1 point) B. How do DNA-modifying agents cause mutations? (1 point) C. Why are intercalating agents more likely to cause frameshift mutations?

A. Intercalating agents cause mutations by causing abnormal spacing by getting in between adjacent bases causing a distortion in the DNA, which causes a frameshift mutations in the base pairs following the abnormal interjection. The intercalating agent causes DNA polymerase to get confused by the random thing and so it attempts to correct the issue by adding a random base/base pair so it can continue replication. When DNA polymerase adds the random base pair in an attempt to fix the issue, this causes a frameshift down mutation for the rest of the replication sequence. B. DNA-modifying agents cause mutations via a mutagen that causes a change in a base's structure, changing it's base pairing behavior or specificity. An example is alkylating agents that add groups, such as CH3, to the oxygen on guanine causing it to be able to form double hydrogen bonds/base pair with thymine instead of cytosine which may cause a significant mutation. C. Intercalating agents are more likely to cause frameshift mutations because the DNA polymerase tries to compensate for the confusion and changes the reading frame for everything after the intercalating agent. This is a fully random addition of a new base pair whereas the DNA-modifying enzyme is not adding a new nucleotide per say but just changing the binding behavior or specificity of the nucleotide to another. The DNA-modifying agent also does not always result in base pairing with the wrong complimentary base it can still pair with the base it is suppose to, but with less specificity, which may result in mispairing but not always. This is likely to only cause a mutation in one codon sequence, not the entire reading frame as with the intercalating agent. The key is a base pairing behavior or specificity change, not a random base addition which is more likely to cause a frameshift mutation.

Working in a diagnostic lab, you've been tasked with testing skin samples for Mycobacterium leprae (the bacteria that causes leprosy) in humans. What stain would you recommend to test the skin samples and how will it appear if the skin is infected with M. leprae?

Acid fast stain: hot pink

Infants receive booster immunizations to protect them from life-threatening infections. The immune response the baby produces is an example of...

Artificial active immunity

You are tasked with trying to create an antibiotic to treat a bacterium called Streptococcus socialdistanceus. You find a drug that inhibits NAG-NAM crosslinking, and you also find it can inhibit this bacterium from sporulating. Based on the fact that this drug inhibits NAG-NAM formation, what step in sporulation is most likely being inhibited by this drug? A. Formation of the core B. Formation of the cortex C. Formation of the spore coat D. Engulfment of the endospore by the plasma membrane E. Lysis of the sporangium

B. Formation of the cortex

SHORT ANSWER: Name two ways that bacteria can acquire antibiotic resistance and briefly explain each.

Bacteria acquire these genes through gene transfer or random mutations

You are a microbiologist. You isolate a bacterial strain in your lab that stains green and pink with an endospore stain. How many different kinds of carbohydrates and amino acids would you most likely expect to find in the cell wall of this strain? (first # = carbohydrates, second # =amino acids)

Carbohydrates = 2 Amino acids = 6

To determine if quorum sensing is happening in a bacterial population, which of the following would you try to isolate from the medium they are growing in?

Chemical communication molecules

If you want to block the ability of a pathogenic bacterium to invade deeper into host tissue, which molecule would you try to inhibit?

Collagenase

T/F: All bacteria within a given genus species are equally susceptible to antibiotics.

False

T/F: In a eukaryotic gene, exons are sequences that are removed by splicing.

False

The antibiotic triclosan, which is found in many soap products, inhibits the biosynthesis of fatty acids. As bacteria divide, what structure in both Gram-positive and Gram-negative cells would you expect to be most compromised upon exposure to this drug?

Cytoplasmic membrane

T/F: Subunit vaccines provide the best immunity because ideally they initiate an infection in the host that is asymptomatic and lasts long enough to elicit many different memory T and B cells.

False

T/F: The lower the therapeutic index of a drug the better because this means it will cause less toxicity in people, even at high concentrations.

False

In the laboratory, you pull a culture of Pseudomonas aeruginosa out of a low oxygen-containing tube and place it in a high oxygen-containing tube. Knowing that this particular organism is a facultative anaerobe, you would expect its doubling time to _______________ in the high oxygen-containing tube. Increase or Decrease

Decrease

SHORT ANSWER: Microbiologists often use differential stains to help characterize bacteria and place them in a genus and species. Please explain what is meant by the term differential stain.

Differential stains divide microbes into different categories depending on differences among structural characteristics present or not present in a microbial organism of a given genus and/or species which helps distinguish microbes from one another.

You isolate a bacterium that has a mutation in the genes for production of carboxysome granules. Thus bacterium most likely would be unable to?

Fix CO2

You isolate an antibiotic that has been shown to inhibit the glycosidic binding between NAG and NAM in peptidoglycan. What type of organism would you expect this antibiotic to be effective against?

Gram -negative & -positive bacteria

If you are Gram staining a mixed culture and forget to add decolorizer but do everything else correctly, what color would you expect Gram negative and Gram positive cells to be?

Gram negative = purple; Gram positive = purple

What isotype would you expect to find on the surface of a naïve B cell?

IgM

What does complement do?

Induces apoptosis: pops holes in microbial membranes

Please identify the circled part on the following antibody molecule:

Light Chain Variable Region

What vaccine type provides the best immunity because ideally it initiates an infection in the host that is asymptomatic and lasts long enough to elicit many different memory T and B cells.

Live, attenuated

SHORT ANSWER: You have been vaccinated against COVID, and 3 months later you are exposed to the virus, and test positive. You know that this time you will be going through a secondary immune response. Which of the steps in the primary response will not be required before you can start producing antibodies? Briefly explain what memory B cells and T-cells don't need.

Memory B-cells will not require activation to undergo clonal selection/expansion. They will be able to recognize the antigen/pathogen and clone plasma cells that will produce the specific antibodies required to fight the pathogenic agent. The immunologic memory is robust with a highly specific antibody response that results in the secondary immune response, making it more rapid and efficient in combatting infections.

Which of the following organisms would you predict can cause infection in the stomach?

Mesophilic, acidophilic

SHORT ANSWER: You are performing an Ames test to determine if a new diet soda has mutagenic potential. You set up the following pour plates each inoculated with the same amount of a His- auxotroph of Salmonella. All the plates have a trace amount of Histidine and were incubated overnight at 37 degrees Celsius. Note: The small circles on the plates represent single colonies. *Please answer each part by denoting A,B,C, etc. A. What is the mutation frequency of the diet soda? Could this be a mutagen? Show your work for full points and briefly explain. (3 points) B. How many bacterial colonies growing on Plate B are likely due to spontaneous mutations? Show your work for full points. (2 points) C. How many bacterial colonies growing on Plate B are likely due to induced mutations?

Mutation frequency = #CFU in test mutagen plate/#CFU in background plate; the background is the negative control, plate A, with nothing added. The positive control is Plate C with a known mutagen added. #CFU of induced mutations = #CFU in test mutagen plate - #CFU in background; the spontaneous mutations that occur are what is leftover, or the total #CFU in the test mutagen plate - #CFU induced. A. Yes, the diet soda can act as a mutagenic agent because the mutation frequency is greater than 1. Calculations: mutagen frequency = 12CFU in plate B/2CFU in plate A = 6 CFU > 1 = mutagenic agent. B. #CFU in plate B - #CFU in plate A = 12CFU - 2CFU = 10CFU induced. Then, #CFU in plate B - #CFU induced = 12CFU - 10CFU = 2CFU spontaneous. C. #CFU in plate B - #CFU in plate A = 12CFU - 2CFU = 10CFU induced.

Fungi normally live on the human scalp and provide protection against pathogens while using conditions in the scalp for their own survival. This is an example of which type of symbiotic relationship?

Mutualistic

You isolate a bacterium that produces exotoxin. If you correctly perform a Gram stain on this organism, what color would you expect to see under the microscope?

Pink or Purple

If you have a bacterium with a thick 90 nm peptidoglycan layer, what color will the bacterium appear if properly Gram stained? What kind of microscope will you use to observe the bacterium?

Purple; bright field light microscope

Mutating which of the following would lead to a loss of genetic exchange between bacteria within the same generation?

Sex pilus

What is the shape of this bacterium, what is the name of the structure this organism uses to swim, and what type of microscope was used to take this image?

Spirillum; flagellum; bright field

When correctly performing a chemoattractant assay, what does large, diffuse spread of a bacterial colony tell you?

The bacteria are moving outward toward more attractant

Dr. Pop's kitty has been acting ill. After seeing the vet, he is prescribed antibiotics for a bacterial infection. Dr. Pop gives the kitty antibiotics, but his symptoms become much worse just hours after taking them. Why might this have happened to the poor kitty, and what does this tell us about the bacterium making him ill?

The bacteria causing the infection are Gram-negative. When they were exposed to the antibiotics they were killed. However, the bacteria contained endotoxin, so when they died they released the toxin in mass amounts, leading to severe symptoms.

T/F: If you express antibody other than IgM specific for COVID-19, you can assume that you are infected, you have been infected in the past, or you have been vaccinated.

True

A patient presents with a chronic cough, a chest X-ray with calcified lesions in both lungs, and a positive skin test. A course of anti-fungal medication does not clear the infection. What do suspect your patient has?

Tuberculosis

You get a job at a pharmaceutical company. They ask you to develop an attenuated vaccine against Measles virus. What will you try to create?

Virus that has been altered to inactivate it, but not kill it.

Your roommate just brought home another stomach bug! This time you don't catch it. You deduce correctly that you have had this infection before. Which of the following is most likely NOT true of the immune response in you versus your roommate?

Your immune response produces more IgM than your roommate's which has more IgA

An organism that metabolizes via aerobic and anaerobic respiration, lipid and protein catabolism, and can also utilize fermentation is considered a... a. Chemoorganoheterotrophs b. Photolithoautotroph c. Chemolithoautotroph d. None of the above e. Photoorganoheterotroph

a. Chemoorganoheterotrophs

You want to develop a drug that selectively inhibits RNA polymerase in bacteria but won't bind to and inhibit eukaryotic RNA polymerase. Your drug must therefore target a sequence on the prokaryotic RNA polymerase that is _________________. a. highly variable b. highly conserved c. the level of conservation of the target sequence is not important

a. highly variable

A patient with shock arrives in the ER. You isolate the bacterium responsible for causing shock in this patient. How would you expect the bacterium to Gram stain? a. purple b. pink c. either pink or purple

a. purple = gram positive bacteria are the main causative agents of septic shock

The dark reaction of photosynthesis... a. reduces and fixes CO2 b. generates O2 c. reduces and fixes CO2 and converts light energy into chemical energy in the form of NADPH and ATP d. reduces CO2 and converts light energy into chemical energy in the form of NADPH and ATP e. converts light energy into chemical energy in the form of NADPH and ATP f. fixes CO2 g. reduces CO2

a. reduces and fixes CO2

Your neighbor recently took his niece and nephew to a petting zoo. This kids had a great time holding baby chicks and even some turtles. Several days later, both children showed signs of Salmonella infection. What type of infection did they have? a. zoonotic b. opportunistic c. nosocomial d. endemic

a. zoonotic

How many amino acids will be in this protein before post-translational modification? 5'AGUGUAGGACCGGCAUGGGGCUAAAAACAACUUAAGAAUGAAGGUA 3' a. 12 b. 6 c. 4 d. 5 e. 15

b. 6

You induce a base substitution point mutation in the -10 sequence (Pribnow Box) of a prokaryotic promoter such that RNA polymerase has higher affinity binding. What is most likely to occur? a. Decreased DNA replication b. Increased transcription of mRNA c. Decreased transcription of mRNA d. The transcription rate of mRNA would not be affected e. b, c or d

b. Increased transcription of mRNA

You find an enzyme that is regulated when an amino acid binds to the effector site. This binding causes the shape of the enzyme to change such that it binds to the substrate better. This is an example of a. Positive covalent modification b. Positive allosteric modification c. Feedback inhibition d. Negative covalent modification e. Negative allosteric regulation

b. Positive allosteric modification

Which bond connects complementary nucleotides on double-stranded DNA? a. peptide b. hydrogen c. carbon d. disulfide e. phosphodiester

b. hydrogen

According to these data, Toxin A is more likely

botulism toxin

The source of electrons in the light reaction of oxygenic photosynthesis is _________, and the source of electrons in the dark reaction of oxygenic photosynthesis is _________, a. sunlight; H2O b. NADPH; CO2 c. NADPH; H2O d. CO2; NADPH e. H2O; NADPH

e. H2O; NADPH

You isolate a bacterial protein that cost the cell 360 ATP/GTP to produce. How many amino acids would you expect to find in this protein? a. 12 b. 360 c. 120 d. 40

c. 120

You have isolated a cell that possesses the following: double-stranded DNA and a nuclear membrane composed of a phospholipid bilayer. From this information, into which domain of living organisms would you classify this cell? a. bacteria b. archaea c. eukarya d. bacteria or archaea e. archaea or eukarya f. all

c. eukarya

Which of the following is/are an organic molecule? a. proteins b. nucleic acids c. water d. a and b e. all of the above

d. a and b: -proteins -nucleic acids

You have discovered an extremely rare archaebacterium that causes disease in humans. Which of the following treatments would NOT be effective against this microbe? a. An antibiotic that targets the link between NAG and NAM in peptidoglycan b. An antibiotic that targets 80S ribosomes c. An antibiotic that targets 70S ribosomes d. a and b e. a, b and c

d. a and b: a. An antibiotic that targets the link between NAG and NAM in peptidoglycan. and b. An antibiotic that targets 80S ribosomes.

If free Fe3+ is the electron acceptor, which of the following could spontaneously be a donor? a. H2S b. NO2- c. H2O d. a and b

d. a and b: a. H2S b. NO2-

Which of the following bacterial virulence factors would be ineffective in causing disease in a mouse that lacks the ability to produce antibodies? a. IgA protease b. Collagenase c. Protein A d. a or c e. a, b, or c

d. a or c: a. IgA protease c. Protein A

You are studying an organism that uses Fe2+ as a food source but it can only grow with oxygen. What type of metabolism does this organism use? a. aerobic respiration or aerobic chemolithotropy b. anaerobic chemolithotropy c. aerobic respiration d. aerobic chemolithotropy e. anaerobic respiration f. fermentation

d. aerobic chemolithotropy

Bob, the bacterium, is placed in a high oxygen environment and has a doubling time of 2 hours. Then, Bob is placed in an environment with no oxygen and is found to have a doubling time of 2 hours. How would you classify Bob? a. obligate aerobe b. facultative anaerobe c. obligate anaerobe d. aerotolerant anaerobe e. cannot be determined

d. aerotolerant anaerobe

Which of the following would be an example of code degeneracy? a. AUU; ACU; AAU; AGU b. AGU; GGU; GUG; CGU c. CCU; AAU; GAU; UAU d. UUU; UCU; CAU; GUU e. CCU; CCC; CCA; CCG

e. CCU; CCC; CCA; CCG

In photosynthesis, CO₂ is a(n) ____________, where as in respiration, CO₂ is a(n) ____________ . a. electron acceptor; electron donor b. waste product; electron acceptor c. electron donor; electron acceptor d. electron acceptor; waste product

d. electron acceptor; waste product

Which of your body parts could be populated by your roommate's normal flora? a. pancreas b. eye, mouth, and pancreas c. eye d. eye and mouth c. mouth e. none

d. eye and mouth

Which of the following would have little to no normal flora? a. sinuses b. colon c. ear canal d. spleen

d. spleen

New DNA is always synthesized in which direction? a. 3' to 5' b. 3' to 5' on leading strand, 5' to 3' on lagging strand c. New DNA is synthesized in both directions. d. 5' to 3' on leading strand, 3' to 5' on lagging strand e. 5' to 3'

e. 5' to 3'

Which of the following is true of normal flora? a. They can be spread from one person to another. b. Some may overgrow and cause infections when other populations get disrupted. c. They can cause disease when they translocate to another place in the body. d. b and c e. a, b, and c

e. a, b, and c

If you want to visualize the nucleus of a eukaryotic cell, which of the following microscopes could you use? a. Phase-contrast b. Bright-field with stain c. Electron d. a and c e. Any of the above

e. any of the above: phase contrast, bright-field with stain, or electron microscopy

According to these graphed data, this drug could be targeting a. Lipoteichoic acid b. Lipopolysaccharide c. 70S d. a or c e. b or c

e. b or c -gram negative cells are dying not gram positive -only gram negatives have lipopolysaccharide -the drug could be binding on a variable sequence on the 70S that is specific to gram negatives

You isolate an organism with 50S and 30S ribosomal subunits. This organism could be: a. eukaryotic b. prokaryotic c. archaebacteria d. prokaryotic & archaebacteria e. all

e. eukaryote, prokaryotic & archaebacteria, and bacteria -70S ribosomes are in everything but with the same conserved sequences and maybe some variable sequences

You see a microbe that lacks mitochondria. What domain could this microbe be a part of? a. bacteria b. archaea c. eukarya d. bacteria or archaea e. archaea or eukarya f. all

f. all: archaea, bacteria and eukarya -eukarya because of transitional organisms such as protozoa

You got a job at a pharmaceutical company developing anti-toxins for various bacterial infections. Which type of cell will you isolate to maximize your yield of an anti-toxin against one specific toxin?

plasma cell

NO3- --> NO2- is a ____________ reaction.

reduction

You are studying a bacterium that is transmitted to humans by ticks. If the ticks pick up the bacterium from feeding on the white-footed mouse, the _________ is the vector and the _________ is the reservoir.

tick; mouse