Module 3
What is a transgenic organism?
An organism that has been permanently altered by the addition of a DNA sequence to its genome.
Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?
At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.
What is comparative genomics? How does its study contribute to our understanding of genetics?
Comparative genomics also provides a powerful tool for studying evolutionary changes among organisms, helping to identify genes that are conserved or common among species, as well as genes that give each organism its unique characteristics.
The_________________ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human
Human Genome Project
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.
Human Genome Project
Explain why the greatest diversity of human SNPs is found among African people.
Humans are thought to have first evolved in Africa. Therefore, these populations are the oldest and have had the greatest amount of time to accumulate polymorphisms. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendents is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.
Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.
Less
What is meant by the term low gene density? Give an example of an organism with low gene density.
Low gene density is common in eukaryotes in which there may be as few as one gene in 64 kb base pairs, as is the case with a segment of human chromosome 22
What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?
Selectable Marker (Selection)
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).
Microarray
Present a general definition for a multigene superfamily.
Multigene superfamilies share DNA sequence homology, and their gene products are functionally related. They are often (but not always) found together in a single location in a chromosome. They are believed to be derived from a common ancestral gene.
What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined.
Northern blots are used to detect/compare/study RNA in a sample. Steps: (1) RNA is extracted from tissue, cells etc. (2) Gel electrophoresis separates RNA molecules based on size (3) RNA is "blotted" (transferred) from the gel onto a membrane. (4) RNA is fixed to the membrane and hybridized with a probe (probe is labeled radioactively or with enzymes for chemiluminesence) (5) Visualization of RNA using X-ray film or phosphoimager screen. Microarray RNA levels can be determined and quantified by the darkness of the bands in the image.
A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons.
OH; 2'; 3'
In what way are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?
Oligonucleotide primers associate by hydrogen bonding to specific sections; primers are then extended
What is meant by the designation EcoRI? Do not simply state the type of macromolecule designated by EcoRI, but explain why it is so named.
One of the first restriction enzymes isolated from E.coli Eco then R1
Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ .
Orthologs
Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words?
Palindromic
In the polymerase chain reaction, what is the purpose of the initial high temperature? What is the purpose of cooling in the second step?
The purpose is to denature the target (template) DNA, annealing the primer to the target.
Describe the organization of the α-globin gene cluster in humans. Roughly how large is this cluster? How many genes are present? Briefly describe these genes.
The α-group spans more than 30 kb and contains three genes: zeta and two copies of the alpha gene. In addition, two nonfunctional pseudogenes are in the group. Most of the DNA in this region consists of intergenic spacer DNA.
A map of the distribution of cloned genomic DNA from genomic clone libraries.
Physical Map
A map of the order, overlap, and orientation of physically isolated pieces of the genome.
Physical Map
One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that
each vector can take up only a relatively small fraction of the eukaryotic DNA.
A BLAST search is done to
find similar gene or protein sequences.
Compared with prokaryotic chromosomes, eukaryotic chromosomes are
large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
When propagating a clone in the lambda phage, would you have more immediate success if the phage entered the lysogenic or the lytic cycle?
lytic cycle
Name and describe three different kinds of bacterial cloning vectors.
(1) plasmid: contain a multi-cloning site, origin of replication, and a selectable marker; can carry ~20-25Kb of foreign DNA (2) phage: a virus containing the DNA of interest infects bacteria; is more efficient than plasmid transformation and can carry ~25Kb of foreign DNA (3) cosmid: type of hybrid plasmid that contains plasmid sequences plus the COS sequences from phage for capsid packaging for phage transduction; cosmids form colonies, not plaques; can carry up to ~45Kb of foreign DNA (4) bacterial artificial chromosome or BA: a vector based on the bacterial F-plasmid (fertility plasmid), making its introduction in bacteria more stable than plasmids; typical foreign DNA insert size is in the hundreds of Kb
List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.
-Origin of replication: ensures that the vector is replicated within the cells -Selectable markers: enable all cells containing the vector to be identified -Restriction sites: needed so a DNA fragment can be inserted
What are three key differences between a genomic and a cDNA library?
-cDNA is enriched with fragments from actively transcribed genes -Introns do not interrupt the cloned sequences in cDNA -cDNA contains only sequences that are present in mature mRNA
A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment. Enter a number in the box below.
1
A typical prokaryotic genome has
1 million base pairs of DNA, containing 1000 genes.
Name the two strategic methods that scientists are using to sequence genomes.
1. Clone-by-clone 2. Shotgun cloning
Most of the bacterial genomes described in the text have fewer than
10,000
Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
300, 700, 1000, 1200
The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?
50% credit: There was likely a duplication of this gene in pigs. 25% credit: After duplication, the gene has diverged. 25% credit: Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product). 25% credit: Alternatively, humans may have lost one copy of this gene. However, this possibility should be ruled out by the fact that pigs seem to be unique in possessing two genomic copies.
You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment?
Accept anywhere from 28 to 30 cycles as a correct answer or the following equation 3 x (2^n) => than 1 billion)
Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common?
All are derived from a single ancestor
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?
An 8-kb fragment
Molecular biologists rely on many, often sophisticated, techniques to pursue their discipline. One may list ultracentrifugation, electron microscopy, X-ray diffraction, electrophoresis, and computer interfacing as fundamental. Model organisms provide the raw materials for study. List four "organisms" (or organismic groups) often used by molecular biologists and describe a major advantage of each group to the molecular biologist. We might consider these as "model organisms" of the molecular biologist.
Bacteriophage: relatively simple, short generation time. Bacteria: relatively simple, short generation time, simple growth requirements. Yeast: relatively simple for a eukaryote, short generation time, simple growth requirements. Drosophila: relatively simple to culture, extensive genetic and developmental information available, "giant" polytene (salivary gland) chromosomes.
For a physical map of a chromosome, distances are measured in units of
Base Pairs
Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA
CGATATATAT... The repetitive region in A would make it harder to determine even though it is shorter.
It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions?
DNA sequencing
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task?
Data about the inheritance of SNP markers in families with the disease
Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides?
Different fluorochromes attached to the four different ddNTPs.
Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.
Different regions of the chromosome will be more prone to recombination than others.
Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?
Each RE will cleave at a specific sequence. These sequences tend to be short (4-8 bp), and tend to be palindromic.
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR?
Each cycle includes a "hot" denaturation phase (95C), which separates the hydrogen bonds that hold the strands of the template DNA together.
As a model system, what are three of the advantages of the mouse as a model system?
Easy to grow • Short generation time • Produce abundant progeny • Readily mutagenized and crossed. Mice have similar body plans and stages of development as humans • Similar genome size and number of chromosomes to humans
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes. -or- Genes are more densely spaced in prokaryotes versus eukaryotes -or- prokaryotic genomes typically encode fewer genes than eukaryotic genomes
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates?
Eukaryotic: repetitive DNA
Present an overview of the gene organization in large-genome plants. What general level of gene density do plant genomes normally exhibit? What is the composition of the non-gene portions of the DNA?
Generally genome divided into 1. highly repetetive sequence (10%): It is non gene portion, contains 1. Tandem repeats:. 2.Dispersed repeats: 2. moderatly repetative sequence (20%) : Gene families 3. non repetative sequence(70%): Almost all structural genes.
Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?
Genes mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to other regions of the chromosome.
This is the study of "genes in their entirety."
Genomics
Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.
In a Southern blot, the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA.
All of the following are characteristics of the genomics revolution EXCEPT_____________
Inability to understand single genes
The first commercial production of what human enzyme led to the explosion of the biotechnology industry?
Inuslin
Which of the below are not steps in the production of genome sequence maps: Read the sequence of individual piece of the genome. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. Identify molecular markers on specific chromosomes. All of these are steps you would use.
Isolate whole chromosomes
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
Isolated from bacteria, restriction endonucleases restrict or prevent viral infection by degrading the invading nucleic acid of the virus
The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number?
It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.
What is the purpose of the LacZ gene in a plasmid cloning vector?
It is used as a selectable marker. The gene contains a series of unique restriction sites where a fragment of DNA can be inserted and cloned.
How are pseudogenes formed?
Point mutations, deletions, and duplications. renders the gene non functional
What is meant by the term pseudogene?
Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by
Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern?
Replica Plating
Assume that you have cut λ DNA with the restriction enzyme HindIII. You separate the fragments on an agarose gel and stain the DNA with ethidium bromide. You notice that the intensity of the stain is less in the bands that have migrated closer to the "+" pole. Give an explanation for this finding.
Since the smaller fragments migrate toward the "+" pole, away from the origin, they bind less stain than the larger fragments near the origin.
Some restriction enzymes cleave DNA in such a manner as to produce blunt ends. Most often ligation of blunt end fragments is enhanced by the use of the enzyme terminal deoxynucleotidyl transferase. Why?
Terminal deoxynucleotidyl transferase extends single-stranded ends by the addition of nucleotide tails. If complementary tails are added, the fragments can hybridize and the recombinant molecules can be ligated.
What is the function of dideoxynucleotides in Sanger DNA sequencing?
They stop synthesis at a specific site, so the base at that site can be determined.
Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?
Transcriptome has all RNA transcripts, coding and non coding. Proteome only has the proteins that result from those transcripts. Some genes encode non-coding RNAs that are not translated into proteins.
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
Transformation
Name 2 methods that are used to produce mutations in a forward genetics approach.
UV light, EMS, nitrosoguanidine
What is bioinformatics?
a method that uses very large national and international databases to access and work with sequence information
PCR is
a technique for amplifying DNA sequences in vitro
Plasmids are important in biotechnology because they are
a vehicle for the insertion of foreign genes into bacteria
Match each term with the best letter choice: a.chromosome spread b.protein c.plasmid d.centromere e.multiple hosts f.Taq polymerase g.DNA quantification h.protein/DNA interaction i.lacZ j.foreign DNA k.mRNA l.Agrobacterium tumefaciens
a. chromosome spread - in situ hybridization b. Protein - expression vector c. Plasmid - cloning vector d. Centromere - YAC (yeast artificial chromosome) e. multiple hosts - shuttle vector f. Taq polymerase - PCR g. DNA quantification - real-time PCR h. protein/DNA interaction i. lacZ - ß-galactosidase j. foreign DNA - Transgene k. mRNA - cDNA library l.Agrobacterium tumefaciens
In the context of molecular genetics, reverse translation refers to
assembling a DNA sequence from an amino acid sequence.
Compared with eukaryotic chromosomes, bacterial chromosomes are
small, with high gene density.
Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.
b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations.
A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that
bacteria cannot remove eukaryotic introns.
What is the purpose of a cDNA library?
cDNA libraries are used to express eukaryotic genes in prokaryotes. Prokaryotes do not have introns in their DNA and therefore do not possess any enzymes that can cut it out during transcription process. ... cDNA libraries are most useful in reverse genetics where the additional genomic information is of less use. A cDNA library is made using mRNA instead of DNA as the starting material. The mRNA can be extracted from cells of specific tissues from the organism of interest. The "c" in cDNA stands for copy because a double stranded DNA copy is made from a mRNA .
The Human Genome Project, which got under way in 1990, is an international effort to
construct a physical map of the 3.3 billion base pairs in the human genome.
A bacterial polycistronic transcription unit is one that
contains information for more than one protein product.
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________.
contig
Restriction endonucleases...
cut DNA at specific sequences.
List two especially useful characteristics of cloning vector
high copy number and antibiotic resistance gene(s)
Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally
hybridizes filter-bound DNA with a DNA probe.
What two factors contribute significantly to the wide ranges of genome size among eukaryotes?
introns and repetitive sequence
What is a cDNA molecule?
is DNA synthesized from a mature mRNA template in a reaction catalyzed by the enzyme reverse transcriptase and the enzyme DNA polymerase
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites?
multiple cloning site
In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called
operons
The set of all proteins encoded by the genome is called the _______ .
proteome.
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid?
restriction enzymes specific for the target genes and DNA ligase B and C
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA?
reverse transcriptase
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky?
single-stranded complementary tails
Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.
small size to allow large inserts high copy number large numbers of unique restriction sites (polylinkers) variety of selection schemes (pigmented colonies, antibiotic resistance)
What is the specific application of reverse transcriptase in the preparation of cDNA?
synthesis of DNA to form RNA-DNA duplex
What is a concise definition of proteomics?
the process of defining the complete set of proteins encoded by a genome
When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that
the two proteins share a common ancestry.
If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?
three
What is the enzymatic function of restriction enzymes?
to cleave nucleic acids at specific sites
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms.
visual examination, eliminate
