Module 3
The table below lists several genotypes associated with the lac operon in E. coli. For each, indicate with a "+" or a "-" whether β-galactosidase would be expected to be produced. (Note: you are analyzing whether or not you see functional β-galactosidase enzyme or not). Please label your answer No Lactose #1-4 and With Lactose #1-4. β-galactosidase production No Lactose With Lactose 1. I+O+Z+ /F' I-O+Z+ 2. I-O+Z+ /F' I-O+Z+ 3. I-OCZ+ /F' I-O+Z- 4. ISOCZ+ /F' I+O+Z+
1 - + 2 + + 3 + + 4 + +
Fill in the blanks in the "strain genotype" column of the following table. Write chromosomal genotypes with no partial diploidy. (+) means transcription of the lac operon. (-) means no transcription of the operon. The first line is filled in for reference. Please label your answers 1-3. Include the strain genotype for lacI, lacP, lacO, lacZ, and lacY Strain genotype Lactose absent Lactose present 1 - + 2 + + 3 - -
1 lacI+, lacP+, lacO+, lacZ+, and lacY+ 2 lacI, lacP, lacOc, lacZ, and lacY 3 lacI, lacP, lacO, lacZ-, and lacY; or lacP-, lac Z+; or both negative
Fill in the blanks in the "level of transcription" column of this table with: + for high levels of transcription, and - for minimal levels of transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy. Please label your answer with numbers 1-4 based on the chart below. Medium conditions: 1 high glucose, no lactose 2 no glucose, high lactose 3 high glucose, high lactose 4 no glucose, no lactose
1) - 2) + 3) - 4) -
Name two mutagens which would be classified as base analogues. a) ultraviolet light and cosmic radiation b) acridine orange and proflavin c) 5-bromouracil and 2-aminopurine d) hydroxyurea and peroxidase e) ethylmethane sulfonate and ethylmethylketone peroxide
5-bromouracil and 2-aminopurine
It is estimated that transposable elements compose approximately what percent of the human genome? 99 <1 1 50 10
50
What is a mutation? a) A change of amino acid b) A change in allele frequency c) A change in the phenotype d) A change in the DNA sequence
A change in the DNA sequence
The _________ can be used to quickly screen chemicals for their ability to be mutagenic (and hence potentially carcinogenic).
AMES test
In the absence of glucose and in the presence of galactose, several genes are activated to enable yeast utilize galactose. The key regulator(s) of the yeast GAL system is/are the _______ protein(s). Gal80 Gal4 Gal3 All of the above None of the above
All of the above
This structure forms when an extra X chromosome is methylated and largely inactivated. It is most commonly found in females.
Barr body
The _________________, which binds to a core promoter, consists of general transcription factors and RNA polymerase.
Basal transcription apparatus
List at least two different types of DNA repair and briefly explain how each is carried out.
Base excision repair- removes abnormal bases and replaces the entire nucleotide Nucleotide excision repair- removes bulky DNA lesions that distort the double helix DNA mismatch repair- correct errors made by DNA polymerase during DNA replication. Such errors fall into two broad categories: base substitutions and insertions/deletions. Direct- repairs pyrimadine dimers, specific alterations, does not replace the altered nucleotides, only changes them back to original form
Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA. How do amino acids in DNA-binding proteins interact with DNA? a) By forming covalent bonds with DNA bases b) By forming hydrogen bonds with DNA bases c) By forming covalent bonds with DNA sugars d) None of the above. e) a) and c)
By forming hydrogen bonds with DNA bases
This process moves a nucleosome from the TATA box of a gene's promoter so that transcription can occur.
Chromatin remodeling
Over the past decade, the most significant finding in biology has been the identification of miRNAs and siRNAs and their role in regulating the development of many multicellular organisms. Briefly describe the four different ways these small RNAs influence gene expression.
Cleavage of mRNA- mRNA is cleaved in the middle of the siRNA, then mRNA degrades Inhibition of translation- base pairs to mRNA inhibiting translation (complementary) Transcriptional silencing- alter the chromatin structure, for RITS, causes methylation of histones binding DNA more tightly
The region of a protein that is capable of holding on to a particular nucleotide sequence in order to affect proper gene regulation.
DNA binding domain
When regions around genes become sensitive to the enzyme ______________ this is an indication that those regions are becoming ______________ active.
DNAse I (cleaves phosphodiester bond to open DNA for transcription), transcriptionally
Why do insertions and deletions often have more drastic phenotypic effects than base substitutions do?
Deletions cause recessive genes on the homologous chromosome to be expressed and cause imbalances in gene products. Inversions cause breaks in some genes and may move others, results in depression in recombination frequencies Insertions and deletions lead to a change in the reading frame of the gene Base substitutions have alteration in one pair of nucleotides (transversion, transition)
The process by which excessive numbers of a sex chromosome are corrected, often by methylating the X chromosome to form a Barr body.
Dosage compensation
List the different types of chromosome mutations and define each one.
Duplication- part of chromosome doubled Deletion- loss of a chromosome segment Inversion- chromosome segment is turn 180 degrees Translocation- movement of genetic material between nonhomologous chromosomes or w/in the same chromosome Aneupoloidy: loss or gain of one or more chromosomes so that the chromosome number deviates from 2n or the normal euploid complement. Polyploidy: Gain of entire sets of chromosomes so the chromosome number changes from 2n to 3n (triploid), 4n (tetraploid), and so on.
Parts of chromosomes that are not methylated for inactivation, but rather are less dense-staining and are likely active in transcription in the cell.
Euchromatin
Recent discoveries on causes of fragile-X syndrome, myotonic dystrophy, and Huntington disease indicate what type of genetic alteration?
Expanding trinucleotide repeats
__________ mutations produce new traits and are usually dominant. Induced Spontaneous Forward Lethal Gain-of-function
Gain-of-function
What role does RNA stability play in gene regulation? What controls RNA stability in eukaryotic cells?
Gene expression can be regulated through changes in RNA stability. The 5' cap, coding sequence, 3' UTR, poly A tail are all imporant in controlling the stability of mRNAs. Proteins binding to the 5' and 3' ends of eukaryotic mRNA can affect its translation.
Name six different levels at which gene expression might be controlled.
Gene structure, Transcription, mRNA processing, RNA stability, Translation, Posttranslational modification
A highly-methylated region of a chromosome that has become largely deactivated and can be seen as dense-regions when viewed using electron microscopy.
Heterochromatin
Regions of chromosomes that are inactivated through methylation are termed this.
Heterochromatin
The ____________________ consists of modifications to histone proteins that affect the expression of DNA sequences.
Histone codes
What are three ways in which gene regulation is accomplished by modifying the structure of chromatin?
Histone modification, Chromatin remodeling complexes, DNA methylation
Question 11 (2 points) Question 11 Unsaved (I = lac repressor gene; Z, Y, A = lac operon structural genes; P = lac promoter; O = lac operator) Reference: Ref 16-2 (*picture*) Which parts of the DNA region shown in the diagram encode proteins? I, Z, Y, A P, O, Z, Y, A I, P, O, Z, Y, A P
I, Z, Y, A
Riboswitches were first discovered in 2002 and have been found in... a) plants b) In none of the listed organisms c) bacteria d) fungi e) In all of the listed organisms f) archaea
In all of the listed organisms
Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells? A) In eukaryotic cells, the 5' end of mRNA is modified with a cap, while in prokaryotic cells there is no cap. B) In eukaryotic cells, mRNA is spliced before translation, while in prokaryotic cells there is no mRNA splicing. C) In eukaryotic cells, the 3' end of mRNA is modified with a tail, while in porkaryotic cells there is no tail. D) In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.
In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled
Explain two different ways that intragenic suppressors may reverse the effects of mutations.
Intragenic suppression is the result of second mutations within a gene that restore a wild-type phenotype. The suppressor mutations are located at different sites within the gene from the original mutation. One type of suppressor mutation restores the original phenotype by reverting the meaning of a previously mutated codon to that of the original codon. The suppressor mutation occurs at a different position than the first mutation, which is still present within the codon. Intragenic suppression may also occur at two different locations within the same protein. If two regions of a protein interact, a mutation in one of these regions could disrupt that interaction. The suppressor mutation in the other region would restore the interaction. Finally, a frameshift mutation due to an insertion or deletion could be suppressed by a second insertion or deletion that restores the proper reading frame. AN INTRAGENIC SUPRESSOR MUTATION MAY CHANGE A SECOND NUCLEOTIDE IN THE SAME CODON ALTERED BY THE ORIGINAL MUTATION OR MAY WORK BY SUPPRESSING AN ORIGINAL FRAMESHIFT MUTATION (EX. IF ORIGINAL MUTATION IS A ONE-BASE DELETION, THEN THE ADDITION OF A SINGLE BASE ELSEWHERE IN THE GENE WILL RESTORE THE FORMER READING FRAME (from KS)
What is the function of cAMP in regulation of the lac operon? It inactivates an activator protein. It activates an activator protein. It inactivates a repressor protein. It activates a repressor protein.
It activates an activator protein
A mutation in the gene for the yeast regulatory protein GAL4 causes yeast to grow poorly on galactose. What is the function of GAL4? It is a transcription repressor that prevents expression of yeast galactose-digesting enzymes. It is a substrate that binds and activates a transcriptional activator. It is a transcription activator for the galactose-digesting enzyme gene. It is an enzyme that metabolizes galactose. It is a product that binds and activates a transcriptional repressor.
It is a transcription activator for the galactose-digesting enzyme gene.
The molecular nature of transposable elements was first understood in E. coli due to the simplicity of the E. coli genome. Which of the following types of DNA contribute significantly to the genome complexity of other organisms? SINES LTR retrotransposons Genes IS elements LINES
LINES, SINES, LTR retrotransposons
A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells? lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ lacI- lacP+ lacO+ lacZ- lacY+ lacA+
NOT lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ (question shows up with different phrases)
E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on? f-galactosidase Lac I Lac P Permease None of the above
None of the above
_____________ are complexes where, among other activities, a great deal of RNA degradation takes place.
P bodies
Degradation of a eukaryotic mRNA is generally preceded by shortening of the _____________.
Poly A tail
The ____________________ stabilizes the 5' cap, which must be removed before the mRNA molecule can be degraded from the 5' end.
Poly A tail
What is the difference between positive and negative control? What is the difference between inducible and repressible operons?
Positive control stimulates transcription, the protein is an activator Negative control inhibits transcription, the protein is a repressor Inducible- system is normally off, something must activate it to begin Repressible- transcription is usually on, something must take place to turn it off
The process of error correction of mismatched bases carried out by DNA polymerases is called
Proof reading
_______________ is also known as RNA silencing and posttranscriptional gene silencing.
RNA interference
Which of the following is TRUE for both prokaryotic and eukaryotic gene expression? A) After transcription, a 3' poly-A tail and a 5' cap are added to mRNA. B) The mRNA is the exact complement of the gene from which it was copied. C) RNA polymerase binds to the promoter region to begin transcription. D) mRNA is synthesized in the 3' → 5' direction.
RNA polymerase binds to the promoter region to begin transcription
The general term for a protein that binds to an operator and prevents transcription.
Repressor
The __________ is a type of _________ protein that binds to a region of DNA in the promoter of a gene called the _________ and prevents transcription from taking place.
Repressor, regulatory, operator, transcrition
The diagram below shows a chromosomal inversion around a gene. The arrows show how the gene will become physically turned around after mutation. Assuming there is a distinct mutant phenotype, describe in detail the type of mutation, including whether it should be dominant or recessive. Would this phenotype have the same effect in a haploid creature as opposed to a diploid one? (picture includes promoter, enhance, silencer and coding region)
The diagram shows that the promoter for a gene will be moved from a region that enhances transcription toward one that acts as a silencer. This would likely be a loss-of-function mutation for that allele. In a diploid organism this may be recessive, providing the wild-type gene provides enough information. In a haploid organism, the dominant-recessive relationship is essentially meaningless except in the zygote. Students may be aware of examples of enhancers and silencers that occur after the gene, and this should be considered as a correct answer if identified.
Why do extra copies of genes sometimes cause drastic phenotypic effects?
The expression of some genes is balanced with the expression of other genes; the ratios of their gene products, usually proteins, must be maintained within a narrow range for proper cell function. Extra copies of one of these genes cause that gene to be expressed at proportionately higher levels, thereby upsetting the balance of gene products.
Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.
The lacI gene mutation is trans because it effects the operators on BOTH sides of the DNA strand, the superrepressor bind to BOTH operators and prevents transciption on both sides The lacO gene is cis because this mutation only effects genes that it is connected to, so they only affect one side of the DNA strand
Which of the below is not true about the location of enhancers? They can be found upstream of the transcription initiation site. They can be found in introns. The position of the enhancer has no effect on gene regulation. They can be found downstream of the promoter. They can be found 3' of the polyadenylation site.
The position of the enhancer has no effect on gene regulation.
(I = lac repressor gene; Z, Y, A = lac operon structural genes; P = lac promoter; O = lac operator) Reference: Ref 16-2 (*picture*) Where would the lac repressor be bound in a (nonmutant) E. coli cell that is growing in low glucose and high lactose? O I, P, O P and O The repressor would not be bound. P
The repressor would not be bound
(I = lac repressor gene; Z, Y, A = lac operon structural genes; P = lac promoter; O = lac operator) Reference: Ref 16-2 (*picture*) In the above diagram, if there is a mutation in P and I, which of the following is true? These will affect the expression of I only. These are mutations that are, respectively, trans and cis acting on lac operon expression. These will affect the expression of only Z, Y, and A. These are mutations that are, respectively, cis and trans acting on lac operon expression.
These are mutations that are, respectively, cis and trans acting on lac operon expression.
These are factors that need not be adjacent to the genes they control. An example would be the lac operon's repressor protein.
Trans-acting
____________________act as intermediaries between ______________________________ and specific _____ sequences to modify chromatin structure and activate transcription.
Transcriptional activators, Chromatin remodeling complexes, DNA
One type of mutation involves the replacement of a pyrimidine with a purine. What general term is associated with this mutational phenomenon?
Transversion
What human condition is caused by the inability to repair UV-induced DNA lesions?
Xeroderma pigmentosum
What modification neutralizes the charges on histones that promote ionic interaction with DNA? phosphorylation acetylation polyadenylation demethylation
acetylation
DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to: addition of methyl groups to the cytosine of CG doublets altering RNA polymerase activity by methylation altering translational activity especially of highly methylated tRNAs changes in DNA-DNA hydrogen binding alteration of DNA polymerase activity by addition of methyl groups to glycine residues
addition of methyl groups to the cytosine of CG doublets
After translation, eukaryotic proteins can be modified by acetylation. the addition of phosphate groups. the removal of amino acids. the addition of methyl groups. all of the above.
all of the above
In what part of the mRNA does degradation generally begin? Removal from either end is equally likely. at the 3' end with the removal of the poly(A) tail at the 5' end with the removal of the methyl cap at the 3' end with the removal of the methyl cap at the 5' end with the removal of the poly(A) tail
at the 5' end with the removal of the methyl cap
The lac repressor protein controls expression of the lac operon via ________________. binding to the lac structural genes to repress expression binding of the lac Z and lac Y genes only binding to the lac promoter site to repress expression binding to the lac operator site to repress expression all of the above
binding to the lac operator site to repress expression
The lac repressor protein controls expression of the lac operon via ________________. binding to the lac structural genes to repress expression binding of the lac Z and lac Y genes only binding to the lac promoter site to repress expression binding to the lac operator site to repress expression all of the above
binding to the lac promoter site to repress expression
A promoter that affects only genes that are on the same piece of DNA is ____________-acting.
cis
Which of the following clusters of terms applies when addressing enhancers as elements associated with eukaryotic genetic regulation? cis-acting, fixed position, fixed orientation cis-acting, vairable position, fixed orientation trans- and cis-acting, variable position trans-acting, fixed position, fixed orientation cis-acting, variable orientation, variable position
cis-acting, variable orientation, variable position
A condition in which a gene or group of genes is expressed all the time.
constitutive
Mutations in the lacI and lacO genes in the lactose system often lead to full production of the three structural genes related to the lac operon even with no lactose available to the organism. Such mutations would be called________.
constitutive mutations
Mutations in the promoter region of the b-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box) transcription ________________.
decreases
LINES differ from retrotransposons in that LINES: do not contain the transposase gene. do not encode transposase. do not encode reverse transcriptase. do not contain LTRs. do not transpose in a replicative manner.
do not contain LTRs
A eukaryotic DNA sequence that affects transcription at distant promoters is called a(n) ________________.
enhancer
Regulation of gene expression using siRNAs is found in prokaryotes and eukaryotes. prokaryotes only. eukaryotes only.
eukaryotes only
A class of mutations which results in multiple contiguous amino acid changes in proteins is likely to be the following a) transition b) transversion c) base analogue d) frameshift e) recombinant
frameshift
When siRNAs or miRNAs are present, the rate of mRNA degradation_____________ , and the rate of protein production ___________.
increase, decrease
What is the function of allolactose in regulation of the lac operon? repressor regulatory protein inducer promoter activator
inducer
Transposable elements are also known as: Jumping genes Jumping repeats Moving genes Mobile genetic elements Transformers
jumping genes, mobile genetic elements
A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells? lacl+ lacP+ lacO+ lacZ+ lacY+ lacA+ lacI+ lacP+ lacO+ lacZ+ lacY- lacA+ lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ lacI+ lacP+ lacOc lacZ+ lacY+ lacA+
lacI+ lacP- lacO+ lacZ+ lacY+ lacA+
The lac repressor binds to: promoter and lactose. d-galactosidase, permease and transacetylase. lactose and DNA. RNA polymerase. RNA polymerase and DNA.
lactose and DNA
An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule. positive repressible negative inducible positive inducible negative repressible
negative inducible
An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule: negative repressible positive repressible positive inducible negative inducible
negative repressible
A _________ mutation changes a codon that specifies an amino acid into one that terminates translation. neutral reverse missense nonsense silent
nonsense
Indicate the level of activity of the lac operon under the medium conditions listed below: a) No lactose present, no glucose present b) Lactose present, no glucose present c) No lactose present, glucose present d) Lactose present, glucose present For a-d, enter either "high" or "off", separated by commas.
off, on, off, off
A catabolite-activating protein (CAP) exerts _____________control over the lac operon.
positive
Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? a) constitutive b) inducible system c) positive control d) negative control e) repressible system
positive control
Choose the type of control illustrated by GAL4 in the control of genes for yeast galactose-metabolizing enzymes. negative inducible positive repressible positive inducible negative repressible
positive inducible
Choose the type of control illustrated by each example. Reference: Ref 16-1 E. coli lac operon control by lac I negative inducible positive inducible negative repressible positive repressible
positive inducible
Frameshift mutations are caused by the __________ or __________ of one or more nucleotides in DNA. a. chemical modification b. removal c. reversion d. insertion e. suppression
removal, insertion
An example of a gene product encoded by a regulatory gene is repressor protein. beta-galactosidase enzyme. operator. allolactose.
repressor protein
mRNAs are degraded by enzymes called ____________.
ribonuclease
Mutations which arise in nature, from no particular artificial agent are called cosmic mutations induced mutations spontaneous mutations chromosomal aberrations natural mutations
spontaneous mutations
Match each number with the closest type of DNA: a. moderately repetitive DNA b. highly repetitive DNA c. short interspersed elements d. long interspersed elements e. unique-sequence DNA Reference: Ref 11-1 *telomeres and gene-encoding*
telomeres - highly repetitive DNA gene-encoding - unique-sequence DNA
siRNAs and miRNAs are produced by: the cleavage of pre-mRNA in the nucleus. the cutting and processing of double-stranded RNA by Slicer enzymes. the cleavage of RISCs by endonucleases. the cleavage of functional mRNA within the cytoplasm. the cutting and processing of double-stranded RNA by Dicer enzymes.
the cutting and processing of double-stranded RNA by Dicer enzymes
Alternative splicing is known to be important in the regulation of: the mammalian SV40 virus. the lac operon in E. coli. the production of heat-shock elements. the metallothionein gene.
the mammalian SV40 virus
It is possible for a repressor to negatively regulate the expression of an operon because the repressor binding site on the DNA overlaps with the translation start site. one of the genes expressed in the operon negatively regulates the repressor. the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase. the repressor induces the expression of inducer.
the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase.
Which of the following two molecules of DNA has the lower melting temperature? Why? _ AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT_
the top one, A-T bonds are only made of 2 Hydrogen bonds compared to C-G bonds which are made of 3 Hydrogen bonds
Insulators can block the effects of enhancers only when they lie adjacent to a promoter. they lie between an enhancer and a promoter. they lie within a consensus sequence. they lie upstream of a promoter. they lie within the structural genes.
they lie between an enhancer and a promoter
Nutritional mutations can be defined as: a) those mutations which change the composition of the medium. b) those mutations caused by site-specific mutagenesis c) those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium. d) all strains which are not auxotrophic. e) those mutations which change the composition of the medium.
those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.
When referring to attenuation in regulation of the tryptophan operon it would be safe to say that when there are high levels of tryptophan available to the organism: ribosomes are stalling during translation of the attenuator region. the tryptophan operon is being transcribed at relatively high levels. transcriptional termination is likely. tryptophan is inactivating the repressor protein. translational termination is likely.
transcriptional termination is likely
Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called error prone and spontaneous. euchromatic and heterochromatic. base analogues and frameshift transversions and transitions sense and antisense.
transversions and transitions
The following may be caused by mobile genetic elements except ________________. activate a gene in which they reside cause chromosome breaks disrupt a gene undergo mutation all of the above
undergo mutation
Ultraviolet light causes pyrimidine dimers to form in DNA. Some individuals are genetically incapable of repairing some dimers at "normal" rates. Such individuals are likely to suffer from: phenylketonuria xeroderma pigmentosum Huntington disease SCID muscular dystrophy
xeroderma pigmentosum
