Mol Gen Mod 4

Ace your homework & exams now with Quizwiz!

c

A BLAST search is done to 2-26 find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find similar gene or protein sequences. find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed.

Primer walking

A PCR technique that fills in small gaps by using the end of a cloned sequence as a primer to amplify into adjacent uncloned fragments. 3-7

multigene

A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene. 3-8

c

A fragment of DNA is cloned into a plasmid with a sequencing primer binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 2-17 5' TGCTAGC 3' 5' CGATCGT 3' 5' GCTAGCA 3' 5' ACGATCG 3'

Reporter gene

A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP). 2-8

d

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? 1-33 An EST database of the human genome Microarray data of tissues in which the gene is expressed Information about bacterial orthologs of the gene Data about the inheritance of SNP markers in families with the disease Whole-genome-shotgun clones of the human genome

1

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment.

Physical map

A map of the distribution of cloned genomic DNA from genomic clone libraries. 3-10

Physical map

A map of the order, overlap and orientation of physically isolated pieces of the genome. 3-5

d

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that 1-27 bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA bacterial RNA polymerase cannot make RNA complementary to mammalian DNA prokaryotes use a different genetic code from that of eukaryotes bacteria cannot remove eukaryotic introns.

e

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? 1-35 A 10-kb, an 8-kb, and a 2-kb fragment A 10-kb and a 2-kb fragment A 12-kb fragment An 8-kb and a 2-kb fragment An 8-kb fragment

d

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. 2-21 clone chromosome sequence contig map

d

A typical prokaryotic genome has 2-20 1000 base pairs of DNA, containing a few thousand genes. 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few hundred genes. 1 million base pairs of DNA, containing 1000 genes.

e

All of the following are characteristics of the genomics revolution EXCEPT_____________ 2-23 Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Ability to conduct discovery-based research Large scale acquisition of DNA sequences Inability to understand single genes

a transgenic organism

An organism that stably carries a foreign gene within is genome

microarray

Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression). 1-4

a

Before sequencing, the DNA fragment was cloned into a plasmid. On the strand that acted as the template in the sequencing reaction, what base of the cloned fragment was closest to the primer? 1-29 g a c t

c

Cloning Vector a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

centromeric, greater

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map? Gene mapped based on recombination will appear to be very close together in ____________ regions due to low rates of recombination. Distances between the same genes on the physical map may be much ________ when compared to their regions of the chromosomes

c,e

During gel electrophoresis, __ will migrate more rapidly than __. 2-10 a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments

d

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by 1-34 Identifying the molecular weights of the fragments in question Measuring the sizes of the bands on the gel None of the above Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Knowing the isoelectric points of the piece in question.

b, c

Expression Vector a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

base pairs

For a physical map of a chromosome, distances are measured in units of 1-16 base pairs contigs percent recombination centimorgans RFLPs

three

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? 1-32 five two three four six

a

In situ hybridization a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

b,c,d,f

In the previous list of cloned fragments, the fragments needed to make the longest possible contig, with the least amount of overlap, are . 1-9 Cloned fragment Markers present A M4 M5 B M1 M2 M3 C M6 M7 M8 D M3 M4 M5 M6 E M3 M4 M5 F M8 M9 M10

Phage, Cosmid, bacterial artificial chromosome or BAC, plasmid,

List at least three different kinds of bacterial cloning vectors. 2-2Plasmid

Cell free cloning, Identification of restriction enzyme variants, Screening for genetic disorders Diagnostic screening for infectious organisms, Forensics, paleobiology,

List four uses of PCR 10-3

Origin of replication for propagation in the host , Selectable marker like Amp resistance, Polylinker or unique restriction enzyme sites to facilitate cloning

List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each. 1-2

c

List two especially useful characteristics of cloning vectors. 2-24 ability to integrate into the host chromosome and then cause a lytic cycle nonautonomous replication and transposition high copy number and antibiotic resistance gene(s) reverse transcriptase and ligase activities virulence and lysogenicity

3,2,4,1

Match Each paralog, otholog, synteny, homolog 1closely related gene based on sequence and function 2 homologous gene of the same locus inherited from a common ancestor 3. gene related by gene duplication in the genome 4.conservation of the same group of genes in the chromosomes of 2 or more species

i

Match each term with the best letter choice: ß-galactosidase a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

a

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally 1-28 hybridizes filter-bound DNA with a DNA probe hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. cleaves RNA with restriction endonucleases ligates DNA with DNA ligase.

a, it's more repetitive

Of the DNA sequences below, which would probably be the harder to determine? 1-26 CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

Immunoglobin gene subunit diversity ,Differential splicing to create diversity ,Break and nibble mechanism to increase diversity

One of the dominant features of the immune system is the capacity to generate new cells that contain different combinations of antibodies. Because there are billions of such combinations it is impossible that each combination is coded by a separate gene. Explain in as much detail as you can how such diversity is accomplished in the case of the light chain of a typical antibody.

d

One of the primary reasons for the necessity of generating a large number of clones in a eukaryotic genomic library is that 2-16 each ligation product is sequence specific. the host range of the vector is limited each cosmid replicates nonautomously. each vector can take up only a relatively small fraction of the eukaryotic DNA. lysogenic phage continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones.

d

PCR one of the control elements of the cell cycle None of the above necessary for efficient replication of cell's DNA in interphase a technique for amplifying DNA sequences in vitro

d

Plasmids are important in biotechnology because they are 2-25 recognition sites on recombinant DNA strands surfaces for respiratory processes in bacteria surfaces for protein synthesis in eukaryotic recombinants a vehicle for the insertion of foreign genes into bacteria

2,4,1,3

Rank from "roughest" → "fine detail" the amount of resolution allowed by the following methods of mapping: 1-7 Cytogenetic map Sequence map Linkage map Restriction map

d

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? 1-22 blunt ends poly-A sequences 5' cap single stranded complementary tails interference

c,e

Shuttle Vector a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

e

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? 1-25 palindrome β-galactosidase consensus sequence complementation polylinker

a

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. 1-31 visual examination, eliminate temperature extremes, enhance epistasis analysis, enhance complementation analysis, enhance chemical removal, activate

There was likely a duplication of this gene in pigs, Also duplication the gene was diverged, Or humans lost one copy of the genes

The full-length (i.e., containing the entire protein coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. How would you explain the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? 8-3

11,718,750,6,000,000,30,000

The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave? 9-2 4: 6: 8:

You could generate cDNA libraries and compare the transcribed regions of the genome

The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans? 3-3

b

The set of all proteins encoded by the genome is called the _______ . 1-21 pharmacogenome proteome glycome genome metabolome transcriptome

Minimum tiling path

The smallest number of clones that represents the entirety of the genome are called what? 2-13

Transcriptome, Proteome, 3

The transcriptome of a genome contains more components than the proteome. Explain why this is true. _______________: all the RNA molecules transcribed from a genome __________: all the proteins encoded by the genome It takes _ RNA codons to code for one protein, so it is natural to have more transcriptome (RNA molecules) than proteome (proteins).

a

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? 1-17 Eukaryotic: repetitive DNA Eukaryotic: circular DNA Prokaryotic: presence of plasmids Eukaryotic: ESTs Prokaryotic: repetitive DNA

genomics

This is the study of "genes in their entirety."

Genome project

This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.

orthologs

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ .

UV light, EMS, Nitrosoguandandine, transposons

What Method are used to produce mutations in a forward genetics approach?

mRNA, RNA

What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined: (Know step by step) detection and quantitation of _____ levels ____ isolation (total or poly(A) RNA) Probe generation Denaturing agarose gel electrophoresis Transfer to solid support and immobilization Prehybridization and hybridization with probe Washing Detection Stripping and reprobing (optional)

cDNA library, genomic, CDNA, cDNA, mRNA

What are three key differences between a genomic and a cDNA library? 4-2 ________. Represent only transcribed regions of the genome All genes equally represented in _______ library while ________ library reflects the level of expression of a gene in a particular cell type or tissue ________ library contained only sequences found in the mature ______- introns are removed

c

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? 1-19 All produce lipid as a product. All produce RNA as a product. All produce DNA chains as a product. All produce RNA as a product.

b

What is bioinformatics? 1-30 a technique using 3D images of genes in order to predict how and when they will be expressed a method that uses very large national and international databases to access and work with sequence information a series of search programs that allow a student to identify who in the world is trying to sequence a given species a software program available from NIH to design genes

a

What is the enzymatic function of restriction enzymes? 2-22 to cleave nucleic acids at specific sites to add new nucleotides to the growing strand of DNA to join nucleotides during transcription. to repair breaks in sugar-phosphate backbones

a

What is the function of dideoxynucleotides in Sanger DNA sequencing? 1-20 They stop synthesis at a specific site, so the base at that site can be determined. They cut the sequenced DNA at specific sites. They allow only the specific sequencing of the RNAs of a genome. They act as primers for reverse transcriptase. They act as primers for DNA polymerase.

To determine if the vector is present in host cell

What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?

To be able to distinguish those colonies with an insert using blue/white selection white have an insert

What is the purpose of the LacZ gene in a plasmid cloning vector?

b

Which of the below are not steps in the production of genome sequence maps: 2-18 Identify molecular markers on specific chromosomes. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. All of these are steps you would use. Read the sequence of individual piece of the genome.

d

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? 1-23 DNA polymerase restriction enzymes specific for the target genes DNA ligase Both B and C

e

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? 1- DNAse gene cloning isolation of stem cells from a lamb embryo and production of a zygotic equivalent hydrogen sulfide reverse transcriptase

a

Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome? 1-18 See if a SNP database contains sequences in the region. Scan the region for intron splice sites. Scan the region for ORFs. Scan the region for promoter sequences. See if an EST database contains sequences in the region.

They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.

Why are telomeres and centromeres particularly difficult to sequence? 9-3

b, c

Write the letter all of the following statements that are NOT true. 1-6 Coding sequences for gene products can be isolated from cDNA libraries. Antibodies are used for Northern blot analysis. VNTRs are highly conserved in human populations. PCR amplification generates large numbers of linear DNA fragments. RNA molecules can be used as hybridization probes in Southern blot analysis.

D

YAC a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

b

You are doing an experiment to characterize a 3000bp clone using two different restriction enzymes. Enzyme 1 (E1) produces 2 fragments in a single digest of 1400 and 1600bp. Enzyme 2 (E2) also produces 2 fragments of 1400 and 1600bp. When a double digest using both of these enzymes is done, it results in 2 fragments of 1400bp and 200bp. Based on this data, choose the correct restriction map from the choices given below. 1400bp/E1&E2 1600 bp 1400bp/e1/200bp/e2/1400bp 1000bp/e1/800bp/e2/1200bp 1400bp/e1/1400bp/e2/200bp

28 (29 or 30)

You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment? 5-2

The RE must have complementary sticky ends so that they will anneal together

You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful? 1-14

k

cDNA library a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

f

pcr a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

g

real-time PCR a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens

k

transgene a)chromosome spread b)protein c)plasmid d)centromere e)multiple hosts f)Taq polymerase g)DNA quantification h)protein/DNA interaction I)lacZ j)foreign DNA k)mRNA l)Agrobacterium tumefaciens


Related study sets

BUSN Chapter 20 Creditors Rights & Bankruptcy

View Set

Sociology Final : multiple choice

View Set

Chapter 1: Sociology of the Family

View Set

ISM4011-Lesson 01- Business Driven Technology

View Set

Sensory, Short-term & Working Memory

View Set