Molecular Biology (Questions)

Which of the following statements about RNA splicing is TRUE? (a) it removes the introns (b) it is performed by the spliceosome (c) it shortens the RNA molecule (d) it always occurs in the nucleus (e) all of the above is true (f) a and b only

(f) a and b only - introns are "junk" sequences that have to be removed in order for the mRNA to encode a protein with the right sequence - a spliceosome is a protein-RNA complex that recognizes and removes introns and pastes the exons together.

TRUE OR FALSE: Under negative control (for example, the lac operon genes), the expression of the gene is repressed as long as lactose levels are high.

False - this would be positive control

Match each protein with its function: TFIIH

Has kinase activity for phosphorylation of the RNA polymerase to begin elongation

Match each protein or molecule with its function DnaB protein

Helicase that begins unwinding the double helix

What is the composition of a nucleosome?

Histone protein and DNA - made up of a coil of DNA wound around a histone core.

If DNA replication was conservated, predict what Meselson and Stahl would have observed over 2 rounds of replication.

If DNA replication was conservated, after 2 rounds of replication, the DNA in the gel would be in the same position, regardless of generation.

How does an organism control where transcription begins?

In bacteria, the sigma factor recognized the core promotor so the polymerase can know where to start. In eukaryotes, polymerase uses transcription factors to recognize the promotor region and recruit RNA polymerase.

What is the function of TFIIH? What gets phosphorylated?

It phosphorylates the CTD of RNA polymerase and unwinds DNA at the transcription start site to create the "transcription bubble" - cannot start transcription without it

TRUE OR FALSE: In rho-independent termination the important elements are an inverted repeat sequence directly followed by a stretch of T's on the non-template strand.

True - Rho-independent termination only needs two things: 1. inverted repeat sequence 2. string of T's in non-template Rho-dependent termination would only require inverted repeat sequence but NO string of T's.

TRUE OR FALSE: The Filter Binding Assay was used to study the binding of the E.coli sigma factor to the promoter. In this assay, DNA does not stick to nitrocellulose filter unless protein is attached to it.

True - The Filter Binding Assay has three results: 1. DNA goes through the filter (does not bind) 2. Protein sticks to the filter (binding occurs) 3. DNA-protein complex sticks to the filter paper (binding occurs)

TRUE OR FALSE: The trp repressor is synthesized in an inactive form

True - active only when there are low levels of tryptophan

TRUE OR FALSE: operons produce polycistronic RNA that makes multiple proteins

True - an operon contains a cluster of genes, not just one. This leads to polycistronic DNA that is one mRNA transcript that contains information for multiple proteins

TRUE OR FALSE: Both rho-independent and rho-dependent mechanisms of transcription termination in bacteria involve a hairpin loop structure.

True - both need hairpin structure for termination of transcription (only rho-independent need the inverted repeats)

TRUE OR FALSE: genes that are constitutively expressed are always on.

True - definition of constitutively expresses genes

TRUE OR FALSE: A gene under negative regulation is expressed unless it is repressed.

True - negative regulation uses repressor to stop

TRUE OR FALSE: In RNA processing, the presence of a AAUAAA by itself in the mRNA is not sufficient for polyadenylation.

True - polyadenylation needs: 1. AAUAAA sequence 2. GU/U-rich sequence ~20bps downstream

TRUE OR FALSE: The lac repressor binds to the lac operon to block transcription

True - when no lactose is present, we want to repress the lac operon and save energy; lac + repressor = no transcription

In the activity below in reference to the lac operon, indicate the activity of the operon when lactose is present. Lactose present: a) Operon activity (On/Off) _______ b) Repressor bound ________(Yes/No) c) Inducer bound ________ (Yes/No)

a) Operon activity (On/Off) __On_____ b) Repressor bound ___No_____(Yes/No) c) Inducer bound ____Yes____ (Yes/No) - inducer binds to repressor, changing its conformation so it can't bind to the operator, allowing transcription to continue, meaning the operon has activity and is derepressed.

In the activity below in reference to the trp operon, when tryptophan is low: a) Operon activity (On/Off) _______ b) Repressor bound ________(Yes/No) c) Inducer bound ________ (Yes/No)

a) Operon activity (On/Off) ____On___ b) Repressor bound ____No____(Yes/No) c) Inducer bound ____No____ (Yes/No) - repressor works with inducer

Pre-mRNA splicing does NOT involve which of the following structural features? a. 5′ cap b. Branch site c. 3′ splice site d. 5′ splice site e. All of these structural features are involved in pre-mRNA splicing.

a. 5′ cap -Pre-mRNA splicing has: >> a branch site >> 3' splice site >> 5' splice site - the functions of the 5' cap are: >>enhancing transport of mRNA to cytoplasm by transport proteins >>enhancing translation of mRNA >>allows for the proper splicing of mRNA >>protects mRNA from degradation

In a Nitrocellulose filter-binding assay (select ALL correct statements): a. DNA by itself is able to flow through to the filtrate b. Protein by itself binds to the filter c. The DNA-protein complex binds to the filter d. The DNA-protein complex flows through to the filtrate e. Protein by itself is able to flow through to the filtrate

a. DNA by itself is able to flow through to the filtrate b. Protein by itself binds to the filter c. The DNA-protein complex binds to the filter

Which of the following is unimportant for the recognition of the promoter by sigma factor? a. The -35 box b. The spacing between the -10 box and the -35 box c. The -10 box d. The sequence of the region between the -10 box and the -35 box

d. The sequence of the region between the -10 box and the -35 box - -10 and -35 boxes recognize core promoter - spacing between the boxes have to be the same - the sequence between the boxes doesn't matter as it will differ among sequences

A maintenance methyltransferase: a. acts on unmethylated DNA. b. acts on DNA strands in which only some CpG islands are methylated. c. acts on fully methylated DNA. d. acts on hemi-methylated DNA. e. removes methyl groups.

d. acts on hemi-methylated DNA. - the original strand will have the methylation and the new strand won't so a methyl group needs to be added to that strand.

Transcription activation via a remodeling complex often involves: a. histone deacetylation. b. recruiting an activator to a promoter. c. DNA methylation. d. displacing nucleosomes from a promoter. e. breaking apart nucleosomes.

d. displacing nucleosomes from a promoter. - Chromatin Remodeling Complexes >> Nucleosome sliding >> Remodeled nucleosomes >> Nucleosome displacement >> Nucleosome replacement

Choose the correct statement about histones: a. histones are negatively charged b. the histone tail can only be acetylated c. histone modifications are permanent and can never be removed d. histones are positively charged

d. histones are positively charged - histone modifications are reversible and not permanent -lysine of the histone tail is acetylated - DNA is negatively charged, not the histone

For the lac operon, _______ is the repressor, ______ is the inducer and_______ is the activator.

repressor - LacI inducer - allolactose activator - cAMP/CAP complex

What are two methods to study protein/polymerase binding to DNA?

1. Filter Binding Assays: protein binds to filter, DNA-protein complex binds to filter, DNA goes through filter. 2. DNase Footprinting Assays: - sigma (-10 to -35) - alpha (-35 to -60) - holoenzyme (all subunits)

What type of gene expression is being measured with a Northern Blot and with Nuclear Run-On?

1. Northern Blotting - mRNA abundance 2. Nuclear Run-On - transcription rate

What two cellular conditions must be met for transcription of the lac operon to occur?

1. there must be a high level of lactose. 2. there must be a low level of glucose.

All chromatin remodeling complexes have a subunit for ________ that is required for function.

ATPase - all chromatin remodeling complexes are ATP dependent.

Match each protein with its function: TFIID

Blinds to the TATA box to help recruit the RNA polymerase to the promoter

Chromatin remodeling complexes do not contain DNA-binding motifs. How are they able to affect chromatin structure?

Chromatin remodeling complexes cannot bind directly to DNA so the DNA-binding motifs must be recruited by DNA-binding proteins, such as activators and promotors.

What is the consensus sequence from the list of sequences below? TAGGACT TCGCAGA AAGCTCG TACCAAG TTCCTCG

Consensus sequences: the sequence in the nucleotides that occurs most (vertically) Answer: TAGCACG

Match each protein or molecule with its function: Okazaki fragments

DNA fragments found on the lagging strand

Match each protein or molecule with its function: DNA pol I

Erases RNA primer and fills gaps with DNA bases

TRUE OR FALSE: In eukaryotes, gene expression is repressed when there is CG methylation in the gene body or the histone tails are acetylated.

False - DNA methylation in the gene body is involved in activation - if the histone tails are acetylated, that is associated with activation, not repression.

TRUE OR FALSE: In the lac operon, a mutation in the operator would allow stronger binding of the repressor, resulting in constitutive expression of lacZYA.

False - a mutation would not allow binding at repressor at all - resulting in constitutive expression of lacZYA is true but the 1st part is wrong, making the whole thing false.

TRUE OR FALSE: Bromodomain and chromodomain containing proteins function to remove the modification of histone tails.

False - bromodomain and chromodomain containing proteins are reader protein that read proteins - writer proteins modify histone tails not reader proteins - eraser proteins remove the modification

TRUE OR FALSE: Bacterial and eukaryotic RNA polymerase share this similar function, both can read DNA to find the promotor sequence.

False - Bacterial RNA pol can read DNA to find the promoter because it can bind directly to it with the sigma factor but eukaryotic RNA pol must use transcription factors because it cannot bind directly to the DNA

TRUE OR FALSE: Chromatin Immunoprecipitation followed by sequencing (ChIP-seq) is an in-vivo method that allows for the identification of all the sites in a genome free of a transcription regulator.

False - Chromatin Immunoprecipitation shows where the protein is bound

TRUE OR FALSE: General transcription factors for RNA polymerase II bind to the TATA box as a single initiation complex.

False - General transcription factors create 4 pre-imitation complexes and puts them together into one initiation complex (it doesn't start as a single initiation complex)

TRUE OR FALSE: Histone code hypothesis states that gene regulation is partly dependent on histone modification that occur on the DNA found in nucleosomes.

False - Histone code hypothesis state that gene regulation is partly dependent on histone modifications that primarily occur on histone tails.

TRUE OR FALSE: Bacteria RNA polymerase binds to the TSS to begin transcription.

False - RNA polymerase binds to the promotor (-10 to -35)

TRUE OR FALSE: RNA polymerase is only made of one protein subunit

False - a protein complex made of multiple protein subunits >>sigma factors >>beta and beta' >>alpha I and alpha II >>omega

TRUE OR FALSE: General transcription factors function to activate gene expression above the basal level of expression,

False - activators and enhancers get you beyond basal level.

TRUE OR FALSE: Constitutively expressed genes are rarely expressed

False - constitutively expressed genes are always expressed

TRUE OR FALSE: In RNA processing a poly(A) tail is made by transcribing DNA containing runs of T's (50-250bp).

False - formed through polyadenylation by an enzyme poly-A polymerase (no template; added after transcription)

TRUE OR FALSE: if a nucleosome covers a promoter, there are higher levels of transcription

False - nucleosomes (are made up of histones) prevent transcription (think about how the DNA is wound around the histones tightly)

TRUE OR FALSE: Regulated genes are always repressed.

False - regulated genes are expressed only when needed; can be induced OR repressed

TRUE OR FALSE: The C-Terminal Domain (CTD) of the sigma factor is used to bind the UP element to promoters.

False - the CTD of the ALPHA-subunit is used to bind to the UP element, not the sigma factor

TRUE OR FALSE: one major function of the 5' cap of a eukaryotic mRNA is to provide a binding site for RNA polymerase.

False - the functions of the 5' cap are: - enhancing transport of mRNA to cytoplasm by transport proteins - enhancing translation of mRNA - allows for the proper splicing of mRNA - protects mRNA from degradation

TRUE OR FALSE: The newly synthesized RNA contains the promotor, TSS, coding region and TSS.

False - the promoter is not transcribed into the RNA

TRUE OR FALSE: coactivator and corepressor proteins function by binding directly to DNA and regulating gene expression..

False - they don't bind to DNA, they interact with promotors who then bind to the DNA

Match each protein or molecule with its function: DNA ligase

Joins the ends of DNA

What is the basic subunit of chromatin?

Nucleosome - made up of a coil of DNA wound around a histone core.

Match each protein or molecule with its function: DnaA protein

Recognizes oriC and opens DNA at specific sites

Match each protein or molecule with its function: Topoisomerase

Relaxes supercoils by nick and repair of DNA

Match each protein or molecule with its function: Telomerase

Reverse transcriptase that carries an RNA template to direct DNA synthesis

Match each protein with its function: TFIIF

Similar to the prokaryotic sigma factor because it guides the RNA polymerase to the pre-initiation complex

Match each protein or molecule with its function: SSB (single-stranded binding proteins)

Stabilizes single-stranded regions

Match each protein or molecule with its function: DNA pol III

Synthesizes DNA during DNA replication

Match each protein or molecule with its function: Primase (DnaG)

Synthesizes RNA primers

In eukaryotic cells, assembly of basal transcription factors via TBP usually begins at ___________ sequence in the promotor.

TATA box

Which subunit within the TFIID protein complex binds to the TATA box?

TBP (TATA box binding protein); it is part of TFIID, not separate.

Which TF is responsible for binding first to the promotor?

TFIID - recognizes the promotor and binds first before anything else gets assembled. WITHOUT TFIID, NOTHING HAPPENS

You performed a DNA footprinting assay to see if your protein of interest binds to a sequence of DNA. The results of your assay are shown in the image. Which corresponding region of the gel (labeled by A, B, C) shows where your protein is bound? (can't add the picture)

The region of the gel that shows where the protein is bound is the protected region where no bands are present.

Match each protein with its function: RNA pol II

Transcribes protein-coding genes in eukaryotes

TRUE OR FALSE: Attenuation is the formation of a hairpin in an mRNA that is needed for intrinsic termination.

True - Intrinsic terminator = rho-independent termination >> Hairpin structure (caused by inverted repeats) >>string of U's (T-rich region in non-template strand)

TRUE OR FALSE: Histone acetylation is always associated with gene activation.

True - histone acetylation weakens DNA-nucleosome associations - reduces the overall positive charge of histone tails (remember that DNA is negatively charged, neutralizing the positive charge of the histone tail reduces the attraction between the tail and the DNA, allowing DNA to relax)

TRUE OR FALSE: Both DNA and RNA synthesis goes from 5' to 3'

True - no reason, it just is.

TRUE OR FALSE: the oriC site is AT rich

True - AT has a weaker bond (2 OH bonds compared to GC with 3 OH bonds), so its weaker to "break" open for replication

Which statement describes the relationship between methylation and gene activity? a. DNA methylation is generally associated with transcriptional inactivity. b. DNA methylation is generally associated with translational inactivity. c. DNA methylation is generally associated with transcriptional activity. d. Histone methylation is generally associated with transcriptional inactivity. e. Histone methylation is generally associated with transcriptional activity.

a. DNA methylation is generally associated with transcriptional inactivity. - i don't know why but i think it could be because methyl groups prevent cleavage in DNA or because methyl groups make the histone tails too bulky - methylation in the gene body = activation methylation in the DNA = inhibition

After a histone acetyltransferase modifies a histone tail, please choose a likely next event: a. a chromodomain-containing transcription factor binds the modified nucleosomes and then binds a DNA element in the underlying DNA b. A bromodomain-containing transcription factor binds the modified nucleosomes and then binds a DNA element in the underlying DNA c. A bromodomain in the CTD of RNA polymerase II binds to the chromatin and then associates with the core promoter. A histone acetyltransferase modifies some chromatin d. A chromodomain in the CTD of RNA polymerase II binds to the chromatin and then associated with the core promoter. A histone acetyltransferase modifies some chromatin.

b. A bromodomain-containing transcription factor binds the modified nucleosomes and then binds a DNA element in the underlying DNA - Histone acetyltransferase (HATs) = bromodomain - binds to modified histone but not able to bind directly to DNA so needs to recruit remodeling complexes

Select the correct statement about the regulation of the lac operon: a. HIGH cellular glucose levels will lead to HIGH transcription of the lac operon due to HIGH cAMP levels b. LOW cellular glucose levels will lead to HIGH transcription of the lac operon due to the HIGH cAMP levels c. LOW cellular glucose levels will lead to LOW transcription of the lac operon due to LOW cAMP levels d. HIGH cellular glucose levels will lead to HIGH transcription of the lac operon due to LOW cAMP levels

b. LOW cellular glucose levels will lead to HIGH transcription of the lac operon due to the HIGH cAMP levels -cAMP is produced when glucose is low, making the cAMP-CAP complex and lac operon activity

An enhancer ______ the gene it affects. a. must be upstream from b. can be very distant from c. cannot be within an intron of d. must be in the same orientation as e. must be downstream from

b. can be very distant from - frequently found upstream but not a rule - enhancers are position- and orientation- independent -enhancers can be within introns

Which of the following is true about chromatin organization at active promoters? a. it contains a high density of nucleosomes b. most active promoters are free of nucleosomes c. DNA of promoters is heavily methylated d. histone H3 is methylated at the K9 position

b. most active promoters are free of nucleosomes - nucleosomes prevent transcription

When tryptophan levels are high: a. there is no effect on the trp operon b. the trp operon is repressed c. the repressor is removed from the trp operon d. the trp operon is activated

b. the trp operon is repressed - trp operon only turns one when there are low levels of tryptophan

Transcription activator/factor proteins always have two domains: a) Dimerization domain and Activation domain b) Repressor domain and DNA-binding domain c) DNA binding domain and Activation domain d) Activation domain and Hormone binding domain

c) DNA binding domain and activation domain - transcription activators/factor proteins have at least two domains: >>DNA-binding domain (always) >>Activation domain (always) >>Dimerization domain (often, not always) >>Binding sites for hormones, etc. (sometimes)

You are tasked with performing an experiment to determine whether E.coli RNA polymerase binds to the region upstream of the gene encoding Beta Galatosiadase that contains UP elements in the promoter. You decided to use one of the two Protein/DNA assays you have recently learned so you perform a DNase I Footprinting Assay. You have mixed either the sigma factor, alpha subunits, beta subunits, no protein or the Holoenzyme with the DNA, then added DNase I. You next ran the Acrylamide gel below. What was added in Lane B, D and F? (could not upload picture) a. Lane B Holoenzyme; Lane D no polymerase; Lane F sigma factor b. Lane B sigma factor: Lane D alpha subunit; Lane F Holoenzyme c. Lane B alpha subunit; Lane D sigma factor: Lane F Holoenzyme d. Lane B alpha subunit; Lane D holoenzyme; Lane F no polymerase

c. Lane B alpha subunit; Lane D sigma factor: Lane F Holoenzyme - alpha subunit: -35 to -60 - sigma factor: -10 to -35 - holoenzyme: all the subunits

In the image below (image is in the definition part), IFN-beta mRNA is produced starting at 6h (Lane 7) but not before, why? a. The four histone modifications a-acH4 (K5, K8, K12, K16) are only found at the promoter at 6h. b. a-acH3 K9 is only found at the promoter at 6h c. a-TBP is only recruited to the promoter at 6h. d. a-phH3 S10 is only found at the promoter at 6h

c. a-TBP is only recruited to the promoter at 6h. - the acetylation of lysine 14 of H3 (H3K14) is required to recruit TBP to the promoter

Which statement best describes the role of the E. coli RNA polymerase? a. sigma factor is responsible for catalyzing the formation of phosphodiester bonds during RNA polymerization. b. Sigma factor shuttles cytoplasmic RNA polymerase to promotor sequences. c. Sigma factor increases the affinity of RNA polymerase for promotor sequences. d. sigma factor actively removes core enzyme from DNA and attaches it to a promotor.

c. sigma factor increases the affinity of RNA polymerase for promotor sequences. - sigma factor functions to enhance binding to DNA

Consider the mRNA sequence: 5'-AAUGCAGCUUUAGCA-3'. What is the sequence and orientation of the coding (sense) strand of DNA? a. 5'AAUGCAGCUUUAGCA3' b. 5'ACGATTCGACGTAA3' c. 3'TTACGTCGAAATCGA5' d. 5'AATGCAGCTTTAGCA3'

d. 5'AATGCAGCTTTAGCA3' - the coding strand is the sense strand - the template strand is the antisense strand - in this case, we are given the template (antisense) strand so basically all that needs to be done is change the U's to T's since its asking for DNA

What two domains do transcription factors always have? a. RNA-binding domain and a dimerization domain b. Translation domain and a transcription domain c. Alpha domain and a sigma domain d. DNA-binding domain and an activation domain

d. DNA-binding domain and an activation domain - transcription activators/factor proteins have at least two domains: >>DNA-binding domain (always) >>Activation domain (always) >>Dimerization domain (often, not always) >>Binding sites for hormones, etc. (sometimes)

Acetyl groups added to histone tails function to activate transcription because: a. they increase the affinity of the histones for DNA b. they can never be removed c. they enhance the positive charge of the histone tail, allowing DNA to condone d. they neutralize the positive charge of the histone tail, allowing DNA to relax

d. they neutralize the positive charge of the histone tail, allowing DNA to relax - relaxed DNA is what is wanted for transcription

One major difference between bacterial and eukaryotic RNA polymerase is that: a. prokaryotes have several RNA polymerases. b. eukaryotic RNA polymerase can polymerize RNA in the 3′ to 5′ direction. c. prokaryotic RNA polymerase recognizes several different promoters. d. eukaryotic RNA polymerase has only one polypeptide. e. eukaryotic RNA polymerase cannot read DNA to find the promoter sequence.

e. eukaryotic RNA polymerase cannot read DNA to find the promoter sequence. - needs general transcription factors

in the lac operon, in the absence of the inducer, the: a. repressed gene is not transcribed b. genes encoding enzymes are not transcribed c. repressed gene is not translated d. repressor cannot bind to the operator e. genes encoding enzymes are not transcribed

e. genes encoding enzymes are not transcribed - in the absence of the inducer, the repressor is bound = no operon activity

In the gene sequence below, what type of termination will be used to terminate transcription? 5' ATGTGCTACGAAGTTCGTAATCCTCAGT 3' 3' TACACGATGCTTCAAGCATTAGGAGTCA 5'

inverted repeats 5' TACGAAGTTCGTA 3' 3' ATGCTTCAAGCAT 5'